CircNet

General Information

circRNA Basic Information

CircID	chr6:108447214\|108477292
Strand	+
CircType	exon
Host Gene	ENSG00000135537.16;
Algorism	find_circ;CIRI2;DCC;
Sequence	GAATATTGTAATACAGTCCAGCTAGATTCTGGGATAGATTACCGGAAAAGGGAACTTCCTGCTGCAGGAAAACTCTACTACCTCACAAGTGAAGCTGATGTGGAGGCTGTCATGGATAAGTTGTTTGATGAGCTGGCTCAGAAACAAAATGATTTAACTAGACCAAGGATTCTAAAAGTGCAAGGCAGAGAGCTGCGCCTGAATAAAGCCTGTGGAACCGTTGCCGACTGCACATTTGAAGAGCTGTGTGAGAGA

circRNA Expression in different cancers

circRNA-miRNA-gene regulatory network

Target miRNAs

CircID	miRNA	PITA	miRanda	targetScan

Target Genes

Note about Function Analysis:
We also provide this interface that can help researchers to perform GO, KEGG and disease enrichment analysis easily. This function will take around 30 seconds. After the analysis, this page will automatically jump to the result page.

Target miRNA Expression in different cancers

circRNA Open Reading Frame (ORF)

RNA Binding Protein (RBP) of circRNA

CircID	RBP	Number of Upstream Sites	Number of Downstream Sites	Number of Circ Exons Sites
chr6:108447214\|108477292	ELAVL1	2	1	0
chr6:108447214\|108477292	HNRNPC	9	1	0
chr6:108447214\|108477292	SRSF1	0	2	3
chr6:108447214\|108477292	NOP58	0	3	1
chr6:108447214\|108477292	IGF2BP2	0	1	0
chr6:108447214\|108477292	U2AF2	0	1	1
chr6:108447214\|108477292	NOP56	0	2	0
chr6:108447214\|108477292	FUS	1	0	0
chr6:108447214\|108477292	PRPF8	0	2	0
chr6:108447214\|108477292	HNRNPL	0	1	0
chr6:108447214\|108477292	TAF15	3	0	0
chr6:108447214\|108477292	FIP1L1	1	0	0
chr6:108447214\|108477292	BUD13	0	0	1
chr6:108447214\|108477292	PTBP1	4	1	0
chr6:108447214\|108477292	TARDBP	1	0	0
chr6:108447214\|108477292	HNRNPA1	0	1	0
chr6:108447214\|108477292	EIF4A3	0	1	3
chr6:108447214\|108477292	AGO2	0	0	1

CircRNA Information