CircNet

miRNA ID	hsa-let-7f-5p
Description	Homo sapiens let-7f-1 stem-loop
Comment	None
Experiment	cloned [1,3-5], Northern [1], Illumina [6]
Sequence	UGAGGUAGUAGAUUGUAUAGUU

circRNA-miRNA-gene regulatory network

Note about Netwrok:
This is a network diagram with miRNA (purple circle) as the center.
We used three tools(PITA, miRanda, targetScan) to predict the binding sites of circrna (green circle) and miRNA. Accordingly, for this miRNA that binds to circrna, we have three confidence levels, namely confident 1, confident 2 and confident 3. Confidence value indicates how many tools can deduce these results. For each confidence, we use different kinds of dashed lines.

Target circRNA with confidence

Confidence 3 (3 of 3 tools predicted)

CircID	miRNA	PITA	miRanda	targetScan
chr10:102362475\|102363798	hsa-let-7f-5p	1	1	1
chr16:11839695\|11850418	hsa-let-7f-5p	1	1	1
chr2:197001753\|197090032	hsa-let-7f-5p	1	1	1
chr2:159714557\|159743253	hsa-let-7f-5p	1	1	1

Confidence 2 (2 of 3 tools predicted)

CircID	miRNA	PITA	miRanda
chr3:195515989\|195516092	hsa-let-7f-5p	1	1
chr3:4984210\|4984287	hsa-let-7f-5p	1	1
chr12:112022161\|112022298	hsa-let-7f-5p	1	1
chr1:243501758\|243501925	hsa-let-7f-5p	1	1
chr22:24572876\|24572996	hsa-let-7f-5p	1	1
chr5:140567515\|140567670	hsa-let-7f-5p	1	1
chr11:1186392\|1186535	hsa-let-7f-5p	1	1
chr11:1186311\|1186463	hsa-let-7f-5p	1	1
chr6:138423448\|138423616	hsa-let-7f-5p	1	1
chr14:39181503\|39181656	hsa-let-7f-5p	1	1
chr14:24239660\|24239804	hsa-let-7f-5p	1	1
chr3:37325034\|37325187	hsa-let-7f-5p	1	1
chr1:234608002\|234608180	hsa-let-7f-5p	1	1
chr1:234607969\|234608173	hsa-let-7f-5p	1	1
chr7:64686142\|64686246	hsa-let-7f-5p	1	1
chr4:74189078\|74189187	hsa-let-7f-5p	1	1
chr1:234607941\|234608173	hsa-let-7f-5p	1	1
chr22:31535586\|31535843	hsa-let-7f-5p	1	1
chr16:503882\|504055	hsa-let-7f-5p	1	1
chr5:3586719\|3586840	hsa-let-7f-5p	1	1
chr9:6846274\|6846412	hsa-let-7f-5p	1	1
chrX:1404397\|1404614	hsa-let-7f-5p	1	1
chrX:1405388\|1405470	hsa-let-7f-5p	1	1
chr6:119285077\|119285213	hsa-let-7f-5p	1	1
chr1:85707742\|85707861	hsa-let-7f-5p	1	1
chr15:74638771\|74638868	hsa-let-7f-5p	1	1
chrX:47242116\|47242238	hsa-let-7f-5p	1	1
chr11:78218042\|78218261	hsa-let-7f-5p	1	1
chr11:47737528\|47737694	hsa-let-7f-5p	1	1
chr10:74107617\|74107711	hsa-let-7f-5p	1	1
chr12:112022161\|112022378	hsa-let-7f-5p	1	1
chr6:138423519\|138423633	hsa-let-7f-5p	1	1
chr12:112022200\|112022378	hsa-let-7f-5p	1	1
chr5:140567467\|140567670	hsa-let-7f-5p	1	1
chr11:1190631\|1190750	hsa-let-7f-5p	1	1
chr4:147637458\|147637590	hsa-let-7f-5p	1	1
chr14:39181500\|39181656	hsa-let-7f-5p	1	1
chr12:6906484\|6906573	hsa-let-7f-5p	1	1
chrX:40074608\|40074733	hsa-let-7f-5p	1	1
chr12:112022148\|112022378	hsa-let-7f-5p	1	1
chr9:96458379\|96458541	hsa-let-7f-5p	1	1
chr1:31337175\|31339048	hsa-let-7f-5p	1	1
chr5:140567515\|140567630	hsa-let-7f-5p	1	1
chr11:1186344\|1186535	hsa-let-7f-5p	1	1
chr12:112022170\|112022298	hsa-let-7f-5p	1	1
chr17:76081746\|76081904	hsa-let-7f-5p	1	1
chr19:2802036\|2802145	hsa-let-7f-5p	1	1
chrX:97604123\|97604238	hsa-let-7f-5p	1	1
chr3:53817153\|53817364	hsa-let-7f-5p	1	1
chr7:106628626\|106628785	hsa-let-7f-5p	1	1
chr17:45106967\|45107075	hsa-let-7f-5p	1	1
chrX:54952000\|54952108	hsa-let-7f-5p	1	1
chr11:59207561\|59207692	hsa-let-7f-5p	1	1
chr7:73598140\|73598242	hsa-let-7f-5p	1	1
chr11:1190607\|1190750	hsa-let-7f-5p	1	1
chr11:116899856\|116900085	hsa-let-7f-5p	1	1
chr7:101004527\|101004775	hsa-let-7f-5p	1	1
chr3:195515986\|195516102	hsa-let-7f-5p	1	1

Confidence 1 (1 of 3 tools predicted)

CircID	miRNA	PITA	miRanda
chr17:42790172\|42790350	hsa-let-7f-5p	1	0
chr6:2785226\|2785360	hsa-let-7f-5p	1	0
chr1:22639083\|22639154	hsa-let-7f-5p	1	0
chr2:224478200\|224478311	hsa-let-7f-5p	0	1
chr17:41523659\|41523786	hsa-let-7f-5p	0	1
chr21:33296740\|33296889	hsa-let-7f-5p	0	1
chr12:124341939\|124342021	hsa-let-7f-5p	0	1
chr12:55725849\|55726201	hsa-let-7f-5p	0	1
chr10:17233836\|17233931	hsa-let-7f-5p	0	1
chr8:38264127\|38264300	hsa-let-7f-5p	0	1
chr17:1937357\|1937569	hsa-let-7f-5p	0	1
chr21:33296667\|33296889	hsa-let-7f-5p	0	1
chr1:147184506\|147184640	hsa-let-7f-5p	0	1
chr2:179945568\|179945683	hsa-let-7f-5p	0	1
chr17:18247503\|18247794	hsa-let-7f-5p	0	1
chr5:138467757\|138468020	hsa-let-7f-5p	0	1
chr3:51969168\|51969326	hsa-let-7f-5p	0	1
chr15:80596117\|80596286	hsa-let-7f-5p	0	1
chr3:4984083\|4984287	hsa-let-7f-5p	0	1
chr17:38919691\|38919913	hsa-let-7f-5p	0	1
chr1:85707832\|85707984	hsa-let-7f-5p	0	1
chr5:138467757\|138467870	hsa-let-7f-5p	0	1
chr15:89667145\|89667658	hsa-let-7f-5p	0	1
chr1:209786076\|209786187	hsa-let-7f-5p	0	1
chr1:156294018\|156294213	hsa-let-7f-5p	0	1
chr17:2692426\|2692690	hsa-let-7f-5p	0	1
chr17:81511394\|81511612	hsa-let-7f-5p	0	1
chr1:180112408\|180112539	hsa-let-7f-5p	0	1
chr2:38482025\|38482132	hsa-let-7f-5p	0	1
chr1:85707832\|85707966	hsa-let-7f-5p	0	1
chr6:63713478\|63713659	hsa-let-7f-5p	0	1
chr9:112883238\|112883346	hsa-let-7f-5p	0	1
chr12:55725849\|55726194	hsa-let-7f-5p	0	1
chr3:114308702\|114308804	hsa-let-7f-5p	0	1
chr17:41523659\|41523856	hsa-let-7f-5p	0	1
chr19:14477880\|14478129	hsa-let-7f-5p	0	1
chr17:28757817\|28757936	hsa-let-7f-5p	0	1
chr19:39408155\|39408285	hsa-let-7f-5p	0	1
chrX:101393546\|101393648	hsa-let-7f-5p	0	1
chr8:115587355\|115587474	hsa-let-7f-5p	0	1
chr12:6906488\|6906649	hsa-let-7f-5p	0	1
chr17:32469082\|32469176	hsa-let-7f-5p	1	0
chr19:49809984\|49810100	hsa-let-7f-5p	1	0
chr4:67734016\|67734148	hsa-let-7f-5p	1	0
chr1:43621989\|43622090	hsa-let-7f-5p	1	0
chr2:74329943\|74330077	hsa-let-7f-5p	1	0
chrX:120430296\|120430485	hsa-let-7f-5p	1	0
chr7:105143084\|105143144	hsa-let-7f-5p	1	0
chr19:51952083\|51952195	hsa-let-7f-5p	1	0
chr10:118127930\|118128008	hsa-let-7f-5p	1	0
chr12:55993465\|55993842	hsa-let-7f-5p	1	0
chr16:19521921\|19522044	hsa-let-7f-5p	1	0
chr15:55619080\|55619166	hsa-let-7f-5p	1	0
chr1:156466384\|156466520	hsa-let-7f-5p	0	1
chr12:50120071\|50120201	hsa-let-7f-5p	0	1
chr3:4984212\|4984453	hsa-let-7f-5p	0	1
chr5:138467793\|138467915	hsa-let-7f-5p	0	1
chr12:50120052\|50120227	hsa-let-7f-5p	0	1
chr5:81312613\|81312705	hsa-let-7f-5p	0	1
chr14:24239703\|24239868	hsa-let-7f-5p	0	1
chr17:41523670\|41523786	hsa-let-7f-5p	0	1
chr8:126555640\|126555798	hsa-let-7f-5p	0	1
chr5:138467620\|138467864	hsa-let-7f-5p	0	1
chr7:30924900\|30925088	hsa-let-7f-5p	0	1
chr8:103063403\|103063712	hsa-let-7f-5p	0	1
chr20:2481964\|2482062	hsa-let-7f-5p	0	1
chr1:207794423\|207794749	hsa-let-7f-5p	0	1
chr14:39181440\|39181656	hsa-let-7f-5p	0	1
chr16:17104002\|17104153	hsa-let-7f-5p	0	1
chr14:77338541\|77338686	hsa-let-7f-5p	0	1
chr5:41730450\|41730559	hsa-let-7f-5p	0	1
chr10:13444125\|13444438	hsa-let-7f-5p	0	1
chr17:30999010\|30999153	hsa-let-7f-5p	0	1
chr3:58153388\|58153641	hsa-let-7f-5p	0	1
chr6:30492807\|30492981	hsa-let-7f-5p	0	1
chr2:111165534\|111165685	hsa-let-7f-5p	0	1
chr17:41523646\|41523786	hsa-let-7f-5p	0	1
chr22:44862544\|44862635	hsa-let-7f-5p	0	1
chr5:138467757\|138467864	hsa-let-7f-5p	0	1
chr21:33296743\|33296889	hsa-let-7f-5p	0	1
chr3:50325588\|50325756	hsa-let-7f-5p	0	1
chr5:138467757\|138467873	hsa-let-7f-5p	0	1
chr12:57716493\|57717958	hsa-let-7f-5p	0	1
chr14:100140398\|100140661	hsa-let-7f-5p	0	1
chr1:108699435\|108699542	hsa-let-7f-5p	0	1
chr12:56272238\|56272362	hsa-let-7f-5p	0	1
chr11:65121500\|65121572	hsa-let-7f-5p	0	1
chr3:4984210\|4984277	hsa-let-7f-5p	0	1
chr9:113262923\|113263088	hsa-let-7f-5p	0	1
chr1:151342151\|151342290	hsa-let-7f-5p	0	1
chr3:49721198\|49721338	hsa-let-7f-5p	0	1
chr12:110346910\|110347045	hsa-let-7f-5p	0	1
chr6:45550245\|45550364	hsa-let-7f-5p	0	1
chr12:51352660\|51352830	hsa-let-7f-5p	0	1
chr11:72577137\|72577282	hsa-let-7f-5p	0	1
chr11:65121500\|65121623	hsa-let-7f-5p	0	1
chr6:30900605\|30900734	hsa-let-7f-5p	0	1
chr10:124596503\|124596629	hsa-let-7f-5p	0	1
chr13:53051427\|53051558	hsa-let-7f-5p	0	1
chr3:112117161\|112117260	hsa-let-7f-5p	0	1
chr16:71853590\|71853763	hsa-let-7f-5p	0	1
chr3:185489738\|185489939	hsa-let-7f-5p	0	1
chr21:33296711\|33296889	hsa-let-7f-5p	0	1
chr17:38919533\|38919913	hsa-let-7f-5p	0	1
chr22:39317091\|39317217	hsa-let-7f-5p	0	1
chr4:40752211\|40752339	hsa-let-7f-5p	0	1
chr1:117623719\|117623873	hsa-let-7f-5p	0	1
chr3:47829054\|47829134	hsa-let-7f-5p	0	1
chr2:218339830\|218340099	hsa-let-7f-5p	0	1
chr21:33296717\|33296889	hsa-let-7f-5p	0	1
chr12:113297187\|113297355	hsa-let-7f-5p	0	1
chr11:72229151\|72229489	hsa-let-7f-5p	0	1
chr10:37302922\|37303201	hsa-let-7f-5p	0	1
chr6:43504610\|43504803	hsa-let-7f-5p	0	1
chr11:77322120\|77322275	hsa-let-7f-5p	0	1
chr11:65120773\|65121551	hsa-let-7f-5p	0	1
chr2:219386030\|219386331	hsa-let-7f-5p	0	1
chr6:30492807\|30492970	hsa-let-7f-5p	0	1
chr2:203304086\|203304230	hsa-let-7f-5p	0	1
chr5:179838068\|179838353	hsa-let-7f-5p	0	1
chr10:73773532\|73773666	hsa-let-7f-5p	0	1
chr10:37303050\|37303198	hsa-let-7f-5p	0	1
chr14:24239699\|24239868	hsa-let-7f-5p	0	1
chr5:90519077\|90519205	hsa-let-7f-5p	0	1
chr14:77338533\|77338686	hsa-let-7f-5p	0	1
chr14:95408115\|95408235	hsa-let-7f-5p	0	1
chr2:63926908\|63927064	hsa-let-7f-5p	0	1
chr22:29054837\|29054945	hsa-let-7f-5p	0	1
chr1:58576329\|58576571	hsa-let-7f-5p	0	1
chr12:124341948\|124342060	hsa-let-7f-5p	0	1
chr9:37506440\|37506607	hsa-let-7f-5p	0	1
chr6:41590073\|41590331	hsa-let-7f-5p	0	1
chr6:33304189\|33304381	hsa-let-7f-5p	0	1
chr14:24239637\|24239893	hsa-let-7f-5p	0	1
chr3:58153375~58153641	hsa-let-7f-5p	0	1
chr5:81312613~81312705	hsa-let-7f-5p	0	1
chr14:24239703~24239868	hsa-let-7f-5p	0	1
chrX:16588204\|16588496	hsa-let-7f-5p	0	1
chr3:50108089~50108304	hsa-let-7f-5p	0	1
chr14:39181398~39181656	hsa-let-7f-5p	0	1
chr19:54459763~54459970	hsa-let-7f-5p	0	1
chr1:153747943~153748084	hsa-let-7f-5p	0	1
chr11:9027151\|9027248	hsa-let-7f-5p	0	1
chr6:33250375~33250547	hsa-let-7f-5p	0	1
chr16:23571502\|23571698	hsa-let-7f-5p	0	1
chr5:138467757~138467864	hsa-let-7f-5p	0	1
chr19:55592477~55592656	hsa-let-7f-5p	0	1
chr1:154583463~154583594	hsa-let-7f-5p	0	1
chr12:55725849~55726230	hsa-let-7f-5p	0	1
chr14:77338541~77338706	hsa-let-7f-5p	0	1
chr1:179044202~179050365	hsa-let-7f-5p	0	1
chr4:67734016~67734148	hsa-let-7f-5p	0	1
chr17:41523670~41523965	hsa-let-7f-5p	0	1
chr19:43461557~43461719	hsa-let-7f-5p	0	1
chr11:65121500~65121572	hsa-let-7f-5p	0	1
chr21:33296743~33296889	hsa-let-7f-5p	0	1
chr22:44862544~44862635	hsa-let-7f-5p	0	1
chr14:77338541~77338729	hsa-let-7f-5p	0	1
chr17:81511345~81511546	hsa-let-7f-5p	0	1
chr5:138467757~138467882	hsa-let-7f-5p	0	1
chr10:17233836~17233931	hsa-let-7f-5p	0	1
chr7:105143084~105143144	hsa-let-7f-5p	0	1
chr19:51952083~51952195	hsa-let-7f-5p	0	1
chr18:74390036~74390228	hsa-let-7f-5p	0	1
chr16:16141650\|16141730	hsa-let-7f-5p	0	1
chr17:41523670~41523786	hsa-let-7f-5p	0	1
chr1:150965491~150965681	hsa-let-7f-5p	0	1
chr6:31815546~31815627	hsa-let-7f-5p	0	1
chr6:17427089~17427209	hsa-let-7f-5p	0	1
chr1:171652008~171652148	hsa-let-7f-5p	0	1
chr19:40805241~40805352	hsa-let-7f-5p	0	1
chr14:24239703~24239885	hsa-let-7f-5p	0	1
chr2:111165529~111165685	hsa-let-7f-5p	0	1
chr11:78069113~78069290	hsa-let-7f-5p	0	1
chr14:21497907~21498028	hsa-let-7f-5p	0	1
chr5:138467757~138467870	hsa-let-7f-5p	0	1
chr16:48352409~48352569	hsa-let-7f-5p	0	1
chr19:39408079~39408339	hsa-let-7f-5p	0	1
chr2:62135831~62135958	hsa-let-7f-5p	0	1
chr2:60923712~60924010	hsa-let-7f-5p	0	1
chr1:150965480~150965784	hsa-let-7f-5p	0	1
chr1:51312878~51321770	hsa-let-7f-5p	0	1
chr3:60821919\|60822011	hsa-let-7f-5p	0	1
chr11:66840124~66840299	hsa-let-7f-5p	0	1
chr14:22972491~22972632	hsa-let-7f-5p	0	1
chr12:110346910~110347045	hsa-let-7f-5p	0	1
chrX:101393546~101393648	hsa-let-7f-5p	0	1
chr3:38419896\|38419982	hsa-let-7f-5p	0	1
chr12:57716493~57717958	hsa-let-7f-5p	0	1
chr12:66304552~66304694	hsa-let-7f-5p	0	1
chr4:26886367\|26886484	hsa-let-7f-5p	1	0
chr11:45650703\|45650849	hsa-let-7f-5p	1	0
chr16:57568431\|57569135	hsa-let-7f-5p	1	0
chr3:63924772\|63924883	hsa-let-7f-5p	1	0
chr1:27595805\|27595933	hsa-let-7f-5p	1	0
chr18:25322008\|25322187	hsa-let-7f-5p	1	0
chr2:241211377\|241211597	hsa-let-7f-5p	1	0
chr7:151841343\|151841474	hsa-let-7f-5p	1	0
chr11:9506596\|9506731	hsa-let-7f-5p	1	0
chr18:62531914\|62532059	hsa-let-7f-5p	1	0
chr16:57568560\|57569255	hsa-let-7f-5p	1	0
chr2:43291808\|43291918	hsa-let-7f-5p	0	1
chr6:111306310\|111306477	hsa-let-7f-5p	0	1
chr19:34391343\|34391543	hsa-let-7f-5p	0	1
chr9:91299709\|91299862	hsa-let-7f-5p	0	1
chr2:218403355\|218403556	hsa-let-7f-5p	0	1
chr5:77785447\|77785714	hsa-let-7f-5p	0	1
chrX:41200424\|41200573	hsa-let-7f-5p	0	1
chr8:119830879\|119831036	hsa-let-7f-5p	0	1
chr1:108699419\|108699542	hsa-let-7f-5p	0	1
chr3:174743972\|174744185	hsa-let-7f-5p	0	1
chr17:81511267\|81511452	hsa-let-7f-5p	0	1
chr1:169376854\|169376947	hsa-let-7f-5p	0	1
chr22:36340720\|36340843	hsa-let-7f-5p	0	1
chr17:81511285\|81511452	hsa-let-7f-5p	0	1
chr4:15051674\|15051872	hsa-let-7f-5p	0	1
chr2:231463211\|231463351	hsa-let-7f-5p	0	1
chr1:108699443\|108699570	hsa-let-7f-5p	0	1
chr5:138467593\|138467891	hsa-let-7f-5p	0	1
chr5:119254719\|119254851	hsa-let-7f-5p	0	1
chr6:42745339\|42745509	hsa-let-7f-5p	0	1
chr21:36257670\|36257783	hsa-let-7f-5p	0	1
chr12:7925599\|7925781	hsa-let-7f-5p	1	0
chr17:57551412\|57551553	hsa-let-7f-5p	1	0
chr15:65166846\|65166973	hsa-let-7f-5p	1	0
chr7:151841607\|151841771	hsa-let-7f-5p	1	0
chr1:6224507\|6224643	hsa-let-7f-5p	1	0
chr17:58316997\|58317131	hsa-let-7f-5p	0	1
chr21:28730240\|28730450	hsa-let-7f-5p	0	1
chr13:51753952\|51754139	hsa-let-7f-5p	0	1
chr19:1270563\|1270702	hsa-let-7f-5p	0	1
chr1:108699384\|108699542	hsa-let-7f-5p	0	1
chrX:66019798\|66019970	hsa-let-7f-5p	0	1
chr6:111306313\|111306477	hsa-let-7f-5p	0	1
chr22:47004480\|47004635	hsa-let-7f-5p	0	1
chr10:89235706\|89235942	hsa-let-7f-5p	0	1
chr11:3869443\|3869557	hsa-let-7f-5p	0	1
chr19:54458337\|54458501	hsa-let-7f-5p	0	1
chrX:66018258\|66018377	hsa-let-7f-5p	0	1
chr5:131403884\|131404041	hsa-let-7f-5p	0	1
chr16:85567746\|85567881	hsa-let-7f-5p	0	1
chrY:7344248\|7344371	hsa-let-7f-5p	0	1
chr2:113744611\|113744794	hsa-let-7f-5p	0	1
chr1:55066395\|55066539	hsa-let-7f-5p	0	1
chr5:138467757\|138467840	hsa-let-7f-5p	0	1
chr12:52617571\|52617709	hsa-let-7f-5p	0	1
chrX:65633085\|65633241	hsa-let-7f-5p	0	1
chr7:135632139\|135632355	hsa-let-7f-5p	0	1
chrX:130837658\|130837818	hsa-let-7f-5p	0	1
chr2:189804849\|189805006	hsa-let-7f-5p	0	1
chr8:133255046\|133255223	hsa-let-7f-5p	1	0
chr11:117995261\|117995431	hsa-let-7f-5p	1	0
chrX:1406754\|1407041	hsa-let-7f-5p	1	0
chr11:65423138\|65423223	hsa-let-7f-5p	1	0
chr1:45607701\|45607793	hsa-let-7f-5p	1	0
chr15:58912563\|58916999	hsa-let-7f-5p	1	0
chr15:51869217\|51902036	hsa-let-7f-5p	1	0
chr15:42260958\|42268032	hsa-let-7f-5p	1	0
chr4:82878730\|82881940	hsa-let-7f-5p	1	0
chr1:630228\|630337	hsa-let-7f-5p	1	0
chr11:33709748\|33709911	hsa-let-7f-5p	1	0
chr11:65569339\|65569427	hsa-let-7f-5p	1	0
chr12:101756945\|101757149	hsa-let-7f-5p	1	0
chr1:630237\|630337	hsa-let-7f-5p	1	0
chr2:74329782\|74330032	hsa-let-7f-5p	1	0
chr1:161542516\|161542652	hsa-let-7f-5p	1	0
chr5:173959907\|173960082	hsa-let-7f-5p	1	0
chrX:37454907\|37455050	hsa-let-7f-5p	1	0
chr4:10075021\|10075189	hsa-let-7f-5p	0	1
chr19:7559369\|7559632	hsa-let-7f-5p	0	1
chr11:130914956\|130915122	hsa-let-7f-5p	0	1
chr3:4984133\|4984271	hsa-let-7f-5p	0	1
chr1:151342181\|151342290	hsa-let-7f-5p	0	1
chr2:25739030\|25739103	hsa-let-7f-5p	0	1
chr20:17620077\|17620225	hsa-let-7f-5p	0	1
chr16:11871337\|11871508	hsa-let-7f-5p	0	1
chr4:139302326\|139302452	hsa-let-7f-5p	0	1
chr1:6621546\|6621885	hsa-let-7f-5p	0	1
chr10:102380264\|102380394	hsa-let-7f-5p	0	1
chr16:31121497\|31121623	hsa-let-7f-5p	0	1
chr16:28477598\|28477847	hsa-let-7f-5p	0	1
chr10:73808408\|73808612	hsa-let-7f-5p	0	1
chr14:39181337\|39181656	hsa-let-7f-5p	0	1
chr3:4984133\|4984274	hsa-let-7f-5p	0	1
chr4:76215436\|76215569	hsa-let-7f-5p	0	1
chr3:4984151\|4984287	hsa-let-7f-5p	0	1
chr20:3164080\|3164364	hsa-let-7f-5p	0	1
chr6:41590073\|41590335	hsa-let-7f-5p	0	1
chr14:68879962\|68880064	hsa-let-7f-5p	0	1
chr7:30924907\|30925088	hsa-let-7f-5p	0	1
chr12:55725852\|55726194	hsa-let-7f-5p	0	1
chr17:81511345\|81511546	hsa-let-7f-5p	0	1
chr14:73251539\|73251749	hsa-let-7f-5p	0	1
chr17:5319234\|5319387	hsa-let-7f-5p	0	1
chr5:90519087\|90519203	hsa-let-7f-5p	0	1
chr11:64769035\|64769299	hsa-let-7f-5p	0	1
chr2:62135864\|62135958	hsa-let-7f-5p	0	1
chr17:41523670\|41523856	hsa-let-7f-5p	0	1
chr15:40844876\|40844997	hsa-let-7f-5p	0	1
chr3:4984123\|4984274	hsa-let-7f-5p	0	1
chr6:30492807\|30492968	hsa-let-7f-5p	0	1
chr19:15397150\|15397251	hsa-let-7f-5p	0	1
chr15:80890445\|80890525	hsa-let-7f-5p	0	1
chr1:46359266\|46359502	hsa-let-7f-5p	0	1
chr1:108699447\|108699542	hsa-let-7f-5p	0	1
chr5:41730450\|41730543	hsa-let-7f-5p	0	1
chr12:68844528\|68844709	hsa-let-7f-5p	0	1
chr15:41846695\|41846817	hsa-let-7f-5p	0	1
chr12:64759223\|64759375	hsa-let-7f-5p	0	1
chr6:7303550\|7310029	hsa-let-7f-5p	0	1
chr3:185437156\|185437347	hsa-let-7f-5p	0	1
chr15:40471805\|40471998	hsa-let-7f-5p	0	1
chr15:43799027\|43799415	hsa-let-7f-5p	0	1
chr12:111887383\|111887610	hsa-let-7f-5p	0	1
chr1:179851211\|179851319	hsa-let-7f-5p	0	1
chr5:138467596\|138467864	hsa-let-7f-5p	0	1
chr17:76481991\|76482169	hsa-let-7f-5p	0	1
chr10:72235212\|72235387	hsa-let-7f-5p	0	1
chr16:17104011\|17104191	hsa-let-7f-5p	0	1
chr8:38261503\|38261603	hsa-let-7f-5p	0	1
chr12:56999526\|56999719	hsa-let-7f-5p	0	1
chr17:81511410\|81511504	hsa-let-7f-5p	0	1
chr1:6212825\|6213160	hsa-let-7f-5p	0	1
chr3:47851202\|47851402	hsa-let-7f-5p	0	1
chr11:72229190\|72229524	hsa-let-7f-5p	0	1
chr17:81705496\|81705604	hsa-let-7f-5p	0	1
chr15:91022369\|91022484	hsa-let-7f-5p	0	1
chr1:28147697\|28147866	hsa-let-7f-5p	0	1
chr12:55725849\|55726230	hsa-let-7f-5p	0	1
chrX:47181281\|47181554	hsa-let-7f-5p	0	1
chr1:219272417\|219272711	hsa-let-7f-5p	0	1
chr21:33296721\|33296889	hsa-let-7f-5p	0	1
chr17:4797752\|4798049	hsa-let-7f-5p	0	1
chr6:32848731\|32849062	hsa-let-7f-5p	0	1
chr1:85707832\|85707936	hsa-let-7f-5p	0	1
chr5:81312628\|81312744	hsa-let-7f-5p	0	1
chr12:130992632\|130992745	hsa-let-7f-5p	0	1
chr3:4984158\|4984287	hsa-let-7f-5p	0	1
chr1:113839202\|113839380	hsa-let-7f-5p	0	1
chr17:41523747\|41523856	hsa-let-7f-5p	0	1
chr1:151117996\|151118168	hsa-let-7f-5p	0	1
chr1:221981589\|221981726	hsa-let-7f-5p	0	1
chr6:150214744\|150216856	hsa-let-7f-5p	0	1
chr7:30924900\|30925039	hsa-let-7f-5p	0	1
chr15:74176152\|74176268	hsa-let-7f-5p	0	1
chr8:119846511\|119846672	hsa-let-7f-5p	0	1
chr6:2949395\|2949626	hsa-let-7f-5p	0	1
chr15:100893672\|100893867	hsa-let-7f-5p	0	1
chr19:974343\|974679	hsa-let-7f-5p	0	1
chr1:204288105\|204288267	hsa-let-7f-5p	0	1
chr16:4853938\|4854147	hsa-let-7f-5p	0	1
chr10:63623003\|63623335	hsa-let-7f-5p	0	1
chr7:107759265\|107759441	hsa-let-7f-5p	0	1
chr14:39181446\|39181656	hsa-let-7f-5p	0	1
chr3:32481869\|32482047	hsa-let-7f-5p	0	1
chr17:38848885\|38849019	hsa-let-7f-5p	0	1
chr19:39408009\|39408344	hsa-let-7f-5p	0	1
chr20:23639864\|23640043	hsa-let-7f-5p	0	1
chr4:189014039\|189014157	hsa-let-7f-5p	0	1
chr3:50108086\|50109631	hsa-let-7f-5p	0	1
chr12:47780156\|47780328	hsa-let-7f-5p	0	1
chr10:73016874\|73030370	hsa-let-7f-5p	0	1
chr3:50108089\|50108304	hsa-let-7f-5p	0	1
chr3:50108125\|50109631	hsa-let-7f-5p	0	1
chr4:156767838\|156767964	hsa-let-7f-5p	0	1
chr12:49273992\|49274145	hsa-let-7f-5p	-11	1
chr12:49021679\|49021842	hsa-let-7f-5p	-5	1
chr12:112022170\|112022378	hsa-let-7f-5p	-15	1
chr3:68977186\|68977367	hsa-let-7f-5p	-7	1
chr19:39408009\|39408362	hsa-let-7f-5p	-7	1
chr12:113297109\|113297371	hsa-let-7f-5p	0	1
chr17:39742799\|39742942	hsa-let-7f-5p	-16	1
chr12:55993604\|55993842	hsa-let-7f-5p	1	0
chr7:90390129\|90390250	hsa-let-7f-5p	1	0
chrX:68536764\|68536847	hsa-let-7f-5p	1	0
chr16:30737566\|30737671	hsa-let-7f-5p	1	0
chr11:45240777\|45240839	hsa-let-7f-5p	1	0
chr13:75856569\|75856681	hsa-let-7f-5p	1	0
chr9:4863922\|4864038	hsa-let-7f-5p	1	0
chr9:113407826\|113408022	hsa-let-7f-5p	1	0
chr13:53051545\|53051730	hsa-let-7f-5p	1	0
chr17:35985372\|35985481	hsa-let-7f-5p	1	0
chr11:116836264\|116837032	hsa-let-7f-5p	1	0
chr1:45607692\|45607862	hsa-let-7f-5p	1	0
chr22:30416251\|30416327	hsa-let-7f-5p	1	0
chr1:630231\|630337	hsa-let-7f-5p	1	0
chr1:630242\|630337	hsa-let-7f-5p	1	0
chr15:41826722\|41826881	hsa-let-7f-5p	1	0
chr6:33250375\|33250547	hsa-let-7f-5p	0	1
chrX:47181238\|47181584	hsa-let-7f-5p	0	1
chr19:39408051\|39408231	hsa-let-7f-5p	0	1
chr17:81540224\|81540344	hsa-let-7f-5p	0	1
chr9:35742005\|35742334	hsa-let-7f-5p	0	1
chr7:101004659\|101004745	hsa-let-7f-5p	0	1
chr5:58455733\|58456095	hsa-let-7f-5p	0	1
chr21:33296709\|33296889	hsa-let-7f-5p	0	1
chr11:64823790\|64823900	hsa-let-7f-5p	0	1
chr19:39407990\|39408231	hsa-let-7f-5p	0	1
chr1:108699449\|108699559	hsa-let-7f-5p	0	1
chr12:124341939\|124342048	hsa-let-7f-5p	0	1
chr13:113258663\|113258762	hsa-let-7f-5p	0	1
chr3:48746868\|48746985	hsa-let-7f-5p	0	1
chr17:16317262\|16317556	hsa-let-7f-5p	0	1
chr7:101004659\|101004907	hsa-let-7f-5p	0	1
chr4:76922253\|76922399	hsa-let-7f-5p	0	1
chr19:2413948\|2414138	hsa-let-7f-5p	0	1
chr8:8891005\|8891149	hsa-let-7f-5p	0	1
chr19:541587\|541848	hsa-let-7f-5p	0	1
chr8:38261453\|38261603	hsa-let-7f-5p	0	1
chr2:28335698\|28335875	hsa-let-7f-5p	0	1
chr3:49721216\|49721338	hsa-let-7f-5p	0	1
chr15:91022359\|91022488	hsa-let-7f-5p	0	1
chr1:33146566\|33146686	hsa-let-7f-5p	0	1
chr1:207794532\|207794644	hsa-let-7f-5p	0	1
chr12:110346910\|110347060	hsa-let-7f-5p	0	1
chr4:10075021\|10075163	hsa-let-7f-5p	0	1
chr19:541582\|541753	hsa-let-7f-5p	0	1
chr9:121181319\|121181463	hsa-let-7f-5p	0	1
chr11:64769022\|64769299	hsa-let-7f-5p	0	1
chr2:85324590\|85324709	hsa-let-7f-5p	0	1
chr12:51060090\|51060251	hsa-let-7f-5p	0	1
chr3:185489736\|185489935	hsa-let-7f-5p	0	1
chr6:41590073\|41590325	hsa-let-7f-5p	0	1
chrX:154026870\|154026956	hsa-let-7f-5p	0	1
chr19:34390642\|34390793	hsa-let-7f-5p	0	1
chr20:62813507\|62813616	hsa-let-7f-5p	0	1
chr11:34661863\|34662034	hsa-let-7f-5p	0	1
chr17:81721274\|81721478	hsa-let-7f-5p	0	1
chr20:43562177\|43562347	hsa-let-7f-5p	0	1
chr17:41523657\|41523856	hsa-let-7f-5p	0	1
chr21:33296778\|33296889	hsa-let-7f-5p	0	1
chr19:35732259\|35732465	hsa-let-7f-5p	0	1
chr6:12292796\|12292922	hsa-let-7f-5p	0	1
chr19:2272763\|2273104	hsa-let-7f-5p	0	1
chr8:17874425\|17882064	hsa-let-7f-5p	0	1
chr11:111913872\|111914006	hsa-let-7f-5p	0	1
chr17:81511345\|81511518	hsa-let-7f-5p	0	1
chr5:154460269\|154460434	hsa-let-7f-5p	0	1
chr19:39408145\|39408231	hsa-let-7f-5p	0	1
chr12:6906479\|6906611	hsa-let-7f-5p	0	1
chr20:62813526\|62813616	hsa-let-7f-5p	0	1
chr1:151342151\|151342376	hsa-let-7f-5p	0	1
chr9:101562478\|101562750	hsa-let-7f-5p	0	1
chr14:22773110\|22773333	hsa-let-7f-5p	0	1
chr2:207766130\|207766323	hsa-let-7f-5p	0	1
chr4:51863437\|51863709	hsa-let-7f-5p	0	1
chr10:100364325\|100364513	hsa-let-7f-5p	0	1
chr2:218754263\|218754491	hsa-let-7f-5p	0	1
chr1:154988160\|154988287	hsa-let-7f-5p	0	1
chr8:38261475\|38261603	hsa-let-7f-5p	0	1
chr17:81511330\|81511452	hsa-let-7f-5p	0	1
chr1:32192395\|32193236	hsa-let-7f-5p	0	1
chr2:207766130\|207766358	hsa-let-7f-5p	0	1
chr20:34075668\|34075756	hsa-let-7f-5p	0	1
chr2:130345374\|130345629	hsa-let-7f-5p	0	1
chr2:130345390\|130345629	hsa-let-7f-5p	0	1
chr5:75371536\|75371659	hsa-let-7f-5p	0	1
chr2:218340978\|218341127	hsa-let-7f-5p	0	1
chr15:44733478\|44733631	hsa-let-7f-5p	0	1
chr2:219224260\|219224370	hsa-let-7f-5p	0	1
chr12:47780161\|47780328	hsa-let-7f-5p	0	1
chr14:22972538\|22972712	hsa-let-7f-5p	0	1
chr19:48868208\|48868382	hsa-let-7f-5p	1	0
chr8:126555632\|126555798	hsa-let-7f-5p	0	1
chr17:4164749\|4164891	hsa-let-7f-5p	0	1
chr1:28147716\|28147859	hsa-let-7f-5p	0	1
chr2:84870327\|84870470	hsa-let-7f-5p	0	1
chr16:89557287\|89557443	hsa-let-7f-5p	0	1
chr3:188889171\|188889371	hsa-let-7f-5p	0	1
chr14:77338541\|77338675	hsa-let-7f-5p	0	1
chr2:238247698\|238247800	hsa-let-7f-5p	1	0
chr19:48868208\|48868329	hsa-let-7f-5p	1	0
chr1:45607701\|45607862	hsa-let-7f-5p	1	0
chr3:58320885\|58321055	hsa-let-7f-5p	1	0
chr19:48868208\|48868296	hsa-let-7f-5p	1	0
chr2:191243483\|191243661	hsa-let-7f-5p	1	0
chr1:22638975\|22639154	hsa-let-7f-5p	1	0
chr10:31527101\|31527234	hsa-let-7f-5p	1	0
chr18:54541093\|54541271	hsa-let-7f-5p	1	0
chr2:207120084\|207120195	hsa-let-7f-5p	1	0
chr17:44190518\|44190671	hsa-let-7f-5p	1	0
chr8:38934104\|38934222	hsa-let-7f-5p	1	0
chr17:51185332\|51185432	hsa-let-7f-5p	1	0
chr11:65976062\|65976237	hsa-let-7f-5p	1	0
chr17:48050787\|48050917	hsa-let-7f-5p	1	0
chr1:85707742\|85707876	hsa-let-7f-5p	1	0
chr3:132677236\|132677402	hsa-let-7f-5p	1	0
chr17:48050787\|48051023	hsa-let-7f-5p	1	0
chr17:7000523\|7000678	hsa-let-7f-5p	1	0
chr3:39083596\|39083717	hsa-let-7f-5p	1	0
chr3:132677300\|132677402	hsa-let-7f-5p	1	0
chr12:55993557\|55993842	hsa-let-7f-5p	1	0
chr9:113407826\|113408003	hsa-let-7f-5p	1	0
chr19:41329045\|41329265	hsa-let-7f-5p	1	0

Target genes

miRNA	Gene	Gene Description	HGNC ID	details
hsa-let-7f-5p	KLK10	kallikrein related peptidase 10	HGNC:6358	details
hsa-let-7f-5p	KLK6	kallikrein related peptidase 6	HGNC:6367	details
hsa-let-7f-5p	PRDM1	PR/SET domain 1	HGNC:9346	details
hsa-let-7f-5p	IL13	interleukin 13	HGNC:5973	details
hsa-let-7f-5p	MPL	MPL proto-oncogene, thrombopoietin receptor	HGNC:7217	details
hsa-let-7f-5p	CYP19A1	cytochrome P450 family 19 subfamily A member 1	HGNC:2594	details
hsa-let-7f-5p	KIF1A	kinesin family member 1A	HGNC:888	details
hsa-let-7f-5p	FDPS	farnesyl diphosphate synthase	HGNC:3631	details
hsa-let-7f-5p	TFF1	trefoil factor 1	HGNC:11755	details
hsa-let-7f-5p	EEF1A2	eukaryotic translation elongation factor 1 alpha 2	HGNC:3192	details
hsa-let-7f-5p	ESM1	endothelial cell specific molecule 1	HGNC:3466	details
hsa-let-7f-5p	ASS1	argininosuccinate synthase 1	HGNC:758	details
hsa-let-7f-5p	VIM	vimentin	HGNC:12692	details
hsa-let-7f-5p	NTS	neurotensin	HGNC:8038	details
hsa-let-7f-5p	COPS8	COP9 signalosome subunit 8	HGNC:24335	details
hsa-let-7f-5p	NKX2-1	NK2 homeobox 1	HGNC:11825	details
hsa-let-7f-5p	SLC5A5	solute carrier family 5 member 5	HGNC:11040	details
hsa-let-7f-5p	MYC	MYC proto-oncogene, bHLH transcription factor	HGNC:7553	details
hsa-let-7f-5p	GPS1	G protein pathway suppressor 1	HGNC:4549	details
hsa-let-7f-5p	TG	thyroglobulin	HGNC:11764	details
hsa-let-7f-5p	CCND1	cyclin D1	HGNC:1582	details
hsa-let-7f-5p	COPS6	COP9 signalosome subunit 6	HGNC:21749	details
hsa-let-7f-5p	CDKN1A	cyclin dependent kinase inhibitor 1A	HGNC:1784	details
hsa-let-7f-5p	MSL3	MSL complex subunit 3	HGNC:7370	details
hsa-let-7f-5p	MEF2D	myocyte enhancer factor 2D	HGNC:6997	details
hsa-let-7f-5p	ZC3H18	zinc finger CCCH-type containing 18	HGNC:25091	details
hsa-let-7f-5p	UBAP2	ubiquitin associated protein 2	HGNC:14185	details
hsa-let-7f-5p	CEP170B	centrosomal protein 170B	HGNC:20362	details
hsa-let-7f-5p	EIF3C	eukaryotic translation initiation factor 3 subunit C	HGNC:3279	details
hsa-let-7f-5p	ARMC8	armadillo repeat containing 8	HGNC:24999	details
hsa-let-7f-5p				details
hsa-let-7f-5p	SNRPC	small nuclear ribonucleoprotein polypeptide C	HGNC:11157	details
hsa-let-7f-5p	YARS2	tyrosyl-tRNA synthetase 2	HGNC:24249	details
hsa-let-7f-5p	GLUL	glutamate-ammonia ligase	HGNC:4341	details
hsa-let-7f-5p	ARID3B	AT-rich interaction domain 3B	HGNC:14350	details
hsa-let-7f-5p	HNRNPUL1	heterogeneous nuclear ribonucleoprotein U like 1	HGNC:17011	details
hsa-let-7f-5p	USP45	ubiquitin specific peptidase 45	HGNC:20080	details
hsa-let-7f-5p	RABEP1	rabaptin, RAB GTPase binding effector protein 1	HGNC:17677	details
hsa-let-7f-5p	CNOT8	CCR4-NOT transcription complex subunit 8	HGNC:9207	details
hsa-let-7f-5p	SLC33A1	solute carrier family 33 member 1	HGNC:95	details
hsa-let-7f-5p				details
hsa-let-7f-5p	UBAP2L	ubiquitin associated protein 2 like	HGNC:29877	details
hsa-let-7f-5p	ARL6IP1	ADP ribosylation factor like GTPase 6 interacting protein 1	HGNC:697	details
hsa-let-7f-5p	SP1	Sp1 transcription factor	HGNC:11205	details
hsa-let-7f-5p	YWHAQ	tyrosine 3-monooxygenase/tryptophan 5-monooxygenase activation protein theta	HGNC:12854	details
hsa-let-7f-5p				details
hsa-let-7f-5p	SF3A1	splicing factor 3a subunit 1	HGNC:10765	details
hsa-let-7f-5p	ALDH7A1	aldehyde dehydrogenase 7 family member A1	HGNC:877	details
hsa-let-7f-5p	LARP1	La ribonucleoprotein 1, translational regulator	HGNC:29531	details
hsa-let-7f-5p	SMARCC1	SWI/SNF related, matrix associated, actin dependent regulator of chromatin subfamily c member 1	HGNC:11104	details
hsa-let-7f-5p				details
hsa-let-7f-5p	TSPAN3	tetraspanin 3	HGNC:17752	details
hsa-let-7f-5p	GBF1	golgi brefeldin A resistant guanine nucleotide exchange factor 1	HGNC:4181	details
hsa-let-7f-5p	CAPRIN2	caprin family member 2	HGNC:21259	details
hsa-let-7f-5p	BAZ1B	bromodomain adjacent to zinc finger domain 1B	HGNC:961	details
hsa-let-7f-5p				details
hsa-let-7f-5p	DYNC1LI2	dynein cytoplasmic 1 light intermediate chain 2	HGNC:2966	details
hsa-let-7f-5p	ROR2	receptor tyrosine kinase like orphan receptor 2	HGNC:10257	details
hsa-let-7f-5p	ANP32C	acidic nuclear phosphoprotein 32 family member C	HGNC:16675	details
hsa-let-7f-5p	TAB2	TGF-beta activated kinase 1 (MAP3K7) binding protein 2	HGNC:17075	details
hsa-let-7f-5p	ATXN2L	ataxin 2 like	HGNC:31326	details
hsa-let-7f-5p	SPTBN5	spectrin beta, non-erythrocytic 5	HGNC:15680	details
hsa-let-7f-5p				details
hsa-let-7f-5p	GTF2E1	general transcription factor IIE subunit 1	HGNC:4650	details
hsa-let-7f-5p	SLC25A12	solute carrier family 25 member 12	HGNC:10982	details
hsa-let-7f-5p	ATR	ATR serine/threonine kinase	HGNC:882	details
hsa-let-7f-5p	BCOR	BCL6 corepressor	HGNC:20893	details
hsa-let-7f-5p	ASCC3	activating signal cointegrator 1 complex subunit 3	HGNC:18697	details
hsa-let-7f-5p	ZNF280B	zinc finger protein 280B	HGNC:23022	details
hsa-let-7f-5p	ATP2A2	ATPase sarcoplasmic/endoplasmic reticulum Ca2+ transporting 2	HGNC:812	details
hsa-let-7f-5p	CNEP1R1	CTD nuclear envelope phosphatase 1 regulatory subunit 1	HGNC:26759	details
hsa-let-7f-5p	CCNB2	cyclin B2	HGNC:1580	details
hsa-let-7f-5p	USP2	ubiquitin specific peptidase 2	HGNC:12618	details
hsa-let-7f-5p	IGF2BP1	insulin like growth factor 2 mRNA binding protein 1	HGNC:28866	details
hsa-let-7f-5p	HMGA2	high mobility group AT-hook 2	HGNC:5009	details
hsa-let-7f-5p	HNRNPA2B1	heterogeneous nuclear ribonucleoprotein A2/B1	HGNC:5033	details
hsa-let-7f-5p	LRIG3	leucine rich repeats and immunoglobulin like domains 3	HGNC:30991	details
hsa-let-7f-5p	ASTE1	asteroid homolog 1	HGNC:25021	details
hsa-let-7f-5p	NUDT4	nudix hydrolase 4	HGNC:8051	details
hsa-let-7f-5p	SART3	spliceosome associated factor 3, U4/U6 recycling protein	HGNC:16860	details
hsa-let-7f-5p	ATL1	atlastin GTPase 1	HGNC:11231	details
hsa-let-7f-5p	THOC5	THO complex 5	HGNC:19074	details
hsa-let-7f-5p	EDA	ectodysplasin A	HGNC:3157	details
hsa-let-7f-5p	CCNG1	cyclin G1	HGNC:1592	details
hsa-let-7f-5p	MYH9	myosin heavy chain 9	HGNC:7579	details
hsa-let-7f-5p	CALM1	calmodulin 1	HGNC:1442	details
hsa-let-7f-5p	PDGFB	platelet derived growth factor subunit B	HGNC:8800	details
hsa-let-7f-5p	FARP1	FERM, ARH/RhoGEF and pleckstrin domain protein 1	HGNC:3591	details
hsa-let-7f-5p	ACTR10	actin related protein 10	HGNC:17372	details
hsa-let-7f-5p				details
hsa-let-7f-5p	GALC	galactosylceramidase	HGNC:4115	details
hsa-let-7f-5p	FZD4	frizzled class receptor 4	HGNC:4042	details
hsa-let-7f-5p	TGFBR1	transforming growth factor beta receptor 1	HGNC:11772	details
hsa-let-7f-5p	SOCS3	suppressor of cytokine signaling 3	HGNC:19391	details
hsa-let-7f-5p	ELF4	E74 like ETS transcription factor 4	HGNC:3319	details
hsa-let-7f-5p	DYRK2	dual specificity tyrosine phosphorylation regulated kinase 2	HGNC:3093	details
hsa-let-7f-5p	CCL7	C-C motif chemokine ligand 7	HGNC:10634	details
hsa-let-7f-5p	NDUFA4P1	NDUFA4 pseudogene 1	HGNC:29835	details
hsa-let-7f-5p	ATP6V1G1	ATPase H+ transporting V1 subunit G1	HGNC:864	details
hsa-let-7f-5p	KIF27	kinesin family member 27	HGNC:18632	details
hsa-let-7f-5p	ZNF774	zinc finger protein 774	HGNC:33108	details
hsa-let-7f-5p	ANKRD46	ankyrin repeat domain 46	HGNC:27229	details
hsa-let-7f-5p	FMNL3	formin like 3	HGNC:23698	details
hsa-let-7f-5p	C19orf53	chromosome 19 open reading frame 53	HGNC:24991	details
hsa-let-7f-5p	MEIS3P1	Meis homeobox 3 pseudogene 1	HGNC:7002	details
hsa-let-7f-5p	C1RL	complement C1r subcomponent like	HGNC:21265	details
hsa-let-7f-5p	NUCB2	nucleobindin 2	HGNC:8044	details
hsa-let-7f-5p	QDPR	quinoid dihydropteridine reductase	HGNC:9752	details
hsa-let-7f-5p	ATP6V1F	ATPase H+ transporting V1 subunit F	HGNC:16832	details
hsa-let-7f-5p	DISC1	DISC1 scaffold protein	HGNC:2888	details
hsa-let-7f-5p	RHD	Rh blood group D antigen	HGNC:10009	details
hsa-let-7f-5p				details
hsa-let-7f-5p	FXN	frataxin	HGNC:3951	details
hsa-let-7f-5p	RABL2A	RAB, member of RAS oncogene family like 2A	HGNC:9799	details
hsa-let-7f-5p	ACOT9	acyl-CoA thioesterase 9	HGNC:17152	details
hsa-let-7f-5p	GLO1	glyoxalase I	HGNC:4323	details
hsa-let-7f-5p	RABL2B	RAB, member of RAS oncogene family like 2B	HGNC:9800	details
hsa-let-7f-5p	ZNF587	zinc finger protein 587	HGNC:30955	details
hsa-let-7f-5p	THEM6	thioesterase superfamily member 6	HGNC:29656	details
hsa-let-7f-5p	MRPL12	mitochondrial ribosomal protein L12	HGNC:10378	details
hsa-let-7f-5p	FUT10	fucosyltransferase 10	HGNC:19234	details
hsa-let-7f-5p	RRM1	ribonucleotide reductase catalytic subunit M1	HGNC:10451	details
hsa-let-7f-5p	NOM1	nucleolar protein with MIF4G domain 1	HGNC:13244	details
hsa-let-7f-5p				details
hsa-let-7f-5p	NOA1	nitric oxide associated 1	HGNC:28473	details
hsa-let-7f-5p	OPA3	outer mitochondrial membrane lipid metabolism regulator OPA3	HGNC:8142	details
hsa-let-7f-5p	SLC11A2	solute carrier family 11 member 2	HGNC:10908	details
hsa-let-7f-5p	COL8A1	collagen type VIII alpha 1 chain	HGNC:2215	details
hsa-let-7f-5p				details
hsa-let-7f-5p	ZNF8	zinc finger protein 8	HGNC:13154	details
hsa-let-7f-5p	ZC3HAV1L	zinc finger CCCH-type containing, antiviral 1 like	HGNC:22423	details
hsa-let-7f-5p	YWHAZ	tyrosine 3-monooxygenase/tryptophan 5-monooxygenase activation protein zeta	HGNC:12855	details
hsa-let-7f-5p	VCL	vinculin	HGNC:12665	details
hsa-let-7f-5p	TSC22D2	TSC22 domain family member 2	HGNC:29095	details
hsa-let-7f-5p	TMTC3	transmembrane O-mannosyltransferase targeting cadherins 3	HGNC:26899	details
hsa-let-7f-5p	TMED5	transmembrane p24 trafficking protein 5	HGNC:24251	details
hsa-let-7f-5p	SYNJ2BP	synaptojanin 2 binding protein	HGNC:18955	details
hsa-let-7f-5p	SLC20A1	solute carrier family 20 member 1	HGNC:10946	details
hsa-let-7f-5p	RNF144B	ring finger protein 144B	HGNC:21578	details
hsa-let-7f-5p	RAB40C	RAB40C, member RAS oncogene family	HGNC:18285	details
hsa-let-7f-5p	PPP1R15B	protein phosphatase 1 regulatory subunit 15B	HGNC:14951	details
hsa-let-7f-5p	POLR2D	RNA polymerase II subunit D	HGNC:9191	details
hsa-let-7f-5p	PLXND1	plexin D1	HGNC:9107	details
hsa-let-7f-5p	PGM2L1	phosphoglucomutase 2 like 1	HGNC:20898	details
hsa-let-7f-5p	PDP2	pyruvate dehyrogenase phosphatase catalytic subunit 2	HGNC:30263	details
hsa-let-7f-5p	PCGF3	polycomb group ring finger 3	HGNC:10066	details
hsa-let-7f-5p	NR6A1	nuclear receptor subfamily 6 group A member 1	HGNC:7985	details
hsa-let-7f-5p	NAA20	N-alpha-acetyltransferase 20, NatB catalytic subunit	HGNC:15908	details
hsa-let-7f-5p	MTUS1	microtubule associated scaffold protein 1	HGNC:29789	details
hsa-let-7f-5p	MLLT10	MLLT10 histone lysine methyltransferase DOT1L cofactor	HGNC:16063	details
hsa-let-7f-5p	MIEF1	mitochondrial elongation factor 1	HGNC:25979	details
hsa-let-7f-5p	MDM4	MDM4 regulator of p53	HGNC:6974	details
hsa-let-7f-5p	MAP2K7	mitogen-activated protein kinase kinase 7	HGNC:6847	details
hsa-let-7f-5p	LYN	LYN proto-oncogene, Src family tyrosine kinase	HGNC:6735	details
hsa-let-7f-5p	LRRC20	leucine rich repeat containing 20	HGNC:23421	details
hsa-let-7f-5p	KREMEN1	kringle containing transmembrane protein 1	HGNC:17550	details
hsa-let-7f-5p	KLHDC8B	kelch domain containing 8B	HGNC:28557	details
hsa-let-7f-5p	KIAA0930	KIAA0930	HGNC:1314	details
hsa-let-7f-5p	KCTD21	potassium channel tetramerization domain containing 21	HGNC:27452	details
hsa-let-7f-5p	IFNLR1	interferon lambda receptor 1	HGNC:18584	details
hsa-let-7f-5p	ICOSLG	inducible T cell costimulator ligand	HGNC:17087	details
hsa-let-7f-5p	HMGA1	high mobility group AT-hook 1	HGNC:5010	details
hsa-let-7f-5p	HERPUD1	homocysteine inducible ER protein with ubiquitin like domain 1	HGNC:13744	details
hsa-let-7f-5p	GABPB1	GA binding protein transcription factor subunit beta 1	HGNC:4074	details
hsa-let-7f-5p	FNDC3A	fibronectin type III domain containing 3A	HGNC:20296	details
hsa-let-7f-5p	FAM83G	family with sequence similarity 83 member G	HGNC:32554	details
hsa-let-7f-5p	EIF4G2	eukaryotic translation initiation factor 4 gamma 2	HGNC:3297	details
hsa-let-7f-5p	EFHD2	EF-hand domain family member D2	HGNC:28670	details
hsa-let-7f-5p	EDN1	endothelin 1	HGNC:3176	details
hsa-let-7f-5p	CRY2	cryptochrome circadian regulator 2	HGNC:2385	details
hsa-let-7f-5p	C5orf51	chromosome 5 open reading frame 51	HGNC:27750	details
hsa-let-7f-5p				details
hsa-let-7f-5p	BZW1	basic leucine zipper and W2 domains 1	HGNC:18380	details
hsa-let-7f-5p	ATXN7L3B	ataxin 7 like 3B	HGNC:37931	details
hsa-let-7f-5p	ATXN7L3	ataxin 7 like 3	HGNC:25416	details
hsa-let-7f-5p	ATG9A	autophagy related 9A	HGNC:22408	details
hsa-let-7f-5p	ATG12	autophagy related 12	HGNC:588	details
hsa-let-7f-5p	AREL1	apoptosis resistant E3 ubiquitin protein ligase 1	HGNC:20363	details
hsa-let-7f-5p	AP1S1	adaptor related protein complex 1 subunit sigma 1	HGNC:559	details
hsa-let-7f-5p	AHR	aryl hydrocarbon receptor	HGNC:348	details
hsa-let-7f-5p	AHCYL2	adenosylhomocysteinase like 2	HGNC:22204	details
hsa-let-7f-5p	PLAGL2	PLAG1 like zinc finger 2	HGNC:9047	details
hsa-let-7f-5p	IGF1R	insulin like growth factor 1 receptor	HGNC:5465	details
hsa-let-7f-5p	ZNF28	zinc finger protein 28	HGNC:13073	details
hsa-let-7f-5p	TUBB2A	tubulin beta 2A class IIa	HGNC:12412	details
hsa-let-7f-5p	ABT1	activator of basal transcription 1	HGNC:17369	details
hsa-let-7f-5p	ZBTB5	zinc finger and BTB domain containing 5	HGNC:23836	details
hsa-let-7f-5p	TNFSF9	TNF superfamily member 9	HGNC:11939	details
hsa-let-7f-5p	SOCS1	suppressor of cytokine signaling 1	HGNC:19383	details
hsa-let-7f-5p	PMAIP1	phorbol-12-myristate-13-acetate-induced protein 1	HGNC:9108	details
hsa-let-7f-5p	LIMD2	LIM domain containing 2	HGNC:28142	details
hsa-let-7f-5p	GRPEL2	GrpE like 2, mitochondrial	HGNC:21060	details
hsa-let-7f-5p	FAM43A	family with sequence similarity 43 member A	HGNC:26888	details
hsa-let-7f-5p	CEP120	centrosomal protein 120	HGNC:26690	details
hsa-let-7f-5p	ARID3A	AT-rich interaction domain 3A	HGNC:3031	details
hsa-let-7f-5p	TBC1D19	TBC1 domain family member 19	HGNC:25624	details
hsa-let-7f-5p	SNX17	sorting nexin 17	HGNC:14979	details
hsa-let-7f-5p	SLC12A7	solute carrier family 12 member 7	HGNC:10915	details
hsa-let-7f-5p	PLEKHO1	pleckstrin homology domain containing O1	HGNC:24310	details
hsa-let-7f-5p	PLCG2	phospholipase C gamma 2	HGNC:9066	details
hsa-let-7f-5p	GGA3	golgi associated, gamma adaptin ear containing, ARF binding protein 3	HGNC:17079	details
hsa-let-7f-5p	SDR42E1	short chain dehydrogenase/reductase family 42E, member 1	HGNC:29834	details
hsa-let-7f-5p	MFSD8	major facilitator superfamily domain containing 8	HGNC:28486	details
hsa-let-7f-5p				details
hsa-let-7f-5p	THBS1	thrombospondin 1	HGNC:11785	details
hsa-let-7f-5p	STRN	striatin	HGNC:11424	details
hsa-let-7f-5p	SMCR8	SMCR8-C9orf72 complex subunit	HGNC:17921	details
hsa-let-7f-5p	SMARCAD1	SWI/SNF-related, matrix-associated actin-dependent regulator of chromatin, subfamily a, containing DEAD/H box 1	HGNC:18398	details
hsa-let-7f-5p	SLC5A6	solute carrier family 5 member 6	HGNC:11041	details
hsa-let-7f-5p	SLC10A7	solute carrier family 10 member 7	HGNC:23088	details
hsa-let-7f-5p	SUMO1	small ubiquitin like modifier 1	HGNC:12502	details
hsa-let-7f-5p	SEMA4C	semaphorin 4C	HGNC:10731	details
hsa-let-7f-5p	RNFT1	ring finger protein, transmembrane 1	HGNC:30206	details
hsa-let-7f-5p	RNF44	ring finger protein 44	HGNC:19180	details
hsa-let-7f-5p	RBFOX2	RNA binding fox-1 homolog 2	HGNC:9906	details
hsa-let-7f-5p	RAB11FIP4	RAB11 family interacting protein 4	HGNC:30267	details
hsa-let-7f-5p	PDE12	phosphodiesterase 12	HGNC:25386	details
hsa-let-7f-5p	NSD1	nuclear receptor binding SET domain protein 1	HGNC:14234	details
hsa-let-7f-5p	NHLRC3	NHL repeat containing 3	HGNC:33751	details
hsa-let-7f-5p	NCOA3	nuclear receptor coactivator 3	HGNC:7670	details
hsa-let-7f-5p	MBD2	methyl-CpG binding domain protein 2	HGNC:6917	details
hsa-let-7f-5p	KPNA5	karyopherin subunit alpha 5	HGNC:6398	details
hsa-let-7f-5p	KMT2D	lysine methyltransferase 2D	HGNC:7133	details
hsa-let-7f-5p	CLDN12	claudin 12	HGNC:2034	details
hsa-let-7f-5p	CEP135	centrosomal protein 135	HGNC:29086	details
hsa-let-7f-5p	CELF1	CUGBP Elav-like family member 1	HGNC:2549	details
hsa-let-7f-5p	ACER2	alkaline ceramidase 2	HGNC:23675	details
hsa-let-7f-5p				details
hsa-let-7f-5p	C12orf4	chromosome 12 open reading frame 4	HGNC:1184	details
hsa-let-7f-5p	ZNF644	zinc finger protein 644	HGNC:29222	details
hsa-let-7f-5p	SMC1A	structural maintenance of chromosomes 1A	HGNC:11111	details
hsa-let-7f-5p	PPP2R2A	protein phosphatase 2 regulatory subunit Balpha	HGNC:9304	details
hsa-let-7f-5p	ONECUT2	one cut homeobox 2	HGNC:8139	details
hsa-let-7f-5p	NUP155	nucleoporin 155	HGNC:8063	details
hsa-let-7f-5p	IGDCC4	immunoglobulin superfamily DCC subclass member 4	HGNC:13770	details
hsa-let-7f-5p	FIGN	fidgetin, microtubule severing factor	HGNC:13285	details
hsa-let-7f-5p	COIL	coilin	HGNC:2184	details
hsa-let-7f-5p	C1orf210	chromosome 1 open reading frame 210	HGNC:28755	details
hsa-let-7f-5p	DIABLO	diablo IAP-binding mitochondrial protein	HGNC:21528	details
hsa-let-7f-5p	AK4	adenylate kinase 4	HGNC:363	details
hsa-let-7f-5p	STK4	serine/threonine kinase 4	HGNC:11408	details
hsa-let-7f-5p	ZNF566	zinc finger protein 566	HGNC:25919	details
hsa-let-7f-5p	YOD1	YOD1 deubiquitinase	HGNC:25035	details
hsa-let-7f-5p	IKZF3	IKAROS family zinc finger 3	HGNC:13178	details
hsa-let-7f-5p	CD59	CD59 molecule (CD59 blood group)	HGNC:1689	details
hsa-let-7f-5p	TRMO	tRNA methyltransferase O	HGNC:30967	details
hsa-let-7f-5p	ZBTB8OS	zinc finger and BTB domain containing 8 opposite strand	HGNC:24094	details
hsa-let-7f-5p	ZCCHC3	zinc finger CCHC-type containing 3	HGNC:16230	details
hsa-let-7f-5p	RDX	radixin	HGNC:9944	details
hsa-let-7f-5p	NCKIPSD	NCK interacting protein with SH3 domain	HGNC:15486	details
hsa-let-7f-5p	FZD9	frizzled class receptor 9	HGNC:4047	details
hsa-let-7f-5p	FBXW2	F-box and WD repeat domain containing 2	HGNC:13608	details
hsa-let-7f-5p	ESPL1	extra spindle pole bodies like 1, separase	HGNC:16856	details
hsa-let-7f-5p	DVL3	dishevelled segment polarity protein 3	HGNC:3087	details
hsa-let-7f-5p	DNA2	DNA replication helicase/nuclease 2	HGNC:2939	details
hsa-let-7f-5p	SOD2	superoxide dismutase 2	HGNC:11180	details
hsa-let-7f-5p	RRAD	RRAD, Ras related glycolysis inhibitor and calcium channel regulator	HGNC:10446	details
hsa-let-7f-5p	OPRL1	opioid related nociceptin receptor 1	HGNC:8155	details
hsa-let-7f-5p	WASL	WASP like actin nucleation promoting factor	HGNC:12735	details
hsa-let-7f-5p	LEFTY1	left-right determination factor 1	HGNC:6552	details
hsa-let-7f-5p	SALL3	spalt like transcription factor 3	HGNC:10527	details
hsa-let-7f-5p	UBXN2B	UBX domain protein 2B	HGNC:27035	details
hsa-let-7f-5p	RBM12B	RNA binding motif protein 12B	HGNC:32310	details
hsa-let-7f-5p	SLC16A9	solute carrier family 16 member 9	HGNC:23520	details
hsa-let-7f-5p	PM20D2	peptidase M20 domain containing 2	HGNC:21408	details
hsa-let-7f-5p	ZNF264	zinc finger protein 264	HGNC:13057	details
hsa-let-7f-5p	ZNF200	zinc finger protein 200	HGNC:12993	details
hsa-let-7f-5p	TXLNG	taxilin gamma	HGNC:18578	details
hsa-let-7f-5p	TGFBR3	transforming growth factor beta receptor 3	HGNC:11774	details
hsa-let-7f-5p	RRM2	ribonucleotide reductase regulatory subunit M2	HGNC:10452	details
hsa-let-7f-5p	NAT8L	N-acetyltransferase 8 like	HGNC:26742	details
hsa-let-7f-5p	NAA30	N-alpha-acetyltransferase 30, NatC catalytic subunit	HGNC:19844	details
hsa-let-7f-5p	MSI2	musashi RNA binding protein 2	HGNC:18585	details
hsa-let-7f-5p	IGF2BP3	insulin like growth factor 2 mRNA binding protein 3	HGNC:28868	details
hsa-let-7f-5p	FBXL20	F-box and leucine rich repeat protein 20	HGNC:24679	details
hsa-let-7f-5p	EPHA4	EPH receptor A4	HGNC:3388	details
hsa-let-7f-5p	DUSP1	dual specificity phosphatase 1	HGNC:3064	details
hsa-let-7f-5p	DNAL1	dynein axonemal light chain 1	HGNC:23247	details
hsa-let-7f-5p	COLEC12	collectin subfamily member 12	HGNC:16016	details
hsa-let-7f-5p	CCNT2	cyclin T2	HGNC:1600	details
hsa-let-7f-5p	CBX5	chromobox 5	HGNC:1555	details
hsa-let-7f-5p	BEND4	BEN domain containing 4	HGNC:23815	details
hsa-let-7f-5p	ZNF611	zinc finger protein 611	HGNC:28766	details
hsa-let-7f-5p				details
hsa-let-7f-5p	ECHDC1	ethylmalonyl-CoA decarboxylase 1	HGNC:21489	details
hsa-let-7f-5p	PMPCA	peptidase, mitochondrial processing subunit alpha	HGNC:18667	details
hsa-let-7f-5p	ACTA1	actin alpha 1, skeletal muscle	HGNC:129	details
hsa-let-7f-5p	SUOX	sulfite oxidase	HGNC:11460	details
hsa-let-7f-5p	MCF2L2	MCF.2 cell line derived transforming sequence-like 2	HGNC:30319	details
hsa-let-7f-5p	HASPIN	histone H3 associated protein kinase	HGNC:19682	details
hsa-let-7f-5p	AKAP8	A-kinase anchoring protein 8	HGNC:378	details
hsa-let-7f-5p	RAD18	RAD18 E3 ubiquitin protein ligase	HGNC:18278	details
hsa-let-7f-5p	ZNF460	zinc finger protein 460	HGNC:21628	details
hsa-let-7f-5p	USP38	ubiquitin specific peptidase 38	HGNC:20067	details
hsa-let-7f-5p	TXLNA	taxilin alpha	HGNC:30685	details
hsa-let-7f-5p	PLEKHA3	pleckstrin homology domain containing A3	HGNC:14338	details
hsa-let-7f-5p	PGRMC1	progesterone receptor membrane component 1	HGNC:16090	details
hsa-let-7f-5p	PEX11B	peroxisomal biogenesis factor 11 beta	HGNC:8853	details
hsa-let-7f-5p	PDZD8	PDZ domain containing 8	HGNC:26974	details
hsa-let-7f-5p	MXD1	MAX dimerization protein 1	HGNC:6761	details
hsa-let-7f-5p	MAPK6	mitogen-activated protein kinase 6	HGNC:6879	details
hsa-let-7f-5p	HAND1	heart and neural crest derivatives expressed 1	HGNC:4807	details
hsa-let-7f-5p	FAM222B	family with sequence similarity 222 member B	HGNC:25563	details
hsa-let-7f-5p	CDV3	CDV3 homolog	HGNC:26928	details
hsa-let-7f-5p	C19orf47	chromosome 19 open reading frame 47	HGNC:26723	details
hsa-let-7f-5p	ARIH1	ariadne RBR E3 ubiquitin protein ligase 1	HGNC:689	details
hsa-let-7f-5p	ADIPOR2	adiponectin receptor 2	HGNC:24041	details
hsa-let-7f-5p	PEG10	paternally expressed 10	HGNC:14005	details
hsa-let-7f-5p	EMILIN2	elastin microfibril interfacer 2	HGNC:19881	details
hsa-let-7f-5p	TRIM71	tripartite motif containing 71	HGNC:32669	details
hsa-let-7f-5p	SURF4	surfeit 4	HGNC:11476	details
hsa-let-7f-5p	PARP16	poly(ADP-ribose) polymerase family member 16	HGNC:26040	details
hsa-let-7f-5p	GNG5	G protein subunit gamma 5	HGNC:4408	details
hsa-let-7f-5p	E2F6	E2F transcription factor 6	HGNC:3120	details
hsa-let-7f-5p	C1orf21	chromosome 1 open reading frame 21	HGNC:15494	details
hsa-let-7f-5p	BACH1	BTB domain and CNC homolog 1	HGNC:935	details
hsa-let-7f-5p	ABHD17C	abhydrolase domain containing 17C, depalmitoylase	HGNC:26925	details
hsa-let-7f-5p	THYN1	thymocyte nuclear protein 1	HGNC:29560	details
hsa-let-7f-5p	CALU	calumenin	HGNC:1458	details
hsa-let-7f-5p	TGOLN2	trans-golgi network protein 2	HGNC:15450	details
hsa-let-7f-5p	ZBTB37	zinc finger and BTB domain containing 37	HGNC:28365	details
hsa-let-7f-5p	GOLGA4	golgin A4	HGNC:4427	details
hsa-let-7f-5p	FAM104A	family with sequence similarity 104 member A	HGNC:25918	details
hsa-let-7f-5p	POTEG	POTE ankyrin domain family member G	HGNC:33896	details
hsa-let-7f-5p	RWDD1	RWD domain containing 1	HGNC:20993	details
hsa-let-7f-5p	FMO4	flavin containing dimethylaniline monoxygenase 4	HGNC:3772	details
hsa-let-7f-5p	ZNF556	zinc finger protein 556	HGNC:25669	details
hsa-let-7f-5p	PRIM2	DNA primase subunit 2	HGNC:9370	details
hsa-let-7f-5p	ZNF584	zinc finger protein 584	HGNC:27318	details
hsa-let-7f-5p	ZNF578	zinc finger protein 578	HGNC:26449	details
hsa-let-7f-5p	ARL8B	ADP ribosylation factor like GTPase 8B	HGNC:25564	details
hsa-let-7f-5p	INTS7	integrator complex subunit 7	HGNC:24484	details
hsa-let-7f-5p	RFC2	replication factor C subunit 2	HGNC:9970	details
hsa-let-7f-5p	ZFAND4	zinc finger AN1-type containing 4	HGNC:23504	details
hsa-let-7f-5p	BRI3BP	BRI3 binding protein	HGNC:14251	details
hsa-let-7f-5p	STAT2	signal transducer and activator of transcription 2	HGNC:11363	details
hsa-let-7f-5p	ZNF738	zinc finger protein 738	HGNC:32469	details
hsa-let-7f-5p	DTX3L	deltex E3 ubiquitin ligase 3L	HGNC:30323	details
hsa-let-7f-5p	RAB19	RAB19, member RAS oncogene family	HGNC:19982	details
hsa-let-7f-5p	CDKAL1	CDK5 regulatory subunit associated protein 1 like 1	HGNC:21050	details
hsa-let-7f-5p	EIF4A3	eukaryotic translation initiation factor 4A3	HGNC:18683	details
hsa-let-7f-5p	DNAH9	dynein axonemal heavy chain 9	HGNC:2953	details
hsa-let-7f-5p	SLC19A3	solute carrier family 19 member 3	HGNC:16266	details
hsa-let-7f-5p	ITGA3	integrin subunit alpha 3	HGNC:6139	details
hsa-let-7f-5p	SLC38A7	solute carrier family 38 member 7	HGNC:25582	details
hsa-let-7f-5p	SAR1A	secretion associated Ras related GTPase 1A	HGNC:10534	details
hsa-let-7f-5p	PHACTR4	phosphatase and actin regulator 4	HGNC:25793	details
hsa-let-7f-5p	MTX3	metaxin 3	HGNC:24812	details
hsa-let-7f-5p	CPA4	carboxypeptidase A4	HGNC:15740	details
hsa-let-7f-5p	COX6B1	cytochrome c oxidase subunit 6B1	HGNC:2280	details
hsa-let-7f-5p	FPR1	formyl peptide receptor 1	HGNC:3826	details
hsa-let-7f-5p	ATXN2	ataxin 2	HGNC:10555	details
hsa-let-7f-5p	ZNF799	zinc finger protein 799	HGNC:28071	details
hsa-let-7f-5p	DNAJC28	DnaJ heat shock protein family (Hsp40) member C28	HGNC:1297	details
hsa-let-7f-5p	ZNF417	zinc finger protein 417	HGNC:20646	details
hsa-let-7f-5p	ZNF443	zinc finger protein 443	HGNC:20878	details
hsa-let-7f-5p	ADH5	alcohol dehydrogenase 5 (class III), chi polypeptide	HGNC:253	details
hsa-let-7f-5p	PRSS22	serine protease 22	HGNC:14368	details
hsa-let-7f-5p	POLR3D	RNA polymerase III subunit D	HGNC:1080	details
hsa-let-7f-5p	NHLRC2	NHL repeat containing 2	HGNC:24731	details
hsa-let-7f-5p	KIAA1328	KIAA1328	HGNC:29248	details
hsa-let-7f-5p	IPO9	importin 9	HGNC:19425	details
hsa-let-7f-5p	EDEM3	ER degradation enhancing alpha-mannosidase like protein 3	HGNC:16787	details
hsa-let-7f-5p	CTPS1	CTP synthase 1	HGNC:2519	details
hsa-let-7f-5p	CHTOP	chromatin target of PRMT1	HGNC:24511	details
hsa-let-7f-5p	AMD1	adenosylmethionine decarboxylase 1	HGNC:457	details
hsa-let-7f-5p	NAP1L1	nucleosome assembly protein 1 like 1	HGNC:7637	details
hsa-let-7f-5p	PAFAH2	platelet activating factor acetylhydrolase 2	HGNC:8579	details
hsa-let-7f-5p	HDAC2	histone deacetylase 2	HGNC:4853	details
hsa-let-7f-5p	AGO1	argonaute RISC component 1	HGNC:3262	details
hsa-let-7f-5p	IL6	interleukin 6	HGNC:6018	details
hsa-let-7f-5p	POSTN	periostin	HGNC:16953	details
hsa-let-7f-5p	CASTOR2	cytosolic arginine sensor for mTORC1 subunit 2	HGNC:37073	details
hsa-let-7f-5p	CRX	cone-rod homeobox	HGNC:2383	details
hsa-let-7f-5p	CXCL8	C-X-C motif chemokine ligand 8	HGNC:6025	details
hsa-let-7f-5p	DYRK3	dual specificity tyrosine phosphorylation regulated kinase 3	HGNC:3094	details
hsa-let-7f-5p	ERO1A	endoplasmic reticulum oxidoreductase 1 alpha	HGNC:13280	details
hsa-let-7f-5p	FNDC9	fibronectin type III domain containing 9	HGNC:33547	details
hsa-let-7f-5p	GATM	glycine amidinotransferase	HGNC:4175	details
hsa-let-7f-5p	GPAT4	glycerol-3-phosphate acyltransferase 4	HGNC:20880	details
hsa-let-7f-5p	KIAA1143	KIAA1143	HGNC:29198	details
hsa-let-7f-5p	MARCKSL1	MARCKS like 1	HGNC:7142	details
hsa-let-7f-5p	MARS2	methionyl-tRNA synthetase 2, mitochondrial	HGNC:25133	details
hsa-let-7f-5p	MIDN	midnolin	HGNC:16298	details
hsa-let-7f-5p	PBX2	PBX homeobox 2	HGNC:8633	details
hsa-let-7f-5p	PDLIM5	PDZ and LIM domain 5	HGNC:17468	details
hsa-let-7f-5p	PLD3	phospholipase D family member 3	HGNC:17158	details
hsa-let-7f-5p	POLL	DNA polymerase lambda	HGNC:9184	details
hsa-let-7f-5p	POTEM	POTE ankyrin domain family member M	HGNC:37096	details
hsa-let-7f-5p	RHBDF2	rhomboid 5 homolog 2	HGNC:20788	details
hsa-let-7f-5p	SOCS7	suppressor of cytokine signaling 7	HGNC:29846	details
hsa-let-7f-5p	SYT1	synaptotagmin 1	HGNC:11509	details
hsa-let-7f-5p	TIAF1	TGFB1-induced anti-apoptotic factor 1	HGNC:11803	details
hsa-let-7f-5p	TOMM40L	translocase of outer mitochondrial membrane 40 like	HGNC:25756	details
hsa-let-7f-5p	TRAPPC10	trafficking protein particle complex subunit 10	HGNC:11868	details
hsa-let-7f-5p	TUBB4A	tubulin beta 4A class IVa	HGNC:20774	details
hsa-let-7f-5p	ZNF609	zinc finger protein 609	HGNC:29003	details
hsa-let-7f-5p	AQP6	aquaporin 6	HGNC:639	details
hsa-let-7f-5p	IL6R	interleukin 6 receptor	HGNC:6019	details
hsa-let-7f-5p	MAGEA12	MAGE family member A12	HGNC:6799	details
hsa-let-7f-5p	MAGEA3	MAGE family member A3	HGNC:6801	details
hsa-let-7f-5p	MAGEA6	MAGE family member A6	HGNC:6804	details
hsa-let-7f-5p	PRR5-ARHGAP8	PRR5-ARHGAP8 readthrough	HGNC:34512	details
hsa-let-7f-5p	STX3	syntaxin 3	HGNC:11438	details
hsa-let-7f-5p	TMED4	transmembrane p24 trafficking protein 4	HGNC:22301	details
hsa-let-7f-5p	USP47	ubiquitin specific peptidase 47	HGNC:20076	details

miRNA Card

Confidence 3 (3 of 3 tools predicted)

Confidence 2 (2 of 3 tools predicted)

Confidence 1 (1 of 3 tools predicted)