CircNet

General Information

circRNA Basic Information

CircID	chr8:18064457\|18067298
Strand	-
CircType	exon
Host Gene	ENSG00000104763.18;
Algorism	find_circ;CIRI2;CIRC
Sequence	CCTGGCCTACTTGGCAACTTTCCTGGCCCTTTTGAAGAGGAAATGAAGGGTATTGCCGCTGTTACTGATATACCTTTAG

circRNA Expression in different cancers

circRNA-miRNA-gene regulatory network

Target miRNAs

CircID	miRNA	PITA	miRanda	targetScan

Target Genes

Note about Function Analysis:
We also provide this interface that can help researchers to perform GO, KEGG and disease enrichment analysis easily. This function will take around 30 seconds. After the analysis, this page will automatically jump to the result page.

Target miRNA Expression in different cancers

circRNA Open Reading Frame (ORF)

RNA Binding Protein (RBP) of circRNA

CircID	RBP	Number of Upstream Sites	Number of Downstream Sites	Number of Circ Exons Sites
chr8:18064457\|18067298	KHSRP	3	3	1
chr8:18064457\|18067298	FUS	3	3	0
chr8:18064457\|18067298	PRPF8	0	2	1
chr8:18064457\|18067298	TAF15	1	0	0
chr8:18064457\|18067298	CPSF6	0	2	0
chr8:18064457\|18067298	NUDT21	1	0	0
chr8:18064457\|18067298	TROVE2	0	1	0
chr8:18064457\|18067298	ELAVL1	4	2	0
chr8:18064457\|18067298	SRSF1	0	0	1
chr8:18064457\|18067298	NOP58	0	1	0
chr8:18064457\|18067298	U2AF1	2	2	1
chr8:18064457\|18067298	TNRC6A	0	0	1
chr8:18064457\|18067298	U2AF2	26	8	3
chr8:18064457\|18067298	NOP56	2	0	0
chr8:18064457\|18067298	DDX54	0	1	2
chr8:18064457\|18067298	HNRNPK	0	7	0
chr8:18064457\|18067298	HNRNPL	0	1	0
chr8:18064457\|18067298	HNRNPA2B1	0	1	0
chr8:18064457\|18067298	PCBP2	0	1	0
chr8:18064457\|18067298	PTBP1	12	1	0
chr8:18064457\|18067298	HNRNPC	14	0	0
chr8:18064457\|18067298	HNRNPD	1	0	0
chr8:18064457\|18067298	TRA2A	0	0	2
chr8:18064457\|18067298	DDX3X	0	0	2
chr8:18064457\|18067298	HNRNPA1	4	0	0
chr8:18064457\|18067298	LIN28B	4	1	3
chr8:18064457\|18067298	FXR1	0	0	1
chr8:18064457\|18067298	FXR2	1	0	1
chr8:18064457\|18067298	SND1	2	1	3
chr8:18064457\|18067298	IGF2BP1	0	1	1
chr8:18064457\|18067298	IGF2BP2	0	0	1
chr8:18064457\|18067298	BUD13	0	0	2
chr8:18064457\|18067298	RBFOX2	0	1	0
chr8:18064457\|18067298	RBM47	0	0	1
chr8:18064457\|18067298	DDX42	0	3	0
chr8:18064457\|18067298	CSTF2T	0	2	1
chr8:18064457\|18067298	CSTF2	1	0	0
chr8:18064457\|18067298	XRN2	0	2	0
chr8:18064457\|18067298	DKC1	1	0	0
chr8:18064457\|18067298	EWSR1	1	0	0
chr8:18064457\|18067298	EIF4A3	2	1	0
chr8:18064457\|18067298	FBL	0	0	1

CircRNA Information