CircNet

General Information

circRNA Basic Information

CircID	chrX:85051389\|85074391
Strand	+
CircType	exon
Host Gene	ENSG00000155008.13;
Algorism	find_circ;CIRI2;DCC;
Sequence	CTAGGATCCTCTTCCGAAATAGAAGTACCTGCAAAAACAACTCACGTCTTGAAACACTCAGTGCCCTTGCCAACAGAACTCAGCTCTGAAGCAAAGACCAAATCAGAATCCACTTCAG

circRNA Expression in different cancers

circRNA-miRNA-gene regulatory network

Target miRNAs

CircID	miRNA	PITA	miRanda	targetScan

Target Genes

Note about Function Analysis:
We also provide this interface that can help researchers to perform GO, KEGG and disease enrichment analysis easily. This function will take around 30 seconds. After the analysis, this page will automatically jump to the result page.

Target miRNA Expression in different cancers

circRNA Open Reading Frame (ORF)

RNA Binding Protein (RBP) of circRNA

CircID	RBP	Number of Upstream Sites	Number of Downstream Sites	Number of Circ Exons Sites
chrX:85051389\|85074391	FBL	0	0	1
chrX:85051389\|85074391	ELAVL1	2	0	1
chrX:85051389\|85074391	PRPF8	0	1	0
chrX:85051389\|85074391	MSI1	0	1	0
chrX:85051389\|85074391	NOP56	0	1	1
chrX:85051389\|85074391	IGF2BP3	0	0	1
chrX:85051389\|85074391	DDX54	0	0	1
chrX:85051389\|85074391	RBFOX2	1	0	0
chrX:85051389\|85074391	FUS	1	1	0
chrX:85051389\|85074391	CNBP	0	1	0
chrX:85051389\|85074391	DIS3L2	1	0	0
chrX:85051389\|85074391	UPF1	2	0	0
chrX:85051389\|85074391	U2AF2	3	5	0
chrX:85051389\|85074391	TAF15	4	0	0
chrX:85051389\|85074391	IGF2BP1	0	0	2
chrX:85051389\|85074391	NOP58	1	1	2
chrX:85051389\|85074391	PTBP1	0	0	1
chrX:85051389\|85074391	IGF2BP2	0	0	1
chrX:85051389\|85074391	TRA2A	0	0	1
chrX:85051389\|85074391	EIF4A3	0	2	2
chrX:85051389\|85074391	AGO2	0	1	1

CircRNA Information