CircNet

General Information

circRNA Basic Information

CircID	chr4:98352476\|98421394
Strand	+
CircType	exon
Host Gene	ENSG00000138698.14;
Algorism	find_circ;CIRI2;DCC;
Sequence	AGTTTATGCGAATTCCATGTGTGGATGCTGGATTGATTTCACCACTGGTGCAGCTGCTAAATAGCAAAGACCAGGAAGTGCTGCTTCAAACGGGCAGGGCTCTAGGAAACATATGTTACGATAGCC

circRNA Expression in different cancers

circRNA-miRNA-gene regulatory network

Target miRNAs

CircID	miRNA	PITA	miRanda	targetScan

Target Genes

Note about Function Analysis:
We also provide this interface that can help researchers to perform GO, KEGG and disease enrichment analysis easily. This function will take around 30 seconds. After the analysis, this page will automatically jump to the result page.

Target miRNA Expression in different cancers

circRNA Open Reading Frame (ORF)

RNA Binding Protein (RBP) of circRNA

CircID	RBP	Number of Upstream Sites	Number of Downstream Sites	Number of Circ Exons Sites
chr4:98352476\|98421394	DGCR8	1	0	0
chr4:98352476\|98421394	FAM120A	0	0	1
chr4:98352476\|98421394	SRSF1	0	0	2
chr4:98352476\|98421394	ELAVL1	1	0	0
chr4:98352476\|98421394	AUH	1	0	0
chr4:98352476\|98421394	ACIN1	0	0	1
chr4:98352476\|98421394	SRSF9	0	0	1
chr4:98352476\|98421394	LIN28B	0	0	4
chr4:98352476\|98421394	DDX54	1	0	2
chr4:98352476\|98421394	FUS	0	1	0
chr4:98352476\|98421394	PRPF8	0	0	1
chr4:98352476\|98421394	FXR2	0	0	1
chr4:98352476\|98421394	FBL	0	1	0
chr4:98352476\|98421394	U2AF2	2	0	0
chr4:98352476\|98421394	IGF2BP1	0	0	1
chr4:98352476\|98421394	DDX3X	1	0	1
chr4:98352476\|98421394	IGF2BP3	0	0	1
chr4:98352476\|98421394	IGF2BP2	1	2	3
chr4:98352476\|98421394	EIF4A3	1	2	2
chr4:98352476\|98421394	AGO2	0	0	1

CircRNA Information