CircRNA Information

General Information
circRNA Basic Information
CircID chr6:129353164|129403959
Strand +
CircType exon
Host Gene ENSG00000196569.11;
Algorism find_circ;CIRI2;DCC;
Sequence GTGTGCCCCTGGCTATACTGGCAGTCCAGGCAACCCTGGAGGCTCCTGCCAAGAATGTGAGTGTGATCCCTATGGCTCACTGCCTGTGCCCTGTGACCCTGTCACAGGATTCTGCACGTGCCGACCTGGAGCCACGGGAAGGAAGTGTGACGGCTGCAAGCACTGGCATGCACGCGAGGGCTGGGAGTGTGTTT
circRNA Expression in different cancers

by boxplot.py
circRNA-miRNA-gene regulatory network
Target miRNAs
CircID miRNA PITA miRanda targetScan
chr6:129353164|129403959 hsa-miR-132-5p 0 1 1
Target Genes
       

Note about Function Analysis:
We also provide this interface that can help researchers to perform GO, KEGG and disease enrichment analysis easily. This function will take around 30 seconds. After the analysis, this page will automatically jump to the result page.

Target miRNA Expression in different cancers

    by mir_boxplot.py


circRNA Open Reading Frame (ORF)
RNA Binding Protein (RBP) of circRNA
CircID RBP Number of Upstream Sites Number of Downstream Sites Number of Circ Exons Sites
chr6:129353164|129403959 FUS 0 1 0
chr6:129353164|129403959 RBM47 0 2 0
chr6:129353164|129403959 CSTF2T 0 1 0
chr6:129353164|129403959 LIN28B 1 0 0
chr6:129353164|129403959 CSTF2 5 0 0
chr6:129353164|129403959 TAF15 0 2 0
chr6:129353164|129403959 DKC1 1 0 0
chr6:129353164|129403959 HNRNPC 1 0 1
chr6:129353164|129403959 EWSR1 1 0 0