CircNet

General Information

circRNA Basic Information

CircID	chr5:62362450\|62373837
Strand	+
CircType	exon
Host Gene	ENSG00000068796.16;
Algorism	find_circ;CIRI2;DCC;
Sequence	ATTGCCACAATCTCTCCAGGAATGGCATCCTGTGAAAATACTCTTAATACATTAAGATATGCAAATAG

circRNA Expression in different cancers

circRNA-miRNA-gene regulatory network

Target miRNAs

CircID	miRNA	PITA	miRanda	targetScan

Target Genes

Note about Function Analysis:
We also provide this interface that can help researchers to perform GO, KEGG and disease enrichment analysis easily. This function will take around 30 seconds. After the analysis, this page will automatically jump to the result page.

Target miRNA Expression in different cancers

circRNA Open Reading Frame (ORF)

RNA Binding Protein (RBP) of circRNA

CircID	RBP	Number of Upstream Sites	Number of Downstream Sites	Number of Circ Exons Sites
chr5:62362450\|62373837	DHX9	1	1	0
chr5:62362450\|62373837	HNRNPC	2	0	0
chr5:62362450\|62373837	DICER1	1	0	0
chr5:62362450\|62373837	NOP58	1	3	0
chr5:62362450\|62373837	FBL	0	1	0
chr5:62362450\|62373837	RBM47	1	0	0
chr5:62362450\|62373837	HNRNPA1	0	1	0
chr5:62362450\|62373837	U2AF2	17	1	5
chr5:62362450\|62373837	NOP56	2	0	0
chr5:62362450\|62373837	DDX54	0	0	1
chr5:62362450\|62373837	RBM10	2	0	0
chr5:62362450\|62373837	RBM22	2	0	0
chr5:62362450\|62373837	SRSF10	1	0	0
chr5:62362450\|62373837	TAF15	1	0	0
chr5:62362450\|62373837	FMR1	1	0	1
chr5:62362450\|62373837	MOV10	1	0	0
chr5:62362450\|62373837	IGF2BP3	0	0	1
chr5:62362450\|62373837	IGF2BP2	2	3	1
chr5:62362450\|62373837	EIF4A3	3	2	1
chr5:62362450\|62373837	AGO2	1	0	2

CircRNA Information