CircNet

General Information

circRNA Basic Information

CircID	chr5:65460170\|65471142
Strand	-
CircType	exon
Host Gene	ENSG00000049192.14;
Algorism	find_circ;CIRI2;DCC;
Sequence	CATGGTGTTATTGCTACAGAAGATGAAGAGTATTTTATCGAACCTTTAAAGAATACCACAGAGGATTCCAAGCATTTTAGTTATGAAAATGGCCACCCTCATGTTATTTACAAAAAGTCTGCCCTTCAACAACGACATCTGTATGATCACTCTCATTGTGGGGTTTCGG

circRNA Expression in different cancers

circRNA-miRNA-gene regulatory network

Target miRNAs

CircID	miRNA	PITA	miRanda	targetScan

Target Genes

Note about Function Analysis:
We also provide this interface that can help researchers to perform GO, KEGG and disease enrichment analysis easily. This function will take around 30 seconds. After the analysis, this page will automatically jump to the result page.

Target miRNA Expression in different cancers

circRNA Open Reading Frame (ORF)

RNA Binding Protein (RBP) of circRNA

CircID	RBP	Number of Upstream Sites	Number of Downstream Sites	Number of Circ Exons Sites
chr5:65460170\|65471142	U2AF2	6	3	0
chr5:65460170\|65471142	ELAVL1	3	7	0
chr5:65460170\|65471142	PRPF8	1	1	0
chr5:65460170\|65471142	UPF1	1	0	0
chr5:65460170\|65471142	TAF15	0	1	0
chr5:65460170\|65471142	SRSF1	1	0	0
chr5:65460170\|65471142	NOP58	0	0	1
chr5:65460170\|65471142	ADAR	0	1	0
chr5:65460170\|65471142	KHSRP	0	0	2
chr5:65460170\|65471142	FIP1L1	1	1	0
chr5:65460170\|65471142	PTBP1	3	1	1
chr5:65460170\|65471142	HNRNPC	10	2	0
chr5:65460170\|65471142	HNRNPA1	2	2	0
chr5:65460170\|65471142	LIN28B	0	0	1
chr5:65460170\|65471142	IGF2BP2	0	0	1
chr5:65460170\|65471142	TARDBP	2	1	0
chr5:65460170\|65471142	BUD13	0	0	1
chr5:65460170\|65471142	CSTF2T	0	0	1
chr5:65460170\|65471142	CSTF2	0	3	4
chr5:65460170\|65471142	WDR33	2	0	2
chr5:65460170\|65471142	EIF4A3	0	2	2
chr5:65460170\|65471142	AGO2	1	0	0

CircRNA Information