CircRNA Information

General Information
circRNA Basic Information
CircID chr7:149250159|149250807
Strand +
CircType exon
Host Gene ENSG00000170260.8;
Algorism find_circ;CIRI2;DCC;
Sequence GTGTCCAGGTCACTGGAGAATGATGGCGTCTGTTTCACCGAGCAGGAATGGGAGAATCTGGAGGATTGGCAGAAGGAGCTCTACAGAAACGTGATGGAGAGTAACTATGAGACACTGGTCTCTCTGA
circRNA Expression in different cancers

by boxplot.py
circRNA-miRNA-gene regulatory network
Target miRNAs
CircID miRNA PITA miRanda targetScan
chr7:149250159|149250807 hsa-miR-192-3p 0 1 1
Target Genes
       

Note about Function Analysis:
We also provide this interface that can help researchers to perform GO, KEGG and disease enrichment analysis easily. This function will take around 30 seconds. After the analysis, this page will automatically jump to the result page.

Target miRNA Expression in different cancers

    by mir_boxplot.py


circRNA Open Reading Frame (ORF)
RNA Binding Protein (RBP) of circRNA
CircID RBP Number of Upstream Sites Number of Downstream Sites Number of Circ Exons Sites
chr7:149250159|149250807 U2AF2 10 3 1
chr7:149250159|149250807 ELAVL1 3 1 1
chr7:149250159|149250807 SF3B4 1 0 0
chr7:149250159|149250807 PRPF8 2 4 2
chr7:149250159|149250807 UPF1 1 0 0
chr7:149250159|149250807 SRSF10 1 0 0
chr7:149250159|149250807 TNRC6A 0 1 0
chr7:149250159|149250807 FMR1 0 0 1
chr7:149250159|149250807 SRSF1 1 0 1
chr7:149250159|149250807 NOP58 2 0 1
chr7:149250159|149250807 KHSRP 2 0 0
chr7:149250159|149250807 SRSF9 0 0 1
chr7:149250159|149250807 NOP56 2 0 0
chr7:149250159|149250807 DDX54 1 0 2
chr7:149250159|149250807 LSM11 1 0 0
chr7:149250159|149250807 RBM10 2 3 0
chr7:149250159|149250807 FTO 0 1 0
chr7:149250159|149250807 SF3A3 2 0 0
chr7:149250159|149250807 HNRNPC 10 5 0
chr7:149250159|149250807 DDX3X 1 0 0
chr7:149250159|149250807 SMNDC1 2 0 0
chr7:149250159|149250807 HNRNPA1 1 0 0
chr7:149250159|149250807 IGF2BP2 2 0 1
chr7:149250159|149250807 HNRNPUL1 1 0 0
chr7:149250159|149250807 TARDBP 0 0 1
chr7:149250159|149250807 CSTF2T 1 0 0
chr7:149250159|149250807 TIA1 0 1 0
chr7:149250159|149250807 RBM22 1 1 0
chr7:149250159|149250807 TIAL1 0 1 0
chr7:149250159|149250807 FBL 2 1 0
chr7:149250159|149250807 EIF4A3 2 0 2
chr7:149250159|149250807 AGO2 0 0 1