CircNet

General Information

circRNA Basic Information

CircID	chrY:13393859\|13449066
Strand	-
CircType	exon
Host Gene	ENSG00000183878.15;
Algorism	find_circ;CIRI2;DCC;
Sequence	GGCAATTAAAGCATTTCAAGATGTCCTTTATGTTGACCCCAGCTTTTGTCGAGCCAAGGAAATTCATTTACGACTTGGGCTCATGTTCAAAGTGAACACAGACTACAAGTCTAGTTTAAAGTTCAATTTCATATTGCCCATTTGTATGAAACCCAG

circRNA Expression in different cancers

circRNA-miRNA-gene regulatory network

Target miRNAs

CircID	miRNA	PITA	miRanda	targetScan

Target Genes

Note about Function Analysis:
We also provide this interface that can help researchers to perform GO, KEGG and disease enrichment analysis easily. This function will take around 30 seconds. After the analysis, this page will automatically jump to the result page.

Target miRNA Expression in different cancers

circRNA Open Reading Frame (ORF)

RNA Binding Protein (RBP) of circRNA

CircID	RBP	Number of Upstream Sites	Number of Downstream Sites
chrY:13393859\|13449066	HNRNPA2B1	0	2
chrY:13393859\|13449066	AGO2	0	2
chrY:13393859\|13449066	FUS	1	0
chrY:13393859\|13449066	ELAVL1	2	2

CircRNA Information