miRNA Card

miRNA General Information
miRNA ID hsa-let-7a-3p
Description Homo sapiens let-7a-1 stem-loop
Comment let-7a-3p cloned in [6] has a 1 nt 3' extension (U), which is incompatible with the genome sequence.
Experiment cloned [6]
Sequence CUAUACAAUCUACUGUCUUUC
miRNA Expression in different cancers

    by mir_boxplot.py

circRNA-miRNA-gene regulatory network

Note about Netwrok:
This is a network diagram with miRNA (purple circle) as the center.
We used three tools(PITA, miRanda, targetScan) to predict the binding sites of circrna (green circle) and miRNA. Accordingly, for this miRNA that binds to circrna, we have three confidence levels, namely confident 1, confident 2 and confident 3. Confidence value indicates how many tools can deduce these results. For each confidence, we use different kinds of dashed lines.

Target circRNA with confidence

Confidence 3 (3 of 3 tools predicted)

CircID miRNA PITA miRanda targetScan

Confidence 2 (2 of 3 tools predicted)

CircID miRNA PITA miRanda targetScan

Confidence 1 (1 of 3 tools predicted)

CircID miRNA PITA miRanda targetScan
chr10:68771206|68773099 hsa-let-7a-3p 0 1 0
chr16:23573109|23573230 hsa-let-7a-3p 0 1 0
chr2:85542278|85542634 hsa-let-7a-3p 0 1 0
chr2:85542294|85542634 hsa-let-7a-3p 0 1 0
chr19:36236783|36236847 hsa-let-7a-3p 0 1 0
chr12:31982111|31982267 hsa-let-7a-3p 0 1 0
chr2:85542291|85542634 hsa-let-7a-3p 0 1 0
chr13:52031040|52031169 hsa-let-7a-3p 0 1 0
chr12:55828484|55828685 hsa-let-7a-3p 0 1 0
chr5:150053929|150054118 hsa-let-7a-3p 0 1 0
chr1:83949093|83949148 hsa-let-7a-3p 0 1 0
chr2:85542275|85542634 hsa-let-7a-3p 0 1 0
chr2:85542291~85542634 hsa-let-7a-3p 0 1 0
chr10:68771206~68773099 hsa-let-7a-3p 0 1 0
chr16:23573113~23573230 hsa-let-7a-3p 0 1 0
chr2:85542278~85542634 hsa-let-7a-3p 0 1 0
chr2:85542294~85542634 hsa-let-7a-3p 0 1 0
chr3:134356990~134357124 hsa-let-7a-3p 0 1 0
chr8:41968768|41968889 hsa-let-7a-3p 0 1 0
chr13:95695066|95695260 hsa-let-7a-3p 0 1 0
chr8:38115163|38115306 hsa-let-7a-3p 0 1 0
chr5:150053929|150054150 hsa-let-7a-3p 0 1 0
chr16:30919512|30919703 hsa-let-7a-3p 0 1 0
chr1:203340941|203341215 hsa-let-7a-3p 0 1 0
chr2:85542240|85542634 hsa-let-7a-3p 0 1 0
chr16:23573113|23573230 hsa-let-7a-3p 0 1 0
chr12:110435008|110435168 hsa-let-7a-3p 0 1 0
chr2:88857491|88861902 hsa-let-7a-3p 0 1 0
chr2:85542262|85542634 hsa-let-7a-3p 0 1 0
chr9:72916925|72917060 hsa-let-7a-3p 0 1 0
chr2:85542262|85542373 hsa-let-7a-3p 0 1 0
chr1:203341033|203341384 hsa-let-7a-3p 0 1 0
chr1:203340941|203341159 hsa-let-7a-3p 0 1 0
chr2:85542275|85542663 hsa-let-7a-3p 0 1 0
chrX:23704694|23704809 hsa-let-7a-3p 0 1 0
chr9:19371756|19372097 hsa-let-7a-3p 0 1 0
Target genes
miRNA Gene Gene Description HGNC ID details
hsa-let-7a-3p ARMC8 armadillo repeat containing 8 HGNC:24999 details
hsa-let-7a-3p SETD4 SET domain containing 4 HGNC:1258 details
hsa-let-7a-3p BTF3 basic transcription factor 3 HGNC:1125 details
hsa-let-7a-3p MIPOL1 mirror-image polydactyly 1 HGNC:21460 details
hsa-let-7a-3p TRIM33 tripartite motif containing 33 HGNC:16290 details
hsa-let-7a-3p CS citrate synthase HGNC:2422 details
hsa-let-7a-3p SENP7 SUMO specific peptidase 7 HGNC:30402 details
hsa-let-7a-3p HAT1 histone acetyltransferase 1 HGNC:4821 details
hsa-let-7a-3p SRI sorcin HGNC:11292 details
hsa-let-7a-3p SHOC2 SHOC2 leucine rich repeat scaffold protein HGNC:15454 details
hsa-let-7a-3p SEC24A SEC24 homolog A, COPII coat complex component HGNC:10703 details
hsa-let-7a-3p IRF2BP2 interferon regulatory factor 2 binding protein 2 HGNC:21729 details
hsa-let-7a-3p CREBRF CREB3 regulatory factor HGNC:24050 details
hsa-let-7a-3p ARAP2 ArfGAP with RhoGAP domain, ankyrin repeat and PH domain 2 HGNC:16924 details
hsa-let-7a-3p MSMO1 methylsterol monooxygenase 1 HGNC:10545 details
hsa-let-7a-3p PPIL4 peptidylprolyl isomerase like 4 HGNC:15702 details
hsa-let-7a-3p MTFR1 mitochondrial fission regulator 1 HGNC:29510 details
hsa-let-7a-3p BTG1 BTG anti-proliferation factor 1 HGNC:1130 details
hsa-let-7a-3p ACVR2B activin A receptor type 2B HGNC:174 details
hsa-let-7a-3p CREBZF CREB/ATF bZIP transcription factor HGNC:24905 details
hsa-let-7a-3p ASB11 ankyrin repeat and SOCS box containing 11 HGNC:17186 details
hsa-let-7a-3p UBXN2B UBX domain protein 2B HGNC:27035 details
hsa-let-7a-3p ARID1B AT-rich interaction domain 1B HGNC:18040 details
hsa-let-7a-3p ZNF652 zinc finger protein 652 HGNC:29147 details
hsa-let-7a-3p SENP1 SUMO specific peptidase 1 HGNC:17927 details
hsa-let-7a-3p LCOR ligand dependent nuclear receptor corepressor HGNC:29503 details
hsa-let-7a-3p KLHL15 kelch like family member 15 HGNC:29347 details
hsa-let-7a-3p WEE1 WEE1 G2 checkpoint kinase HGNC:12761 details
hsa-let-7a-3p ADH1B alcohol dehydrogenase 1B (class I), beta polypeptide HGNC:250 details
hsa-let-7a-3p PHF8 PHD finger protein 8 HGNC:20672 details
hsa-let-7a-3p NRBF2 nuclear receptor binding factor 2 HGNC:19692 details
hsa-let-7a-3p MYADM myeloid associated differentiation marker HGNC:7544 details
hsa-let-7a-3p FZD5 frizzled class receptor 5 HGNC:4043 details
hsa-let-7a-3p E2F8 E2F transcription factor 8 HGNC:24727 details
hsa-let-7a-3p CREB1 cAMP responsive element binding protein 1 HGNC:2345 details
hsa-let-7a-3p ZNF256 zinc finger protein 256 HGNC:13049 details
hsa-let-7a-3p ABCC4 ATP binding cassette subfamily C member 4 HGNC:55 details
hsa-let-7a-3p OCIAD1 OCIA domain containing 1 HGNC:16074 details
hsa-let-7a-3p PPP1R10 protein phosphatase 1 regulatory subunit 10 HGNC:9284 details
hsa-let-7a-3p ALG10B ALG10 alpha-1,2-glucosyltransferase B HGNC:31088 details
hsa-let-7a-3p PPIL3 peptidylprolyl isomerase like 3 HGNC:9262 details
hsa-let-7a-3p TP53INP1 tumor protein p53 inducible nuclear protein 1 HGNC:18022 details
hsa-let-7a-3p LDLR low density lipoprotein receptor HGNC:6547 details
hsa-let-7a-3p BRI3BP BRI3 binding protein HGNC:14251 details
hsa-let-7a-3p CDKN1B cyclin dependent kinase inhibitor 1B HGNC:1785 details
hsa-let-7a-3p MGAT4C MGAT4 family member C HGNC:30871 details
hsa-let-7a-3p RORA RAR related orphan receptor A HGNC:10258 details
hsa-let-7a-3p RBM12B RNA binding motif protein 12B HGNC:32310 details
hsa-let-7a-3p NCOA7 nuclear receptor coactivator 7 HGNC:21081 details
hsa-let-7a-3p GABRG1 gamma-aminobutyric acid type A receptor subunit gamma1 HGNC:4086 details
hsa-let-7a-3p ZNF264 zinc finger protein 264 HGNC:13057 details
hsa-let-7a-3p VEZF1 vascular endothelial zinc finger 1 HGNC:12949 details
hsa-let-7a-3p TOR1AIP2 torsin 1A interacting protein 2 HGNC:24055 details
hsa-let-7a-3p SYF2 SYF2 pre-mRNA splicing factor HGNC:19824 details
hsa-let-7a-3p SLC16A14 solute carrier family 16 member 14 HGNC:26417 details
hsa-let-7a-3p AASDHPPT aminoadipate-semialdehyde dehydrogenase-phosphopantetheinyl transferase HGNC:14235 details
hsa-let-7a-3p ACP1 acid phosphatase 1 HGNC:122 details
hsa-let-7a-3p ZNF136 zinc finger protein 136 HGNC:12920 details
hsa-let-7a-3p SLC35A5 solute carrier family 35 member A5 HGNC:20792 details
hsa-let-7a-3p SIPA1L2 signal induced proliferation associated 1 like 2 HGNC:23800 details
hsa-let-7a-3p PCTP phosphatidylcholine transfer protein HGNC:8752 details
hsa-let-7a-3p HBP1 HMG-box transcription factor 1 HGNC:23200 details
hsa-let-7a-3p DSG2 desmoglein 2 HGNC:3049 details
hsa-let-7a-3p TES testin LIM domain protein HGNC:14620 details
hsa-let-7a-3p NOLC1 nucleolar and coiled-body phosphoprotein 1 HGNC:15608 details
hsa-let-7a-3p ZNF181 zinc finger protein 181 HGNC:12971 details
hsa-let-7a-3p WNK1 WNK lysine deficient protein kinase 1 HGNC:14540 details
hsa-let-7a-3p PGGT1B protein geranylgeranyltransferase type I subunit beta HGNC:8895 details
hsa-let-7a-3p MRPL35 mitochondrial ribosomal protein L35 HGNC:14489 details
hsa-let-7a-3p HMGB2 high mobility group box 2 HGNC:5000 details
hsa-let-7a-3p GSK3B glycogen synthase kinase 3 beta HGNC:4617 details
hsa-let-7a-3p EIF4A2 eukaryotic translation initiation factor 4A2 HGNC:3284 details
hsa-let-7a-3p DLX2 distal-less homeobox 2 HGNC:2915 details
hsa-let-7a-3p CSTF2 cleavage stimulation factor subunit 2 HGNC:2484 details
hsa-let-7a-3p KANSL1L KAT8 regulatory NSL complex subunit 1 like HGNC:26310 details
hsa-let-7a-3p TTC33 tetratricopeptide repeat domain 33 HGNC:29959 details
hsa-let-7a-3p RNF11 ring finger protein 11 HGNC:10056 details
hsa-let-7a-3p MDM2 MDM2 proto-oncogene HGNC:6973 details
hsa-let-7a-3p RPS16 ribosomal protein S16 HGNC:10396 details
hsa-let-7a-3p PHKA1 phosphorylase kinase regulatory subunit alpha 1 HGNC:8925 details
hsa-let-7a-3p CD99 CD99 molecule (Xg blood group) HGNC:7082 details
hsa-let-7a-3p GPRIN3 GPRIN family member 3 HGNC:27733 details
hsa-let-7a-3p DUSP6 dual specificity phosphatase 6 HGNC:3072 details
hsa-let-7a-3p details
hsa-let-7a-3p GREM1 gremlin 1, DAN family BMP antagonist HGNC:2001 details
hsa-let-7a-3p ZNF585A zinc finger protein 585A HGNC:26305 details
hsa-let-7a-3p POLA2 DNA polymerase alpha 2, accessory subunit HGNC:30073 details
hsa-let-7a-3p PAPOLG poly(A) polymerase gamma HGNC:14982 details
hsa-let-7a-3p RUVBL2 RuvB like AAA ATPase 2 HGNC:10475 details
hsa-let-7a-3p PURA purine rich element binding protein A HGNC:9701 details
hsa-let-7a-3p MSH6 mutS homolog 6 HGNC:7329 details
hsa-let-7a-3p USF3 upstream transcription factor family member 3 HGNC:30494 details
hsa-let-7a-3p BRPF3 bromodomain and PHD finger containing 3 HGNC:14256 details
hsa-let-7a-3p AFAP1 actin filament associated protein 1 HGNC:24017 details
hsa-let-7a-3p DIP2A disco interacting protein 2 homolog A HGNC:17217 details
hsa-let-7a-3p RS1 retinoschisin 1 HGNC:10457 details
hsa-let-7a-3p MYOM2 myomesin 2 HGNC:7614 details
hsa-let-7a-3p SFT2D3 SFT2 domain containing 3 HGNC:28767 details
hsa-let-7a-3p COPB2 COPI coat complex subunit beta 2 HGNC:2232 details
hsa-let-7a-3p ALDH1A3 aldehyde dehydrogenase 1 family member A3 HGNC:409 details
hsa-let-7a-3p ZNF800 zinc finger protein 800 HGNC:27267 details
hsa-let-7a-3p TM4SF1 transmembrane 4 L six family member 1 HGNC:11853 details
hsa-let-7a-3p SPAG9 sperm associated antigen 9 HGNC:14524 details
hsa-let-7a-3p SEMA4D semaphorin 4D HGNC:10732 details
hsa-let-7a-3p RUFY2 RUN and FYVE domain containing 2 HGNC:19761 details
hsa-let-7a-3p MBNL1 muscleblind like splicing regulator 1 HGNC:6923 details
hsa-let-7a-3p KLF10 Kruppel like factor 10 HGNC:11810 details
hsa-let-7a-3p ITGA3 integrin subunit alpha 3 HGNC:6139 details
hsa-let-7a-3p ANAPC16 anaphase promoting complex subunit 16 HGNC:26976 details
hsa-let-7a-3p ZNF546 zinc finger protein 546 HGNC:28671 details
hsa-let-7a-3p C1orf52 chromosome 1 open reading frame 52 HGNC:24871 details
hsa-let-7a-3p NDUFAF7 NADH:ubiquinone oxidoreductase complex assembly factor 7 HGNC:28816 details
hsa-let-7a-3p APOBEC3A apolipoprotein B mRNA editing enzyme catalytic subunit 3A HGNC:17343 details
hsa-let-7a-3p CCND2 cyclin D2 HGNC:1583 details
hsa-let-7a-3p LIN28A lin-28 homolog A HGNC:15986 details
hsa-let-7a-3p E2F2 E2F transcription factor 2 HGNC:3114 details
hsa-let-7a-3p CCND1 cyclin D1 HGNC:1582 details
hsa-let-7a-3p EN1 engrailed homeobox 1 HGNC:3342 details
hsa-let-7a-3p HNRNPU heterogeneous nuclear ribonucleoprotein U HGNC:5048 details
hsa-let-7a-3p SGMS1 sphingomyelin synthase 1 HGNC:29799 details
hsa-let-7a-3p LUZP1 leucine zipper protein 1 HGNC:14985 details
hsa-let-7a-3p SMAD2 SMAD family member 2 HGNC:6768 details
hsa-let-7a-3p CNKSR2 connector enhancer of kinase suppressor of Ras 2 HGNC:19701 details
hsa-let-7a-3p LANCL3 LanC like 3 HGNC:24767 details
© 2021 Arieh Warshel Institute of Computational Biology, CUHK(SZ) | Designed by : Biomics Lab