CircNet

General Information

circRNA Basic Information

CircID	chr5:134705327\|134708888
Strand	+
CircType	exon
Host Gene	ENSG00000113615.12;
Algorism	find_circ;CIRI2;DCC;
Sequence	GCGAAAGAAGAATTCGTGTTCATACTTTGTGTTTGCCAGTAGTTTCGACTCTGAATGATGTCTTTCTTGGAGCTGATGTTCAAGCAATTTCAGGGTTATTGGCCAATATGG

circRNA Expression in different cancers

circRNA-miRNA-gene regulatory network

Target miRNAs

CircID	miRNA	PITA	miRanda	targetScan

Target Genes

Note about Function Analysis:
We also provide this interface that can help researchers to perform GO, KEGG and disease enrichment analysis easily. This function will take around 30 seconds. After the analysis, this page will automatically jump to the result page.

Target miRNA Expression in different cancers

circRNA Open Reading Frame (ORF)

RNA Binding Protein (RBP) of circRNA

CircID	RBP	Number of Upstream Sites	Number of Downstream Sites	Number of Circ Exons Sites
chr5:134705327\|134708888	NOP56	0	1	0
chr5:134705327\|134708888	ELAVL1	0	1	0
chr5:134705327\|134708888	FAM120A	0	1	0
chr5:134705327\|134708888	PRPF8	0	1	0
chr5:134705327\|134708888	SRSF1	0	0	1
chr5:134705327\|134708888	NOP58	1	0	0
chr5:134705327\|134708888	U2AF2	3	3	0
chr5:134705327\|134708888	SRSF9	0	0	1
chr5:134705327\|134708888	DDX54	1	0	1
chr5:134705327\|134708888	LSM11	0	1	0
chr5:134705327\|134708888	HNRNPL	1	0	0
chr5:134705327\|134708888	HNRNPA2B1	0	0	1
chr5:134705327\|134708888	PTBP1	0	0	1
chr5:134705327\|134708888	DHX9	0	1	0
chr5:134705327\|134708888	ACIN1	0	0	2
chr5:134705327\|134708888	SMNDC1	2	0	0
chr5:134705327\|134708888	HNRNPA1	1	2	0
chr5:134705327\|134708888	LIN28B	0	0	4
chr5:134705327\|134708888	FXR1	0	0	1
chr5:134705327\|134708888	SND1	1	0	0
chr5:134705327\|134708888	IGF2BP2	1	1	0
chr5:134705327\|134708888	BUD13	1	1	0
chr5:134705327\|134708888	RBM47	0	1	0
chr5:134705327\|134708888	RBM27	0	1	0
chr5:134705327\|134708888	EIF4A3	0	3	2
chr5:134705327\|134708888	AGO2	0	0	1

CircRNA Information