CircNet

General Information

circRNA Basic Information

CircID	chr9:132398141\|132400258
Strand	-
CircType	exon
Host Gene	ENSG00000125482.12;
Algorism	find_circ;CIRI2;CIRC
Sequence	GTGTCGCTATTAAATTTGGCAAGTTTTCTGTAAAGGAAAATAAGCAGTTAGAGAAAAATGTGGAAGACTTTCTAGCCCTGACAGGCATTGAGAGTGCAGACAAGCTGCTGTACACGGACAGATATCCTGAGGAAAAATCTGTGATCACCAACTTAAAAAGGAGATACTCGTTTAGATTACACATTG

circRNA Expression in different cancers

circRNA-miRNA-gene regulatory network

Target miRNAs

CircID	miRNA	PITA	miRanda	targetScan

Target Genes

Note about Function Analysis:
We also provide this interface that can help researchers to perform GO, KEGG and disease enrichment analysis easily. This function will take around 30 seconds. After the analysis, this page will automatically jump to the result page.

Target miRNA Expression in different cancers

circRNA Open Reading Frame (ORF)

RNA Binding Protein (RBP) of circRNA

CircID	RBP	Number of Upstream Sites	Number of Downstream Sites	Number of Circ Exons Sites
chr9:132398141\|132400258	ELAVL1	0	1	0
chr9:132398141\|132400258	DGCR8	0	0	1
chr9:132398141\|132400258	NOP56	2	1	0
chr9:132398141\|132400258	MOV10	0	1	0
chr9:132398141\|132400258	NOP58	0	0	1
chr9:132398141\|132400258	DHX9	2	0	0
chr9:132398141\|132400258	U2AF2	2	1	1
chr9:132398141\|132400258	FXR1	0	1	0
chr9:132398141\|132400258	RBM10	0	2	0
chr9:132398141\|132400258	FMR1	0	0	1
chr9:132398141\|132400258	IGF2BP2	1	0	2
chr9:132398141\|132400258	AGO2	0	1	0
chr9:132398141\|132400258	EIF4A3	2	1	2
chr9:132398141\|132400258	FUS	0	1	0

CircRNA Information