CircNet

General Information

circRNA Basic Information

CircID	chr4:83045626\|83049984
Strand	+
CircType	exon
Host Gene	ENSG00000138663.8;
Algorism	find_circ;CIRI2;DCC;
Sequence	GTATCGTCAGATCCTGGAAAAAGCCATTCAGTTATCTGGAGCAGAACAACTAGAAGCTTTGAAAGCTTTTGTGGAAGCAA

circRNA Expression in different cancers

circRNA-miRNA-gene regulatory network

Target miRNAs

CircID	miRNA	PITA	miRanda	targetScan

Target Genes

Note about Function Analysis:
We also provide this interface that can help researchers to perform GO, KEGG and disease enrichment analysis easily. This function will take around 30 seconds. After the analysis, this page will automatically jump to the result page.

Target miRNA Expression in different cancers

circRNA Open Reading Frame (ORF)

RNA Binding Protein (RBP) of circRNA

CircID	RBP	Number of Upstream Sites	Number of Downstream Sites	Number of Circ Exons Sites
chr4:83045626\|83049984	U2AF2	3	4	0
chr4:83045626\|83049984	FUS	1	0	0
chr4:83045626\|83049984	ZNF184	0	1	0
chr4:83045626\|83049984	KHDRBS1	0	1	0
chr4:83045626\|83049984	PRPF8	0	2	0
chr4:83045626\|83049984	TAF15	0	3	0
chr4:83045626\|83049984	CPSF1	0	1	0
chr4:83045626\|83049984	ELAVL1	2	1	0
chr4:83045626\|83049984	DGCR8	0	1	0
chr4:83045626\|83049984	SRSF1	1	1	1
chr4:83045626\|83049984	NOP58	0	2	0
chr4:83045626\|83049984	ADAR	1	1	0
chr4:83045626\|83049984	NOP56	0	3	0
chr4:83045626\|83049984	SRSF9	1	1	0
chr4:83045626\|83049984	HNRNPU	0	2	0
chr4:83045626\|83049984	DDX54	1	0	2
chr4:83045626\|83049984	HNRNPA2B1	0	2	0
chr4:83045626\|83049984	DHX9	0	2	0
chr4:83045626\|83049984	DDX3X	2	1	2
chr4:83045626\|83049984	HNRNPA1	0	3	0
chr4:83045626\|83049984	FXR2	1	0	0
chr4:83045626\|83049984	SND1	0	1	0
chr4:83045626\|83049984	IGF2BP2	0	1	1
chr4:83045626\|83049984	HNRNPUL1	0	1	0
chr4:83045626\|83049984	BUD13	1	0	1
chr4:83045626\|83049984	BCCIP	0	1	0
chr4:83045626\|83049984	SAFB2	0	1	0
chr4:83045626\|83049984	EIF4A3	0	0	2
chr4:83045626\|83049984	FBL	0	1	0

CircRNA Information