CircNet

General Information

circRNA Basic Information

CircID	chr5:171899004\|171997051
Strand	-
CircType	exon
Host Gene	ENSG00000072803.17;
Algorism	find_circ;CIRI2;DCC;
Sequence	GGATCAGTACCTGTTTAAAAACAGACCCACAGATGGCCCTCCAAATTCATTTTATAGGTCATTATACCCAAAGATTATCCAGGATATAGAG

circRNA Expression in different cancers

circRNA-miRNA-gene regulatory network

Target miRNAs

CircID	miRNA	PITA	miRanda	targetScan

Target Genes

Note about Function Analysis:
We also provide this interface that can help researchers to perform GO, KEGG and disease enrichment analysis easily. This function will take around 30 seconds. After the analysis, this page will automatically jump to the result page.

Target miRNA Expression in different cancers

circRNA Open Reading Frame (ORF)

RNA Binding Protein (RBP) of circRNA

CircID	RBP	Number of Upstream Sites	Number of Downstream Sites	Number of Circ Exons Sites
chr5:171899004\|171997051	NOP56	1	2	0
chr5:171899004\|171997051	ELAVL1	13	3	0
chr5:171899004\|171997051	CELF2	1	0	0
chr5:171899004\|171997051	CNBP	2	0	0
chr5:171899004\|171997051	PRPF8	0	1	0
chr5:171899004\|171997051	TAF15	2	1	0
chr5:171899004\|171997051	CPSF6	1	0	0
chr5:171899004\|171997051	CPSF3	2	0	0
chr5:171899004\|171997051	FUS	2	1	0
chr5:171899004\|171997051	NOP58	0	2	0
chr5:171899004\|171997051	U2AF2	10	7	0
chr5:171899004\|171997051	DDX54	0	0	1
chr5:171899004\|171997051	RBM10	1	0	0
chr5:171899004\|171997051	HNRNPM	1	0	0
chr5:171899004\|171997051	FIP1L1	3	0	0
chr5:171899004\|171997051	PTBP1	8	0	0
chr5:171899004\|171997051	HNRNPC	63	1	0
chr5:171899004\|171997051	DHX9	1	0	0
chr5:171899004\|171997051	ZC3H7B	3	0	0
chr5:171899004\|171997051	MSI1	1	0	0
chr5:171899004\|171997051	HNRNPA1	9	0	0
chr5:171899004\|171997051	LIN28B	0	2	0
chr5:171899004\|171997051	FXR2	0	0	1
chr5:171899004\|171997051	IGF2BP2	0	1	1
chr5:171899004\|171997051	RBFOX2	8	0	0
chr5:171899004\|171997051	RBM47	0	1	1
chr5:171899004\|171997051	CSTF2	1	0	0
chr5:171899004\|171997051	RBM22	0	1	0
chr5:171899004\|171997051	DKC1	1	0	0
chr5:171899004\|171997051	ALKBH5	1	0	0
chr5:171899004\|171997051	EWSR1	0	1	0
chr5:171899004\|171997051	EIF4A3	4	1	1
chr5:171899004\|171997051	FBL	1	0	0

CircRNA Information