CircNet

General Information

circRNA Basic Information

CircID	chr4:78844928\|78865720
Strand	+
CircType	exon
Host Gene	ENSG00000138756.17;
Algorism	find_circ;CIRI2;DCC;
Sequence	GTAGAAAATATTTTGTTGAATGATGGTGGGAACTATGTACTTTGTGACTTTGGCAGTGCCACTAATAAATTTCTTAATCCTCAAAAAGATGGAGTTAATGTAGTAGAAGAAGAAATTAAAAA

circRNA Expression in different cancers

circRNA-miRNA-gene regulatory network

Target miRNAs

CircID	miRNA	PITA	miRanda	targetScan
chr4:78844928\|78865720	hsa-miR-136-5p	0	1	1
chr4:78844928\|78865720	hsa-miR-224-5p	0	1	1

Target Genes

Note about Function Analysis:
We also provide this interface that can help researchers to perform GO, KEGG and disease enrichment analysis easily. This function will take around 30 seconds. After the analysis, this page will automatically jump to the result page.

Target miRNA Expression in different cancers

circRNA Open Reading Frame (ORF)

RNA Binding Protein (RBP) of circRNA

CircID	RBP	Number of Upstream Sites	Number of Downstream Sites	Number of Circ Exons Sites
chr4:78844928\|78865720	NOP56	0	1	0
chr4:78844928\|78865720	FUS	0	4	1
chr4:78844928\|78865720	CELF2	1	0	0
chr4:78844928\|78865720	PRPF8	0	5	0
chr4:78844928\|78865720	NOP58	0	1	1
chr4:78844928\|78865720	U2AF2	3	11	4
chr4:78844928\|78865720	DDX54	0	0	1
chr4:78844928\|78865720	HNRNPC	0	1	0
chr4:78844928\|78865720	HNRNPA1	1	1	0
chr4:78844928\|78865720	LIN28A	0	0	1
chr4:78844928\|78865720	IGF2BP1	0	1	0
chr4:78844928\|78865720	IGF2BP3	0	0	1
chr4:78844928\|78865720	IGF2BP2	1	2	0
chr4:78844928\|78865720	NPM1	1	0	0
chr4:78844928\|78865720	BUD13	0	2	0
chr4:78844928\|78865720	KHSRP	0	4	1
chr4:78844928\|78865720	RBM47	1	1	1
chr4:78844928\|78865720	RBM22	0	1	0
chr4:78844928\|78865720	XRN2	0	2	0
chr4:78844928\|78865720	AGO2	0	2	2
chr4:78844928\|78865720	EIF4A3	1	2	2
chr4:78844928\|78865720	FBL	0	1	0

CircRNA Information