CircNet

General Information

circRNA Basic Information

CircID	chr6:97145046\|97145133
Strand	-
CircType	exon
Host Gene	ENSG00000146263.10;
Algorism	CIRI2;
Sequence	ACACACACACACACACACACAAAAACACATATACACATAAATAACCTCTTTAAAGGCATCACCTTAAATAGATAAAACTCCTTAGTGA

circRNA Expression in different cancers

circRNA-miRNA-gene regulatory network

Target miRNAs

CircID	miRNA	PITA	miRanda	targetScan
chr6:97145046\|97145133	hsa-miR-18a-5p	0	0	1
chr6:97145046\|97145133	hsa-miR-18a-3p	0	0	1
chr6:97145046\|97145133	hsa-miR-154-5p	0	0	1
chr6:97145046\|97145133	hsa-miR-154-3p	0	0	1
chr6:97145046\|97145133	hsa-miR-18b-5p	0	0	1
chr6:97145046\|97145133	hsa-miR-18b-3p	0	0	1
chr6:97145046\|97145133	hsa-miR-583	0	0	1
chr6:97145046\|97145133	hsa-miR-599	0	0	1
chr6:97145046\|97145133	hsa-miR-1276	0	0	1
chr6:97145046\|97145133	hsa-miR-532-5p	0	0	1
chr6:97145046\|97145133	hsa-miR-147	0	0	1
chr6:97145046\|97145133	hsa-miR-297	1	0	0
chr6:97145046\|97145133	hsa-miR-4653-3p	1	0	0
chr6:97145046\|97145133	hsa-miR-574-5p	0	1	0
chr6:97145046\|97145133	hsa-miR-655-5p	1	1	0

Target Genes

Note about Function Analysis:
We also provide this interface that can help researchers to perform GO, KEGG and disease enrichment analysis easily. This function will take around 30 seconds. After the analysis, this page will automatically jump to the result page.

Target miRNA Expression in different cancers