CircRNA Information

General Information
circRNA Basic Information
CircID chr4:121847404|121854820
Strand -
CircType exon
Host Gene ENSG00000138686.9;
Algorism find_circ;CIRI2;DCC;
Sequence GTGACTCTGGAGAAGACCTTTTGTTTGGGACATCAGACGGAAAACTTGCGCTTATACAGATTACTACATCCAAACCAGTACGCAAGTGGGAAATTCAAAATGAGAAAAAGAGAGGAG
circRNA Expression in different cancers

by boxplot.py
circRNA-miRNA-gene regulatory network
Target miRNAs
CircID miRNA PITA miRanda targetScan
Target Genes
       

Note about Function Analysis:
We also provide this interface that can help researchers to perform GO, KEGG and disease enrichment analysis easily. This function will take around 30 seconds. After the analysis, this page will automatically jump to the result page.

Target miRNA Expression in different cancers

circRNA Open Reading Frame (ORF)
RNA Binding Protein (RBP) of circRNA
CircID RBP Number of Upstream Sites Number of Downstream Sites Number of Circ Exons Sites
chr4:121847404|121854820 U2AF2 13 6 2
chr4:121847404|121854820 MOV10 0 1 0
chr4:121847404|121854820 FUS 1 0 0
chr4:121847404|121854820 PRPF8 0 1 0
chr4:121847404|121854820 UPF1 0 1 0
chr4:121847404|121854820 TAF15 0 2 0
chr4:121847404|121854820 FMR1 1 0 1
chr4:121847404|121854820 AGO2 0 1 0
chr4:121847404|121854820 SRSF1 2 0 1
chr4:121847404|121854820 U2AF1 0 0 1
chr4:121847404|121854820 NOP56 0 1 0
chr4:121847404|121854820 DDX54 0 0 2
chr4:121847404|121854820 RBM10 1 1 0
chr4:121847404|121854820 HNRNPC 5 0 0
chr4:121847404|121854820 TRA2A 1 0 0
chr4:121847404|121854820 LIN28B 2 0 0
chr4:121847404|121854820 FXR1 1 0 0
chr4:121847404|121854820 IGF2BP1 0 0 1
chr4:121847404|121854820 IGF2BP3 1 0 0
chr4:121847404|121854820 IGF2BP2 1 0 0
chr4:121847404|121854820 CSTF2T 0 0 1
chr4:121847404|121854820 AIFM1 1 0 0
chr4:121847404|121854820 EIF4A3 2 4 1
chr4:121847404|121854820 FBL 1 1 1