CircRNA Information

General Information
circRNA Basic Information
CircID chr8:25268845|25278665
Strand +
CircType exon
Host Gene ENSG00000147459.17;
Algorism find_circ;CIRI2;DCC;
Sequence GTTGGTACAGAGGATATACCCTCCAAAATAAATCTAAAAAGGGCATTTTCCCTGAAACATATATCCATTTGAAAGAGGCAACTGTGGAAGACCTGGGGCAGCATGAAACCGTGATTCCTGGCGAGCTCCCCCTGGTGCAGGAGCTCACGTCCACTCTGCGAGAATGGGCTGTCATCTGGCGAAAGCTCTACGTG
circRNA Expression in different cancers

by boxplot.py
circRNA-miRNA-gene regulatory network
Target miRNAs
CircID miRNA PITA miRanda targetScan
Target Genes
       

Note about Function Analysis:
We also provide this interface that can help researchers to perform GO, KEGG and disease enrichment analysis easily. This function will take around 30 seconds. After the analysis, this page will automatically jump to the result page.

Target miRNA Expression in different cancers

circRNA Open Reading Frame (ORF)
RNA Binding Protein (RBP) of circRNA
CircID RBP Number of Upstream Sites Number of Downstream Sites Number of Circ Exons Sites
chr8:25268845|25278665 RBM5 1 0 0
chr8:25268845|25278665 U2AF2 5 0 2
chr8:25268845|25278665 ELAVL1 3 0 0
chr8:25268845|25278665 ELAVL3 1 0 0
chr8:25268845|25278665 FAM120A 0 0 1
chr8:25268845|25278665 PRPF8 0 2 1
chr8:25268845|25278665 TAF15 1 0 0
chr8:25268845|25278665 FMR1 0 0 1
chr8:25268845|25278665 FUS 0 1 0
chr8:25268845|25278665 DGCR8 0 1 0
chr8:25268845|25278665 SRSF7 0 0 1
chr8:25268845|25278665 SRSF1 2 0 2
chr8:25268845|25278665 NOP58 0 1 0
chr8:25268845|25278665 U2AF1 0 0 3
chr8:25268845|25278665 NOP56 1 0 0
chr8:25268845|25278665 SRSF9 0 0 1
chr8:25268845|25278665 DDX54 0 0 3
chr8:25268845|25278665 SF3A3 2 0 0
chr8:25268845|25278665 HNRNPC 2 0 0
chr8:25268845|25278665 TRA2A 1 0 0
chr8:25268845|25278665 SMNDC1 0 0 1
chr8:25268845|25278665 ACIN1 2 2 4
chr8:25268845|25278665 BCCIP 0 0 1
chr8:25268845|25278665 IGF2BP1 0 0 1
chr8:25268845|25278665 IGF2BP3 0 0 2
chr8:25268845|25278665 IGF2BP2 3 1 1
chr8:25268845|25278665 BUD13 0 1 3
chr8:25268845|25278665 RBFOX2 1 0 0
chr8:25268845|25278665 EIF4A3 4 5 6