CircNet

General Information

circRNA Basic Information

CircID	chr7:121097699\|121236831
Strand	+
CircType	exon
Host Gene	ENSG00000106034.17;
Algorism	find_circ;CIRI2;DCC;
Sequence	GATTGTGGTTTGCTGATTCATCCAGAGGAAACCTGTGGGTTACAGCCTATTTCTTCTGACTACATTGAAGCCATTTTACAGTCTGAACTAAAAAGATGTCCATCTGGGGACATGAAAG

circRNA Expression in different cancers

circRNA-miRNA-gene regulatory network

Target miRNAs

CircID	miRNA	PITA	miRanda	targetScan

Target Genes

Note about Function Analysis:
We also provide this interface that can help researchers to perform GO, KEGG and disease enrichment analysis easily. This function will take around 30 seconds. After the analysis, this page will automatically jump to the result page.

Target miRNA Expression in different cancers

circRNA Open Reading Frame (ORF)

RNA Binding Protein (RBP) of circRNA

CircID	RBP	Number of Upstream Sites	Number of Downstream Sites	Number of Circ Exons Sites
chr7:121097699\|121236831	FUS	1	0	0
chr7:121097699\|121236831	U2AF2	0	2	0
chr7:121097699\|121236831	LIN28B	0	2	0
chr7:121097699\|121236831	CNBP	0	1	0
chr7:121097699\|121236831	FXR2	0	0	1
chr7:121097699\|121236831	FIP1L1	1	0	0
chr7:121097699\|121236831	AGO2	0	1	0
chr7:121097699\|121236831	EIF4A3	1	2	1
chr7:121097699\|121236831	ELAVL1	0	1	0

CircRNA Information