CircRNA Information

General Information
circRNA Basic Information
CircID chr9:77238002|77280238
Strand +
CircType exon
Host Gene ENSG00000197969.11;
Algorism CIRI2;
Sequence ATTTGAAACTAAAATAGATTCATTTCATATTACTGGCTTACCAGATAATTCAGAAAAACCCCGCCTCCTGTCTTCATTGGATGATGCAATGTCACTTTTCCAAATTACATTTGAGATAAATCCATTAGATGAAACTGTTTCTCAGAGGTGTATCATAGAAGCTGAACCTTTAGAAATCATATATGATGCA
circRNA Expression in different cancers

by boxplot.py
circRNA-miRNA-gene regulatory network
Target miRNAs
CircID miRNA PITA miRanda targetScan
Target Genes
       

Note about Function Analysis:
We also provide this interface that can help researchers to perform GO, KEGG and disease enrichment analysis easily. This function will take around 30 seconds. After the analysis, this page will automatically jump to the result page.

Target miRNA Expression in different cancers

circRNA Open Reading Frame (ORF)
RNA Binding Protein (RBP) of circRNA
CircID RBP Number of Upstream Sites Number of Downstream Sites Number of Circ Exons Sites
chr9:77238002|77280238 NOP56 1 0 0
chr9:77238002|77280238 ELAVL1 2 3 0
chr9:77238002|77280238 ZNF184 0 1 0
chr9:77238002|77280238 SF3B4 1 0 0
chr9:77238002|77280238 CELF2 2 0 0
chr9:77238002|77280238 PRPF8 0 1 0
chr9:77238002|77280238 TAF15 1 2 0
chr9:77238002|77280238 DGCR8 0 1 0
chr9:77238002|77280238 SRSF7 0 0 1
chr9:77238002|77280238 NOP58 0 1 0
chr9:77238002|77280238 U2AF1 0 2 0
chr9:77238002|77280238 ADAR 0 1 0
chr9:77238002|77280238 U2AF2 4 16 0
chr9:77238002|77280238 DDX54 0 0 2
chr9:77238002|77280238 HNRNPC 3 0 0
chr9:77238002|77280238 TRA2A 0 1 0
chr9:77238002|77280238 DHX9 0 0 1
chr9:77238002|77280238 SMNDC1 0 1 0
chr9:77238002|77280238 ACIN1 1 1 0
chr9:77238002|77280238 LIN28B 0 0 1
chr9:77238002|77280238 FXR2 0 0 1
chr9:77238002|77280238 IGF2BP1 0 0 1
chr9:77238002|77280238 IGF2BP2 0 0 1
chr9:77238002|77280238 ELAVL3 0 1 0
chr9:77238002|77280238 TARDBP 1 0 0
chr9:77238002|77280238 RBFOX2 0 1 0
chr9:77238002|77280238 CSTF2T 0 1 0
chr9:77238002|77280238 FBL 1 0 2
chr9:77238002|77280238 EIF4A3 0 2 2
chr9:77238002|77280238 AGO2 0 2 2