miRNA Card

miRNA General Information
miRNA ID hsa-miR-1-3p
Description Homo sapiens miR-1-2 stem-loop
Comment Lagos-Quintana et al. [1] reported the cloning of miR-1b, miR-1c and miR-1d. The mature processed miR sequences are identical apart from the 3' residues (A in mir-1b, C in mir-1c and UU in mir-1d). The 3' residues of both miR-1b and miR-1c conflict with the predicted stem-loop precursor sequence shown here and these sequences are not found in current assemblies of human and mouse genomes. It is suggested that polyA polymerase may add 1-3 nts to the 3' end of the mature transcript (Tom Tuschl, pers. comm.). The common 21 nts of the 3 reported miR sequences have been rationalised here and named miR-1. There are 2 pairs of orthologous putative hairpin precursor structures named mir-1-1 (human MIR:MI0000651, mouse MIR:MI0000139), and mir-1-2 (human MIR:MI0000437, mouse MIR:MI0000652). The mature sequence shown here represents the most commonly cloned form from large-scale cloning studies [2].
Experiment cloned [2], Illumina [3]
Sequence UGGAAUGUAAAGAAGUAUGUAU
miRNA Expression in different cancers

    by mir_boxplot.py

circRNA-miRNA-gene regulatory network

Note about Netwrok:
This is a network diagram with miRNA (purple circle) as the center.
We used three tools(PITA, miRanda, targetScan) to predict the binding sites of circrna (green circle) and miRNA. Accordingly, for this miRNA that binds to circrna, we have three confidence levels, namely confident 1, confident 2 and confident 3. Confidence value indicates how many tools can deduce these results. For each confidence, we use different kinds of dashed lines.

Target circRNA with confidence

Confidence 3 (3 of 3 tools predicted)

CircID miRNA PITA miRanda targetScan

Confidence 1 (1 of 3 tools predicted)

CircID miRNA PITA miRanda targetScan
chr5:139626756|139626859 hsa-miR-1-3p 1 0 0
chr22:29299617|29299721 hsa-miR-1-3p 0 1 0
chr12:57823626|57823966 hsa-miR-1-3p 0 1 0
chr5:83540686|83540803 hsa-miR-1-3p 0 1 0
chr22:29299647|29299742 hsa-miR-1-3p 0 1 0
chr6:125058017|125058106 hsa-miR-1-3p 0 1 0
chr12:69578358|69578472 hsa-miR-1-3p 0 1 0
chr22:29299617|29299742 hsa-miR-1-3p 0 1 0
chr16:68226970|68227153 hsa-miR-1-3p 0 1 0
chr22:29299641|29299697 hsa-miR-1-3p 0 1 0
chr19:48495855|48495998 hsa-miR-1-3p 0 1 0
chr4:2065852|2066027 hsa-miR-1-3p 0 1 0
chr20:54207975|54208092 hsa-miR-1-3p 0 1 0
chr17:17383466|17383622 hsa-miR-1-3p 0 1 0
chr20:32309844|32310036 hsa-miR-1-3p 0 1 0
chr6:63713478|63713659 hsa-miR-1-3p 0 1 0
chr12:57823626|57823955 hsa-miR-1-3p 0 1 0
chr2:189010324|189010828 hsa-miR-1-3p 0 1 0
chr12:48936299|48936427 hsa-miR-1-3p 0 1 0
chr4:87176757|87178505 hsa-miR-1-3p 1 0 0
chr1:31460967|31461038 hsa-miR-1-3p 1 0 0
chr1:113980518|113980617 hsa-miR-1-3p 1 0 0
chr1:43450860|43450933 hsa-miR-1-3p 0 1 0
chr2:189010679|189010828 hsa-miR-1-3p 0 1 0
chr16:15866643|15866786 hsa-miR-1-3p 0 1 0
chr3:19978339|19978403 hsa-miR-1-3p 0 1 0
chr20:35503416|35503668 hsa-miR-1-3p 0 1 0
chr19:40365604|40365729 hsa-miR-1-3p 0 1 0
chr16:87698302|87698462 hsa-miR-1-3p 0 1 0
chr2:241444797|241444908 hsa-miR-1-3p 0 1 0
chr20:17599296|17599359 hsa-miR-1-3p 0 1 0
chr22:29299641|29299709 hsa-miR-1-3p 0 1 0
chr22:29299599|29299751 hsa-miR-1-3p 0 1 0
chr21:36035301|36035497 hsa-miR-1-3p 0 1 0
chr3:9911275|9911597 hsa-miR-1-3p 0 1 0
chr20:35503581|35503668 hsa-miR-1-3p 0 1 0
chr3:149738844|149739010 hsa-miR-1-3p 0 1 0
chr22:29299615|29299742 hsa-miR-1-3p 0 1 0
chr22:29299599|29299697 hsa-miR-1-3p 0 1 0
chr16:71789279|71789430 hsa-miR-1-3p 0 1 0
chr17:41867684|41867800 hsa-miR-1-3p 0 1 0
chr9:111370469~111370765 hsa-miR-1-3p 0 1 0
chr5:56888234~56888357 hsa-miR-1-3p 0 1 0
chr18:31477866~31477991 hsa-miR-1-3p 0 1 0
chr22:29299647~29299721 hsa-miR-1-3p 0 1 0
chr22:29299599~29299718 hsa-miR-1-3p 0 1 0
chr1:111724395~111724528 hsa-miR-1-3p 0 1 0
chr17:41867684~41867806 hsa-miR-1-3p 0 1 0
chr11:62602297~62602398 hsa-miR-1-3p 0 1 0
chr5:83540686~83540803 hsa-miR-1-3p 0 1 0
chr6:131892361~131892548 hsa-miR-1-3p 0 1 0
chr20:35279051~35279601 hsa-miR-1-3p 0 1 0
chr12:48936299~48936427 hsa-miR-1-3p 0 1 0
chr1:51787442~51787804 hsa-miR-1-3p 0 1 0
chr13:111305403~111305554 hsa-miR-1-3p 0 1 0
chr20:35279088~35279200 hsa-miR-1-3p 0 1 0
chr22:29299617~29299697 hsa-miR-1-3p 0 1 0
chr18:63986963|63987089 hsa-miR-1-3p 0 1 0
chr1:27104755|27104881 hsa-miR-1-3p 0 1 0
chr15:84773557|84773677 hsa-miR-1-3p 0 1 0
chr4:83060595|83060743 hsa-miR-1-3p 0 1 0
chr4:87176851|87178593 hsa-miR-1-3p 1 0 0
chr17:80393647|80393834 hsa-miR-1-3p 0 1 0
chr1:154443342|154443506 hsa-miR-1-3p 0 1 0
chr7:98177267|98177427 hsa-miR-1-3p 0 1 0
chr14:21348172|21348302 hsa-miR-1-3p 0 1 0
chr1:9671538|9671771 hsa-miR-1-3p 0 1 0
chr19:15159658|15160020 hsa-miR-1-3p 1 0 0
chr1:113980501|113980617 hsa-miR-1-3p 1 0 0
chr3:122409416|122409520 hsa-miR-1-3p 1 0 0
chr19:15159658|15160025 hsa-miR-1-3p 1 0 0
chr16:1984944|1985149 hsa-miR-1-3p 0 1 0
chr22:29299599|29299742 hsa-miR-1-3p 0 1 0
chr10:110123050|110123286 hsa-miR-1-3p 0 1 0
chr17:41867684|41867872 hsa-miR-1-3p 0 1 0
chr22:29299599|29299718 hsa-miR-1-3p 0 1 0
chr1:183244661|183244838 hsa-miR-1-3p 0 1 0
chr4:184659340|184678394 hsa-miR-1-3p 0 1 0
chr10:95687295|95687676 hsa-miR-1-3p 0 1 0
chr4:25678372|25678512 hsa-miR-1-3p 0 1 0
chrX:12976786|12977000 hsa-miR-1-3p 0 1 0
chr22:29299641|29299766 hsa-miR-1-3p 0 1 0
chr21:34788842|34789085 hsa-miR-1-3p 0 1 0
chr10:73916981|73917139 hsa-miR-1-3p 0 1 0
chr4:25678372|25678472 hsa-miR-1-3p 0 1 0
chr19:21033456|21034184 hsa-miR-1-3p 0 1 0
chr7:16120857|16120921 hsa-miR-1-3p 0 1 0
chr13:110178971|110179354 hsa-miR-1-3p 0 1 0
chr17:35260971|35261096 hsa-miR-1-3p 0 1 0
chr8:143986194|143986435 hsa-miR-1-3p 0 1 0
chr21:44903379|44903494 hsa-miR-1-3p 0 1 0
chr17:41689892|41690176 hsa-miR-1-3p 0 1 0
chr2:134453397|134453575 hsa-miR-1-3p 0 1 0
chr2:189010780|189010882 hsa-miR-1-3p 0 1 0
chr12:123623432|123623586 hsa-miR-1-3p 0 1 0
chr22:29299641|29299742 hsa-miR-1-3p 0 1 0
chr3:9911443|9911597 hsa-miR-1-3p 0 1 0
chr19:15397590|15397766 hsa-miR-1-3p 0 1 0
chr1:159918540|159918767 hsa-miR-1-3p 0 1 0
chr1:51787458|51787804 hsa-miR-1-3p 0 1 0
chr17:41867684|41867806 hsa-miR-1-3p 0 1 0
chr1:11947976|11949813 hsa-miR-1-3p 0 1 0
chr1:159918532|159918767 hsa-miR-1-3p 0 1 0
chr11:44107776|44107980 hsa-miR-1-3p -11 1 0
chr10:73917002|73917139 hsa-miR-1-3p -10 1 0
chr2:158680779|158680918 hsa-miR-1-3p 1 0 0
chr2:158680731|158680834 hsa-miR-1-3p 1 0 0
chr2:219438857|219439028 hsa-miR-1-3p 0 1 0
chrX:40718369|40718552 hsa-miR-1-3p 0 1 0
chr20:35279082|35279200 hsa-miR-1-3p 0 1 0
chr10:35569555|35569704 hsa-miR-1-3p 0 1 0
chr22:29299617|29299709 hsa-miR-1-3p 0 1 0
chr11:62602297|62602398 hsa-miR-1-3p 0 1 0
chr13:48046945|48047094 hsa-miR-1-3p 0 1 0
chr11:62602297|62602457 hsa-miR-1-3p 0 1 0
chr20:58286323|58286432 hsa-miR-1-3p 0 1 0
chr20:35503507|35503664 hsa-miR-1-3p 0 1 0
chr19:39927879|39928059 hsa-miR-1-3p 0 1 0
chr3:12302660|12302795 hsa-miR-1-3p 0 1 0
chr10:73916981|73917129 hsa-miR-1-3p 0 1 0
chr22:29299617|29299751 hsa-miR-1-3p 0 1 0
chr22:29299641|29299751 hsa-miR-1-3p 0 1 0
chr11:44107776|44107978 hsa-miR-1-3p 0 1 0
chr13:43061031|43061146 hsa-miR-1-3p 0 1 0
chr1:228184048|228184205 hsa-miR-1-3p 0 1 0
chr20:35279051|35279601 hsa-miR-1-3p 0 1 0
chr13:43061025|43061146 hsa-miR-1-3p 0 1 0
chr13:77007287|77007381 hsa-miR-1-3p 0 1 0
chr13:43061034|43061146 hsa-miR-1-3p 0 1 0
chr16:72059114|72060206 hsa-miR-1-3p 0 1 0
chr19:15159921|15160142 hsa-miR-1-3p 1 0 0
Target genes
miRNA Gene Gene Description HGNC ID details
hsa-miR-1-3p OAT ornithine aminotransferase HGNC:8091 details
hsa-miR-1-3p OSBPL7 oxysterol binding protein like 7 HGNC:16387 details
hsa-miR-1-3p ARHGAP29 Rho GTPase activating protein 29 HGNC:30207 details
hsa-miR-1-3p PDCD4 programmed cell death 4 HGNC:8763 details
hsa-miR-1-3p CDK14 cyclin dependent kinase 14 HGNC:8883 details
hsa-miR-1-3p PGM2 phosphoglucomutase 2 HGNC:8906 details
hsa-miR-1-3p MTMR12 myotubularin related protein 12 HGNC:18191 details
hsa-miR-1-3p MTX1 metaxin 1 HGNC:7504 details
hsa-miR-1-3p MXD4 MAX dimerization protein 4 HGNC:13906 details
hsa-miR-1-3p NETO2 neuropilin and tolloid like 2 HGNC:14644 details
hsa-miR-1-3p PNP purine nucleoside phosphorylase HGNC:7892 details
hsa-miR-1-3p CCSAP centriole, cilia and spindle associated protein HGNC:29578 details
hsa-miR-1-3p XPNPEP3 X-prolyl aminopeptidase 3 HGNC:28052 details
hsa-miR-1-3p LRRC8A leucine rich repeat containing 8 VRAC subunit A HGNC:19027 details
hsa-miR-1-3p LZTFL1 leucine zipper transcription factor like 1 HGNC:6741 details
hsa-miR-1-3p MMD monocyte to macrophage differentiation associated HGNC:7153 details
hsa-miR-1-3p DHX15 DEAH-box helicase 15 HGNC:2738 details
hsa-miR-1-3p DDX5 DEAD-box helicase 5 HGNC:2746 details
hsa-miR-1-3p details
hsa-miR-1-3p TNS4 tensin 4 HGNC:24352 details
hsa-miR-1-3p CLCN3 chloride voltage-gated channel 3 HGNC:2021 details
hsa-miR-1-3p CHSY1 chondroitin sulfate synthase 1 HGNC:17198 details
hsa-miR-1-3p CHST11 carbohydrate sulfotransferase 11 HGNC:17422 details
hsa-miR-1-3p SLC44A1 solute carrier family 44 member 1 HGNC:18798 details
hsa-miR-1-3p IFT52 intraflagellar transport 52 HGNC:15901 details
hsa-miR-1-3p CAP1 cyclase associated actin cytoskeleton regulatory protein 1 HGNC:20040 details
hsa-miR-1-3p SRXN1 sulfiredoxin 1 HGNC:16132 details
hsa-miR-1-3p AXL AXL receptor tyrosine kinase HGNC:905 details
hsa-miR-1-3p BLCAP BLCAP apoptosis inducing factor HGNC:1055 details
hsa-miR-1-3p ARHGEF18 Rho/Rac guanine nucleotide exchange factor 18 HGNC:17090 details
hsa-miR-1-3p ARF4 ADP ribosylation factor 4 HGNC:655 details
hsa-miR-1-3p ARF3 ADP ribosylation factor 3 HGNC:654 details
hsa-miR-1-3p ARCN1 archain 1 HGNC:649 details
hsa-miR-1-3p ANKRD29 ankyrin repeat domain 29 HGNC:27110 details
hsa-miR-1-3p ADAR adenosine deaminase RNA specific HGNC:225 details
hsa-miR-1-3p details
hsa-miR-1-3p EML4 EMAP like 4 HGNC:1316 details
hsa-miR-1-3p FBLN2 fibulin 2 HGNC:3601 details
hsa-miR-1-3p RBM47 RNA binding motif protein 47 HGNC:30358 details
hsa-miR-1-3p C1orf56 chromosome 1 open reading frame 56 HGNC:26045 details
hsa-miR-1-3p details
hsa-miR-1-3p GCH1 GTP cyclohydrolase 1 HGNC:4193 details
hsa-miR-1-3p GNPDA2 glucosamine-6-phosphate deaminase 2 HGNC:21526 details
hsa-miR-1-3p details
hsa-miR-1-3p HPS4 HPS4 biogenesis of lysosomal organelles complex 3 subunit 2 HGNC:15844 details
hsa-miR-1-3p IP6K2 inositol hexakisphosphate kinase 2 HGNC:17313 details
hsa-miR-1-3p INPP5F inositol polyphosphate-5-phosphatase F HGNC:17054 details
hsa-miR-1-3p CNOT6 CCR4-NOT transcription complex subunit 6 HGNC:14099 details
hsa-miR-1-3p KLHL42 kelch like family member 42 HGNC:29252 details
hsa-miR-1-3p details
hsa-miR-1-3p KIF2A kinesin family member 2A HGNC:6318 details
hsa-miR-1-3p LASP1 LIM and SH3 protein 1 HGNC:6513 details
hsa-miR-1-3p CERS2 ceramide synthase 2 HGNC:14076 details
hsa-miR-1-3p LIN7C lin-7 homolog C, crumbs cell polarity complex component HGNC:17789 details
hsa-miR-1-3p BDNF brain derived neurotrophic factor HGNC:1033 details
hsa-miR-1-3p G6PD glucose-6-phosphate dehydrogenase HGNC:4057 details
hsa-miR-1-3p HSPD1 heat shock protein family D (Hsp60) member 1 HGNC:5261 details
hsa-miR-1-3p HSPA4 heat shock protein family A (Hsp70) member 4 HGNC:5237 details
hsa-miR-1-3p GJA1 gap junction protein alpha 1 HGNC:4274 details
hsa-miR-1-3p KCNJ2 potassium inwardly rectifying channel subfamily J member 2 HGNC:6263 details
hsa-miR-1-3p MET MET proto-oncogene, receptor tyrosine kinase HGNC:7029 details
hsa-miR-1-3p HCN2 hyperpolarization activated cyclic nucleotide gated potassium and sodium channel 2 HGNC:4846 details
hsa-miR-1-3p PIM1 Pim-1 proto-oncogene, serine/threonine kinase HGNC:8986 details
hsa-miR-1-3p FOXP1 forkhead box P1 HGNC:3823 details
hsa-miR-1-3p HDAC4 histone deacetylase 4 HGNC:14063 details
hsa-miR-1-3p HCN4 hyperpolarization activated cyclic nucleotide gated potassium channel 4 HGNC:16882 details
hsa-miR-1-3p CEBPA CCAAT enhancer binding protein alpha HGNC:1833 details
hsa-miR-1-3p MEF2A myocyte enhancer factor 2A HGNC:6993 details
hsa-miR-1-3p details
hsa-miR-1-3p GATA4 GATA binding protein 4 HGNC:4173 details
hsa-miR-1-3p MYOD1 myogenic differentiation 1 HGNC:7611 details
hsa-miR-1-3p BCL2 BCL2 apoptosis regulator HGNC:990 details
hsa-miR-1-3p DLL1 delta like canonical Notch ligand 1 HGNC:2908 details
hsa-miR-1-3p CNN3 calponin 3 HGNC:2157 details
hsa-miR-1-3p LARP4 La ribonucleoprotein 4 HGNC:24320 details
hsa-miR-1-3p TAGLN2 transgelin 2 HGNC:11554 details
hsa-miR-1-3p ATP6V1B2 ATPase H+ transporting V1 subunit B2 HGNC:854 details
hsa-miR-1-3p PPP2R5A protein phosphatase 2 regulatory subunit B'alpha HGNC:9309 details
hsa-miR-1-3p SOX6 SRY-box transcription factor 6 HGNC:16421 details
hsa-miR-1-3p PAX3 paired box 3 HGNC:8617 details
hsa-miR-1-3p KCNE1 potassium voltage-gated channel subfamily E regulatory subunit 1 HGNC:6240 details
hsa-miR-1-3p XPO6 exportin 6 HGNC:19733 details
hsa-miR-1-3p UST uronyl 2-sulfotransferase HGNC:17223 details
hsa-miR-1-3p TRIM2 tripartite motif containing 2 HGNC:15974 details
hsa-miR-1-3p TRAPPC3 trafficking protein particle complex subunit 3 HGNC:19942 details
hsa-miR-1-3p TPM4 tropomyosin 4 HGNC:12013 details
hsa-miR-1-3p CAND1 cullin associated and neddylation dissociated 1 HGNC:30688 details
hsa-miR-1-3p TSPAN4 tetraspanin 4 HGNC:11859 details
hsa-miR-1-3p TIMP3 TIMP metallopeptidase inhibitor 3 HGNC:11822 details
hsa-miR-1-3p NELFCD negative elongation factor complex member C/D HGNC:15934 details
hsa-miR-1-3p TDP1 tyrosyl-DNA phosphodiesterase 1 HGNC:18884 details
hsa-miR-1-3p SLC16A9 solute carrier family 16 member 9 HGNC:23520 details
hsa-miR-1-3p SRSF9 serine and arginine rich splicing factor 9 HGNC:10791 details
hsa-miR-1-3p SERPINB5 serpin family B member 5 HGNC:8949 details
hsa-miR-1-3p SERP1 stress associated endoplasmic reticulum protein 1 HGNC:10759 details
hsa-miR-1-3p SDC4 syndecan 4 HGNC:10661 details
hsa-miR-1-3p RNF138 ring finger protein 138 HGNC:17765 details
hsa-miR-1-3p RABL2B RAB, member of RAS oncogene family like 2B HGNC:9800 details
hsa-miR-1-3p RABL2A RAB, member of RAS oncogene family like 2A HGNC:9799 details
hsa-miR-1-3p RABGAP1L RAB GTPase activating protein 1 like HGNC:24663 details
hsa-miR-1-3p RAB11FIP2 RAB11 family interacting protein 2 HGNC:29152 details
hsa-miR-1-3p TWF1 twinfilin actin binding protein 1 HGNC:9620 details
hsa-miR-1-3p PREX1 phosphatidylinositol-3,4,5-trisphosphate dependent Rac exchange factor 1 HGNC:32594 details
hsa-miR-1-3p POM121 POM121 transmembrane nucleoporin HGNC:19702 details
hsa-miR-1-3p POLR2K RNA polymerase II, I and III subunit K HGNC:9198 details
hsa-miR-1-3p POGK pogo transposable element derived with KRAB domain HGNC:18800 details
hsa-miR-1-3p PLEKHB2 pleckstrin homology domain containing B2 HGNC:19236 details
hsa-miR-1-3p PTMA prothymosin alpha HGNC:9623 details
hsa-miR-1-3p ZNF384 zinc finger protein 384 HGNC:11955 details
hsa-miR-1-3p EGFR epidermal growth factor receptor HGNC:3236 details
hsa-miR-1-3p GPD2 glycerol-3-phosphate dehydrogenase 2 HGNC:4456 details
hsa-miR-1-3p SNAPIN SNAP associated protein HGNC:17145 details
hsa-miR-1-3p PRSS21 serine protease 21 HGNC:9485 details
hsa-miR-1-3p SAC3D1 SAC3 domain containing 1 HGNC:30179 details
hsa-miR-1-3p CPOX coproporphyrinogen oxidase HGNC:2321 details
hsa-miR-1-3p TPM3 tropomyosin 3 HGNC:12012 details
hsa-miR-1-3p SLC25A1 solute carrier family 25 member 1 HGNC:10979 details
hsa-miR-1-3p ANXA2 annexin A2 HGNC:537 details
hsa-miR-1-3p ASH2L ASH2 like, histone lysine methyltransferase complex subunit HGNC:744 details
hsa-miR-1-3p NSUN4 NOP2/Sun RNA methyltransferase 4 HGNC:31802 details
hsa-miR-1-3p SYNE1 spectrin repeat containing nuclear envelope protein 1 HGNC:17089 details
hsa-miR-1-3p NRP1 neuropilin 1 HGNC:8004 details
hsa-miR-1-3p CDCP1 CUB domain containing protein 1 HGNC:24357 details
hsa-miR-1-3p GAK cyclin G associated kinase HGNC:4113 details
hsa-miR-1-3p NOTCH2 notch receptor 2 HGNC:7882 details
hsa-miR-1-3p BRI3BP BRI3 binding protein HGNC:14251 details
hsa-miR-1-3p IRF2BPL interferon regulatory factor 2 binding protein like HGNC:14282 details
hsa-miR-1-3p SFXN1 sideroflexin 1 HGNC:16085 details
hsa-miR-1-3p ATP6V0A1 ATPase H+ transporting V0 subunit a1 HGNC:865 details
hsa-miR-1-3p SEC23IP SEC23 interacting protein HGNC:17018 details
hsa-miR-1-3p PICALM phosphatidylinositol binding clathrin assembly protein HGNC:15514 details
hsa-miR-1-3p THBS1 thrombospondin 1 HGNC:11785 details
hsa-miR-1-3p WDR11 WD repeat domain 11 HGNC:13831 details
hsa-miR-1-3p ITGB4 integrin subunit beta 4 HGNC:6158 details
hsa-miR-1-3p SNX6 sorting nexin 6 HGNC:14970 details
hsa-miR-1-3p PWP1 PWP1 homolog, endonuclein HGNC:17015 details
hsa-miR-1-3p MOV10 Mov10 RISC complex RNA helicase HGNC:7200 details
hsa-miR-1-3p TPM2 tropomyosin 2 HGNC:12011 details
hsa-miR-1-3p MON2 MON2 homolog, regulator of endosome-to-Golgi trafficking HGNC:29177 details
hsa-miR-1-3p PTBP2 polypyrimidine tract binding protein 2 HGNC:17662 details
hsa-miR-1-3p AGMAT agmatinase HGNC:18407 details
hsa-miR-1-3p ANP32B acidic nuclear phosphoprotein 32 family member B HGNC:16677 details
hsa-miR-1-3p ADPGK ADP dependent glucokinase HGNC:25250 details
hsa-miR-1-3p TMX1 thioredoxin related transmembrane protein 1 HGNC:15487 details
hsa-miR-1-3p RNF213 ring finger protein 213 HGNC:14539 details
hsa-miR-1-3p UHRF1 ubiquitin like with PHD and ring finger domains 1 HGNC:12556 details
hsa-miR-1-3p details
hsa-miR-1-3p SLC25A22 solute carrier family 25 member 22 HGNC:19954 details
hsa-miR-1-3p PTBP1 polypyrimidine tract binding protein 1 HGNC:9583 details
hsa-miR-1-3p TPM1 tropomyosin 1 HGNC:12010 details
hsa-miR-1-3p EHMT2 euchromatic histone lysine methyltransferase 2 HGNC:14129 details
hsa-miR-1-3p COIL coilin HGNC:2184 details
hsa-miR-1-3p CORO1C coronin 1C HGNC:2254 details
hsa-miR-1-3p AP3D1 adaptor related protein complex 3 subunit delta 1 HGNC:568 details
hsa-miR-1-3p RFT1 RFT1 homolog HGNC:30220 details
hsa-miR-1-3p FERMT2 FERM domain containing kindlin 2 HGNC:15767 details
hsa-miR-1-3p IQGAP3 IQ motif containing GTPase activating protein 3 HGNC:20669 details
hsa-miR-1-3p ANPEP alanyl aminopeptidase, membrane HGNC:500 details
hsa-miR-1-3p MTHFD2 methylenetetrahydrofolate dehydrogenase (NADP+ dependent) 2, methenyltetrahydrofolate cyclohydrolase HGNC:7434 details
hsa-miR-1-3p PPIB peptidylprolyl isomerase B HGNC:9255 details
hsa-miR-1-3p SH3BGRL3 SH3 domain binding glutamate rich protein like 3 HGNC:15568 details
hsa-miR-1-3p GOLGA7 golgin A7 HGNC:24876 details
hsa-miR-1-3p WDFY1 WD repeat and FYVE domain containing 1 HGNC:20451 details
hsa-miR-1-3p PDLIM7 PDZ and LIM domain 7 HGNC:22958 details
hsa-miR-1-3p PTPRF protein tyrosine phosphatase receptor type F HGNC:9670 details
hsa-miR-1-3p ARID1A AT-rich interaction domain 1A HGNC:11110 details
hsa-miR-1-3p ARID2 AT-rich interaction domain 2 HGNC:18037 details
hsa-miR-1-3p EHMT1 euchromatic histone lysine methyltransferase 1 HGNC:24650 details
hsa-miR-1-3p HNRNPU heterogeneous nuclear ribonucleoprotein U HGNC:5048 details
hsa-miR-1-3p ARMC10 armadillo repeat containing 10 HGNC:21706 details
hsa-miR-1-3p AGRN agrin HGNC:329 details
hsa-miR-1-3p MRC2 mannose receptor C type 2 HGNC:16875 details
hsa-miR-1-3p GNPNAT1 glucosamine-phosphate N-acetyltransferase 1 HGNC:19980 details
hsa-miR-1-3p BCKDHB branched chain keto acid dehydrogenase E1 subunit beta HGNC:987 details
hsa-miR-1-3p details
hsa-miR-1-3p AP3B1 adaptor related protein complex 3 subunit beta 1 HGNC:566 details
hsa-miR-1-3p CTSC cathepsin C HGNC:2528 details
hsa-miR-1-3p SSNA1 SS nuclear autoantigen 1 HGNC:11321 details
hsa-miR-1-3p ABHD11 abhydrolase domain containing 11 HGNC:16407 details
hsa-miR-1-3p YWHAQ tyrosine 3-monooxygenase/tryptophan 5-monooxygenase activation protein theta HGNC:12854 details
hsa-miR-1-3p LRP1 LDL receptor related protein 1 HGNC:6692 details
hsa-miR-1-3p PSMG1 proteasome assembly chaperone 1 HGNC:3043 details
hsa-miR-1-3p CSRP1 cysteine and glycine rich protein 1 HGNC:2469 details
hsa-miR-1-3p RRBP1 ribosome binding protein 1 HGNC:10448 details
hsa-miR-1-3p POLA2 DNA polymerase alpha 2, accessory subunit HGNC:30073 details
hsa-miR-1-3p UNC93B1 unc-93 homolog B1, TLR signaling regulator HGNC:13481 details
hsa-miR-1-3p DNAJB1 DnaJ heat shock protein family (Hsp40) member B1 HGNC:5270 details
hsa-miR-1-3p TWF2 twinfilin actin binding protein 2 HGNC:9621 details
hsa-miR-1-3p CALM2 calmodulin 2 HGNC:1445 details
hsa-miR-1-3p GATA6 GATA binding protein 6 HGNC:4174 details
hsa-miR-1-3p HAND2 heart and neural crest derivatives expressed 2 HGNC:4808 details
hsa-miR-1-3p FN1 fibronectin 1 HGNC:3778 details
hsa-miR-1-3p NOTCH3 notch receptor 3 HGNC:7883 details
hsa-miR-1-3p SLC8A1 solute carrier family 8 member A1 HGNC:11068 details
hsa-miR-1-3p EDN1 endothelin 1 HGNC:3176 details
hsa-miR-1-3p PRKCE protein kinase C epsilon HGNC:9401 details
hsa-miR-1-3p FABP3 fatty acid binding protein 3 HGNC:3557 details
hsa-miR-1-3p SNAI2 snail family transcriptional repressor 2 HGNC:11094 details
hsa-miR-1-3p SOX9 SRY-box transcription factor 9 HGNC:11204 details
hsa-miR-1-3p CDC42BPB CDC42 binding protein kinase beta HGNC:1738 details
hsa-miR-1-3p SRRM1 serine and arginine repetitive matrix 1 HGNC:16638 details
hsa-miR-1-3p CD44 CD44 molecule (Indian blood group) HGNC:1681 details
hsa-miR-1-3p SPRY2 sprouty RTK signaling antagonist 2 HGNC:11270 details
hsa-miR-1-3p MECR mitochondrial trans-2-enoyl-CoA reductase HGNC:19691 details
hsa-miR-1-3p CUL4B cullin 4B HGNC:2555 details
hsa-miR-1-3p PTMAP7 prothymosin alpha pseudogene 7 HGNC:20031 details
hsa-miR-1-3p RAB34 RAB34, member RAS oncogene family HGNC:16519 details
hsa-miR-1-3p SOX5 SRY-box transcription factor 5 HGNC:11201 details
hsa-miR-1-3p YTHDC1 YTH domain containing 1 HGNC:30626 details
hsa-miR-1-3p DGKH diacylglycerol kinase eta HGNC:2854 details
hsa-miR-1-3p FGFR2 fibroblast growth factor receptor 2 HGNC:3689 details
hsa-miR-1-3p OCIAD2 OCIA domain containing 2 HGNC:28685 details
hsa-miR-1-3p SYMPK symplekin HGNC:22935 details
hsa-miR-1-3p LIPC lipase C, hepatic type HGNC:6619 details
hsa-miR-1-3p CBR4 carbonyl reductase 4 HGNC:25891 details
hsa-miR-1-3p B3GNT2 UDP-GlcNAc:betaGal beta-1,3-N-acetylglucosaminyltransferase 2 HGNC:15629 details
hsa-miR-1-3p AP2S1 adaptor related protein complex 2 subunit sigma 1 HGNC:565 details
hsa-miR-1-3p IL6 interleukin 6 HGNC:6018 details
hsa-miR-1-3p RCC2 regulator of chromosome condensation 2 HGNC:30297 details
hsa-miR-1-3p WLS Wnt ligand secretion mediator HGNC:30238 details
hsa-miR-1-3p CRELD2 cysteine rich with EGF like domains 2 HGNC:28150 details
hsa-miR-1-3p GNG5 G protein subunit gamma 5 HGNC:4408 details
hsa-miR-1-3p AGTRAP angiotensin II receptor associated protein HGNC:13539 details
hsa-miR-1-3p details
hsa-miR-1-3p UGT8 UDP glycosyltransferase 8 HGNC:12555 details
hsa-miR-1-3p ABCB5 ATP binding cassette subfamily B member 5 HGNC:46 details
hsa-miR-1-3p PARD6B par-6 family cell polarity regulator beta HGNC:16245 details
hsa-miR-1-3p ALG3 ALG3 alpha-1,3- mannosyltransferase HGNC:23056 details
hsa-miR-1-3p details
hsa-miR-1-3p ACTA1 actin alpha 1, skeletal muscle HGNC:129 details
hsa-miR-1-3p SAMD15 sterile alpha motif domain containing 15 HGNC:18631 details
hsa-miR-1-3p DRAP1 DR1 associated protein 1 HGNC:3019 details
hsa-miR-1-3p MDC1 mediator of DNA damage checkpoint 1 HGNC:21163 details
hsa-miR-1-3p CD63 CD63 molecule HGNC:1692 details
hsa-miR-1-3p KNCN kinocilin HGNC:26488 details
hsa-miR-1-3p FANCI FA complementation group I HGNC:25568 details
hsa-miR-1-3p GCFC2 GC-rich sequence DNA-binding factor 2 HGNC:1317 details
hsa-miR-1-3p GJB3 gap junction protein beta 3 HGNC:4285 details
hsa-miR-1-3p STK24 serine/threonine kinase 24 HGNC:11403 details
hsa-miR-1-3p MCM3 minichromosome maintenance complex component 3 HGNC:6945 details
hsa-miR-1-3p DMTN dematin actin binding protein HGNC:3382 details
hsa-miR-1-3p SIN3A SIN3 transcription regulator family member A HGNC:19353 details
hsa-miR-1-3p ZNF561 zinc finger protein 561 HGNC:28684 details
hsa-miR-1-3p details
hsa-miR-1-3p BMP7 bone morphogenetic protein 7 HGNC:1074 details
hsa-miR-1-3p SLC39A14 solute carrier family 39 member 14 HGNC:20858 details
hsa-miR-1-3p MOBP myelin associated oligodendrocyte basic protein HGNC:7189 details
hsa-miR-1-3p details
hsa-miR-1-3p CBX5 chromobox 5 HGNC:1555 details
hsa-miR-1-3p ATL3 atlastin GTPase 3 HGNC:24526 details
hsa-miR-1-3p BAG5 BAG cochaperone 5 HGNC:941 details
hsa-miR-1-3p CPSF3 cleavage and polyadenylation specific factor 3 HGNC:2326 details
hsa-miR-1-3p SGK3 serum/glucocorticoid regulated kinase family member 3 HGNC:10812 details
hsa-miR-1-3p ALDH2 aldehyde dehydrogenase 2 family member HGNC:404 details
hsa-miR-1-3p USP33 ubiquitin specific peptidase 33 HGNC:20059 details
hsa-miR-1-3p RIMS2 regulating synaptic membrane exocytosis 2 HGNC:17283 details
hsa-miR-1-3p LETM1 leucine zipper and EF-hand containing transmembrane protein 1 HGNC:6556 details
hsa-miR-1-3p RAP1B RAP1B, member of RAS oncogene family HGNC:9857 details
hsa-miR-1-3p GOLPH3 golgi phosphoprotein 3 HGNC:15452 details
hsa-miR-1-3p PGD phosphogluconate dehydrogenase HGNC:8891 details
hsa-miR-1-3p UTRN utrophin HGNC:12635 details
hsa-miR-1-3p GPR137C G protein-coupled receptor 137C HGNC:25445 details
hsa-miR-1-3p FBXO33 F-box protein 33 HGNC:19833 details
hsa-miR-1-3p ITGA6 integrin subunit alpha 6 HGNC:6142 details
hsa-miR-1-3p SRF serum response factor HGNC:11291 details
hsa-miR-1-3p MRPL19 mitochondrial ribosomal protein L19 HGNC:14052 details
hsa-miR-1-3p JUP junction plakoglobin HGNC:6207 details
hsa-miR-1-3p KIF5B kinesin family member 5B HGNC:6324 details
hsa-miR-1-3p SLC27A4 solute carrier family 27 member 4 HGNC:10998 details
hsa-miR-1-3p GNAI1 G protein subunit alpha i1 HGNC:4384 details
hsa-miR-1-3p PLS3 plastin 3 HGNC:9091 details
hsa-miR-1-3p MYO1A myosin IA HGNC:7595 details
hsa-miR-1-3p AP1B1 adaptor related protein complex 1 subunit beta 1 HGNC:554 details
hsa-miR-1-3p FNDC3A fibronectin type III domain containing 3A HGNC:20296 details
hsa-miR-1-3p FLOT2 flotillin 2 HGNC:3758 details
hsa-miR-1-3p PSIP1 PC4 and SFRS1 interacting protein 1 HGNC:9527 details
hsa-miR-1-3p MYO1B myosin IB HGNC:7596 details
hsa-miR-1-3p CAPN1 calpain 1 HGNC:1476 details
hsa-miR-1-3p TAT tyrosine aminotransferase HGNC:11573 details
hsa-miR-1-3p CHRNA4 cholinergic receptor nicotinic alpha 4 subunit HGNC:1958 details
hsa-miR-1-3p PCDH7 protocadherin 7 HGNC:8659 details
hsa-miR-1-3p HNRNPH1 heterogeneous nuclear ribonucleoprotein H1 HGNC:5041 details
hsa-miR-1-3p PYGB glycogen phosphorylase B HGNC:9723 details
hsa-miR-1-3p CCDC88C coiled-coil domain containing 88C HGNC:19967 details
hsa-miR-1-3p RBM42 RNA binding motif protein 42 HGNC:28117 details
hsa-miR-1-3p ABCB6 ATP binding cassette subfamily B member 6 (Langereis blood group) HGNC:47 details
hsa-miR-1-3p UNC13D unc-13 homolog D HGNC:23147 details
hsa-miR-1-3p DTX1 deltex E3 ubiquitin ligase 1 HGNC:3060 details
hsa-miR-1-3p LGALS1 galectin 1 HGNC:6561 details
hsa-miR-1-3p details
hsa-miR-1-3p KLHDC4 kelch domain containing 4 HGNC:25272 details
hsa-miR-1-3p SLBP stem-loop binding protein HGNC:10904 details
hsa-miR-1-3p PI16 peptidase inhibitor 16 HGNC:21245 details
hsa-miR-1-3p RBM12B RNA binding motif protein 12B HGNC:32310 details
hsa-miR-1-3p CALR calreticulin HGNC:1455 details
hsa-miR-1-3p F2RL1 F2R like trypsin receptor 1 HGNC:3538 details
hsa-miR-1-3p SLC25A19 solute carrier family 25 member 19 HGNC:14409 details
hsa-miR-1-3p details
hsa-miR-1-3p ABHD12 abhydrolase domain containing 12, lysophospholipase HGNC:15868 details
hsa-miR-1-3p MCAM melanoma cell adhesion molecule HGNC:6934 details
hsa-miR-1-3p PTPMT1 protein tyrosine phosphatase mitochondrial 1 HGNC:26965 details
hsa-miR-1-3p COQ6 coenzyme Q6, monooxygenase HGNC:20233 details
hsa-miR-1-3p RFC5 replication factor C subunit 5 HGNC:9973 details
hsa-miR-1-3p ZNF579 zinc finger protein 579 HGNC:26646 details
hsa-miR-1-3p TRIM26 tripartite motif containing 26 HGNC:12962 details
hsa-miR-1-3p SPC24 SPC24 component of NDC80 kinetochore complex HGNC:26913 details
hsa-miR-1-3p SEC11C SEC11 homolog C, signal peptidase complex subunit HGNC:23400 details
hsa-miR-1-3p SEMG2 semenogelin 2 HGNC:10743 details
hsa-miR-1-3p RASSF1 Ras association domain family member 1 HGNC:9882 details
hsa-miR-1-3p details
hsa-miR-1-3p MACROD1 mono-ADP ribosylhydrolase 1 HGNC:29598 details
hsa-miR-1-3p details
hsa-miR-1-3p PLXDC2 plexin domain containing 2 HGNC:21013 details
hsa-miR-1-3p NXPH2 neurexophilin 2 HGNC:8076 details
hsa-miR-1-3p SYNE2 spectrin repeat containing nuclear envelope protein 2 HGNC:17084 details
hsa-miR-1-3p TRPM6 transient receptor potential cation channel subfamily M member 6 HGNC:17995 details
hsa-miR-1-3p CAD carbamoyl-phosphate synthetase 2, aspartate transcarbamylase, and dihydroorotase HGNC:1424 details
hsa-miR-1-3p SH3TC2 SH3 domain and tetratricopeptide repeats 2 HGNC:29427 details
hsa-miR-1-3p VASP vasodilator stimulated phosphoprotein HGNC:12652 details
hsa-miR-1-3p ATP6V1C1 ATPase H+ transporting V1 subunit C1 HGNC:856 details
hsa-miR-1-3p AKAP12 A-kinase anchoring protein 12 HGNC:370 details
hsa-miR-1-3p ATP2B4 ATPase plasma membrane Ca2+ transporting 4 HGNC:817 details
hsa-miR-1-3p CLDN12 claudin 12 HGNC:2034 details
hsa-miR-1-3p CHAMP1 chromosome alignment maintaining phosphoprotein 1 HGNC:20311 details
hsa-miR-1-3p PPM1H protein phosphatase, Mg2+/Mn2+ dependent 1H HGNC:18583 details
hsa-miR-1-3p G3BP2 G3BP stress granule assembly factor 2 HGNC:30291 details
hsa-miR-1-3p VPS53 VPS53 subunit of GARP complex HGNC:25608 details
hsa-miR-1-3p IPO8 importin 8 HGNC:9853 details
hsa-miR-1-3p AKAP4 A-kinase anchoring protein 4 HGNC:374 details
hsa-miR-1-3p VMP1 vacuole membrane protein 1 HGNC:29559 details
hsa-miR-1-3p PTAR1 protein prenyltransferase alpha subunit repeat containing 1 HGNC:30449 details
hsa-miR-1-3p DKK1 dickkopf WNT signaling pathway inhibitor 1 HGNC:2891 details
hsa-miR-1-3p UHMK1 U2AF homology motif kinase 1 HGNC:19683 details
hsa-miR-1-3p ZNF326 zinc finger protein 326 HGNC:14104 details
hsa-miR-1-3p FAM102A family with sequence similarity 102 member A HGNC:31419 details
hsa-miR-1-3p PLXNA4 plexin A4 HGNC:9102 details
hsa-miR-1-3p RABEPK Rab9 effector protein with kelch motifs HGNC:16896 details
hsa-miR-1-3p FUBP1 far upstream element binding protein 1 HGNC:4004 details
hsa-miR-1-3p MATR3 matrin 3 HGNC:6912 details
hsa-miR-1-3p GNAI2 G protein subunit alpha i2 HGNC:4385 details
hsa-miR-1-3p CCDC124 coiled-coil domain containing 124 HGNC:25171 details
hsa-miR-1-3p RALB RAS like proto-oncogene B HGNC:9840 details
hsa-miR-1-3p GTF3C6 general transcription factor IIIC subunit 6 HGNC:20872 details
hsa-miR-1-3p EMD emerin HGNC:3331 details
hsa-miR-1-3p ECHS1 enoyl-CoA hydratase, short chain 1 HGNC:3151 details
hsa-miR-1-3p details
hsa-miR-1-3p CACNA2D1 calcium voltage-gated channel auxiliary subunit alpha2delta 1 HGNC:1399 details
hsa-miR-1-3p PXDN peroxidasin HGNC:14966 details
hsa-miR-1-3p AMDHD1 amidohydrolase domain containing 1 HGNC:28577 details
hsa-miR-1-3p THAP2 THAP domain containing 2 HGNC:20854 details
hsa-miR-1-3p KDELR1 KDEL endoplasmic reticulum protein retention receptor 1 HGNC:6304 details
hsa-miR-1-3p NAT14 N-acetyltransferase 14 (putative) HGNC:28918 details
hsa-miR-1-3p DDTL D-dopachrome tautomerase like HGNC:33446 details
hsa-miR-1-3p PLCXD2 phosphatidylinositol specific phospholipase C X domain containing 2 HGNC:26462 details
hsa-miR-1-3p BTC betacellulin HGNC:1121 details
hsa-miR-1-3p ILVBL ilvB acetolactate synthase like HGNC:6041 details
hsa-miR-1-3p RRM1 ribonucleotide reductase catalytic subunit M1 HGNC:10451 details
hsa-miR-1-3p GPR83 G protein-coupled receptor 83 HGNC:4523 details
hsa-miR-1-3p PPA2 inorganic pyrophosphatase 2 HGNC:28883 details
hsa-miR-1-3p DYNC1LI1 dynein cytoplasmic 1 light intermediate chain 1 HGNC:18745 details
hsa-miR-1-3p NPTN neuroplastin HGNC:17867 details
hsa-miR-1-3p MAGEB3 MAGE family member B3 HGNC:6810 details
hsa-miR-1-3p PSG6 pregnancy specific beta-1-glycoprotein 6 HGNC:9523 details
hsa-miR-1-3p ORC3 origin recognition complex subunit 3 HGNC:8489 details
hsa-miR-1-3p SFI1 SFI1 centrin binding protein HGNC:29064 details
hsa-miR-1-3p PAXBP1 PAX3 and PAX7 binding protein 1 HGNC:13579 details
hsa-miR-1-3p HSPA1A heat shock protein family A (Hsp70) member 1A HGNC:5232 details
hsa-miR-1-3p CYP20A1 cytochrome P450 family 20 subfamily A member 1 HGNC:20576 details
hsa-miR-1-3p PSG3 pregnancy specific beta-1-glycoprotein 3 HGNC:9520 details
hsa-miR-1-3p MPRIP myosin phosphatase Rho interacting protein HGNC:30321 details
hsa-miR-1-3p PRIMA1 proline rich membrane anchor 1 HGNC:18319 details
hsa-miR-1-3p ACP2 acid phosphatase 2, lysosomal HGNC:123 details
hsa-miR-1-3p IL11 interleukin 11 HGNC:5966 details
hsa-miR-1-3p ZNF264 zinc finger protein 264 HGNC:13057 details
hsa-miR-1-3p EXOC2 exocyst complex component 2 HGNC:24968 details
hsa-miR-1-3p C12orf57 chromosome 12 open reading frame 57 HGNC:29521 details
hsa-miR-1-3p CDH4 cadherin 4 HGNC:1763 details
hsa-miR-1-3p KLHL3 kelch like family member 3 HGNC:6354 details
hsa-miR-1-3p details
hsa-miR-1-3p details
hsa-miR-1-3p TRPM4 transient receptor potential cation channel subfamily M member 4 HGNC:17993 details
hsa-miR-1-3p CAST calpastatin HGNC:1515 details
hsa-miR-1-3p SLC25A30 solute carrier family 25 member 30 HGNC:27371 details
hsa-miR-1-3p SCAF11 SR-related CTD associated factor 11 HGNC:10784 details
hsa-miR-1-3p KCND1 potassium voltage-gated channel subfamily D member 1 HGNC:6237 details
hsa-miR-1-3p CHAF1B chromatin assembly factor 1 subunit B HGNC:1911 details
hsa-miR-1-3p SYTL2 synaptotagmin like 2 HGNC:15585 details
hsa-miR-1-3p UGGT2 UDP-glucose glycoprotein glucosyltransferase 2 HGNC:15664 details
hsa-miR-1-3p SRSF4 serine and arginine rich splicing factor 4 HGNC:10786 details
hsa-miR-1-3p ZC3H11A zinc finger CCCH-type containing 11A HGNC:29093 details
hsa-miR-1-3p TMEM106C transmembrane protein 106C HGNC:28775 details
hsa-miR-1-3p UBTF upstream binding transcription factor HGNC:12511 details
hsa-miR-1-3p OSBPL10 oxysterol binding protein like 10 HGNC:16395 details
hsa-miR-1-3p KLK12 kallikrein related peptidase 12 HGNC:6360 details
hsa-miR-1-3p INTS6 integrator complex subunit 6 HGNC:14879 details
hsa-miR-1-3p MKI67 marker of proliferation Ki-67 HGNC:7107 details
hsa-miR-1-3p SH2D4A SH2 domain containing 4A HGNC:26102 details
hsa-miR-1-3p NUP50 nucleoporin 50 HGNC:8065 details
hsa-miR-1-3p SHE Src homology 2 domain containing E HGNC:27004 details
hsa-miR-1-3p IGF1 insulin like growth factor 1 HGNC:5464 details
hsa-miR-1-3p ABCB7 ATP binding cassette subfamily B member 7 HGNC:48 details
hsa-miR-1-3p PPARG peroxisome proliferator activated receptor gamma HGNC:9236 details
hsa-miR-1-3p MAD2L1 mitotic arrest deficient 2 like 1 HGNC:6763 details
hsa-miR-1-3p details
hsa-miR-1-3p ACTN4 actinin alpha 4 HGNC:166 details
hsa-miR-1-3p TNKS1BP1 tankyrase 1 binding protein 1 HGNC:19081 details
hsa-miR-1-3p PIGT phosphatidylinositol glycan anchor biosynthesis class T HGNC:14938 details
hsa-miR-1-3p PGRMC2 progesterone receptor membrane component 2 HGNC:16089 details
hsa-miR-1-3p COMMD2 COMM domain containing 2 HGNC:24993 details
hsa-miR-1-3p CD109 CD109 molecule HGNC:21685 details
hsa-miR-1-3p COPG1 COPI coat complex subunit gamma 1 HGNC:2236 details
hsa-miR-1-3p DSG2 desmoglein 2 HGNC:3049 details
hsa-miR-1-3p DCUN1D1 defective in cullin neddylation 1 domain containing 1 HGNC:18184 details
hsa-miR-1-3p SMARCA1 SWI/SNF related, matrix associated, actin dependent regulator of chromatin, subfamily a, member 1 HGNC:11097 details
hsa-miR-1-3p MSH2 mutS homolog 2 HGNC:7325 details
hsa-miR-1-3p details
hsa-miR-1-3p DHRS1 dehydrogenase/reductase 1 HGNC:16445 details
hsa-miR-1-3p CCL14 C-C motif chemokine ligand 14 HGNC:10612 details
hsa-miR-1-3p SUCLA2 succinate-CoA ligase ADP-forming subunit beta HGNC:11448 details
hsa-miR-1-3p ETV7 ETS variant transcription factor 7 HGNC:18160 details
hsa-miR-1-3p HMOX1 heme oxygenase 1 HGNC:5013 details
hsa-miR-1-3p KAT2A lysine acetyltransferase 2A HGNC:4201 details
hsa-miR-1-3p KANK2 KN motif and ankyrin repeat domains 2 HGNC:29300 details
hsa-miR-1-3p SYNPO2L synaptopodin 2 like HGNC:23532 details
hsa-miR-1-3p details
hsa-miR-1-3p NCAPD3 non-SMC condensin II complex subunit D3 HGNC:28952 details
hsa-miR-1-3p PAFAH1B3 platelet activating factor acetylhydrolase 1b catalytic subunit 3 HGNC:8576 details
hsa-miR-1-3p ADAMTSL4 ADAMTS like 4 HGNC:19706 details
hsa-miR-1-3p ACADVL acyl-CoA dehydrogenase very long chain HGNC:92 details
hsa-miR-1-3p SREK1 splicing regulatory glutamic acid and lysine rich protein 1 HGNC:17882 details
hsa-miR-1-3p HSP90B1 heat shock protein 90 beta family member 1 HGNC:12028 details
hsa-miR-1-3p EMP3 epithelial membrane protein 3 HGNC:3335 details
hsa-miR-1-3p FAM81A family with sequence similarity 81 member A HGNC:28379 details
hsa-miR-1-3p SPINK1 serine peptidase inhibitor Kazal type 1 HGNC:11244 details
hsa-miR-1-3p details
hsa-miR-1-3p NT5C1B 5'-nucleotidase, cytosolic IB HGNC:17818 details
hsa-miR-1-3p OXTR oxytocin receptor HGNC:8529 details
hsa-miR-1-3p DPP7 dipeptidyl peptidase 7 HGNC:14892 details
hsa-miR-1-3p details
hsa-miR-1-3p MPDU1 mannose-P-dolichol utilization defect 1 HGNC:7207 details
hsa-miR-1-3p PSG9 pregnancy specific beta-1-glycoprotein 9 HGNC:9526 details
hsa-miR-1-3p FHDC1 FH2 domain containing 1 HGNC:29363 details
hsa-miR-1-3p ANKFY1 ankyrin repeat and FYVE domain containing 1 HGNC:20763 details
hsa-miR-1-3p NR5A2 nuclear receptor subfamily 5 group A member 2 HGNC:7984 details
hsa-miR-1-3p NXN nucleoredoxin HGNC:18008 details
hsa-miR-1-3p RBBP5 RB binding protein 5, histone lysine methyltransferase complex subunit HGNC:9888 details
hsa-miR-1-3p details
hsa-miR-1-3p HDAC2 histone deacetylase 2 HGNC:4853 details
hsa-miR-1-3p LHX4 LIM homeobox 4 HGNC:21734 details
hsa-miR-1-3p CDC42 cell division cycle 42 HGNC:1736 details
hsa-miR-1-3p ZBTB9 zinc finger and BTB domain containing 9 HGNC:28323 details
hsa-miR-1-3p NCAPG non-SMC condensin I complex subunit G HGNC:24304 details
hsa-miR-1-3p AP1S3 adaptor related protein complex 1 subunit sigma 3 HGNC:18971 details
hsa-miR-1-3p BCAP29 B cell receptor associated protein 29 HGNC:24131 details
hsa-miR-1-3p TSHR thyroid stimulating hormone receptor HGNC:12373 details
hsa-miR-1-3p PDE12 phosphodiesterase 12 HGNC:25386 details
hsa-miR-1-3p ADAM12 ADAM metallopeptidase domain 12 HGNC:190 details
hsa-miR-1-3p ATP6V1A ATPase H+ transporting V1 subunit A HGNC:851 details
hsa-miR-1-3p HOOK1 hook microtubule tethering protein 1 HGNC:19884 details
hsa-miR-1-3p PFDN1 prefoldin subunit 1 HGNC:8866 details
hsa-miR-1-3p TMCC1 transmembrane and coiled-coil domain family 1 HGNC:29116 details
hsa-miR-1-3p SUSD1 sushi domain containing 1 HGNC:25413 details
hsa-miR-1-3p SEC62 SEC62 homolog, preprotein translocation factor HGNC:11846 details
hsa-miR-1-3p SMARCC1 SWI/SNF related, matrix associated, actin dependent regulator of chromatin subfamily c member 1 HGNC:11104 details
hsa-miR-1-3p YWHAZ tyrosine 3-monooxygenase/tryptophan 5-monooxygenase activation protein zeta HGNC:12855 details
hsa-miR-1-3p NXT2 nuclear transport factor 2 like export factor 2 HGNC:18151 details
hsa-miR-1-3p ACTN1 actinin alpha 1 HGNC:163 details
hsa-miR-1-3p EIF4G1 eukaryotic translation initiation factor 4 gamma 1 HGNC:3296 details
hsa-miR-1-3p COPZ1 COPI coat complex subunit zeta 1 HGNC:2243 details
hsa-miR-1-3p MOB4 MOB family member 4, phocein HGNC:17261 details
hsa-miR-1-3p RSRC2 arginine and serine rich coiled-coil 2 HGNC:30559 details
hsa-miR-1-3p MYO3B myosin IIIB HGNC:15576 details
hsa-miR-1-3p PDIA3 protein disulfide isomerase family A member 3 HGNC:4606 details
hsa-miR-1-3p FLNB filamin B HGNC:3755 details
hsa-miR-1-3p CHRAC1 chromatin accessibility complex subunit 1 HGNC:13544 details
hsa-miR-1-3p PLS1 plastin 1 HGNC:9090 details
hsa-miR-1-3p POM121C POM121 transmembrane nucleoporin C HGNC:34005 details
hsa-miR-1-3p LRRC8C leucine rich repeat containing 8 VRAC subunit C HGNC:25075 details
hsa-miR-1-3p OXCT1 3-oxoacid CoA-transferase 1 HGNC:8527 details
hsa-miR-1-3p WASF2 WASP family member 2 HGNC:12733 details
hsa-miR-1-3p FLNA filamin A HGNC:3754 details
hsa-miR-1-3p IGFBP7 insulin like growth factor binding protein 7 HGNC:5476 details
hsa-miR-1-3p FBN1 fibrillin 1 HGNC:3603 details
hsa-miR-1-3p PNN pinin, desmosome associated protein HGNC:9162 details
hsa-miR-1-3p NCS1 neuronal calcium sensor 1 HGNC:3953 details
hsa-miR-1-3p WDR33 WD repeat domain 33 HGNC:25651 details
hsa-miR-1-3p MSH6 mutS homolog 6 HGNC:7329 details
hsa-miR-1-3p RAB27B RAB27B, member RAS oncogene family HGNC:9767 details
hsa-miR-1-3p MAN1B1 mannosidase alpha class 1B member 1 HGNC:6823 details
hsa-miR-1-3p OASL 2'-5'-oligoadenylate synthetase like HGNC:8090 details
hsa-miR-1-3p IFIT3 interferon induced protein with tetratricopeptide repeats 3 HGNC:5411 details
hsa-miR-1-3p TMEM87A transmembrane protein 87A HGNC:24522 details
hsa-miR-1-3p TUBB2B tubulin beta 2B class IIb HGNC:30829 details
hsa-miR-1-3p SNRNP35 small nuclear ribonucleoprotein U11/U12 subunit 35 HGNC:30852 details
hsa-miR-1-3p ZNF799 zinc finger protein 799 HGNC:28071 details
hsa-miR-1-3p C6orf118 chromosome 6 open reading frame 118 HGNC:21233 details
hsa-miR-1-3p HERC2 HECT and RLD domain containing E3 ubiquitin protein ligase 2 HGNC:4868 details
hsa-miR-1-3p HINT2 histidine triad nucleotide binding protein 2 HGNC:18344 details
hsa-miR-1-3p RASA1 RAS p21 protein activator 1 HGNC:9871 details
hsa-miR-1-3p SLC29A1 solute carrier family 29 member 1 (Augustine blood group) HGNC:11003 details
hsa-miR-1-3p DPY30 dpy-30 histone methyltransferase complex regulatory subunit HGNC:24590 details
hsa-miR-1-3p RGN regucalcin HGNC:9989 details
hsa-miR-1-3p MFSD10 major facilitator superfamily domain containing 10 HGNC:16894 details
hsa-miR-1-3p PRKAG1 protein kinase AMP-activated non-catalytic subunit gamma 1 HGNC:9385 details
hsa-miR-1-3p CENPF centromere protein F HGNC:1857 details
hsa-miR-1-3p SLC25A10 solute carrier family 25 member 10 HGNC:10980 details
hsa-miR-1-3p PLK2 polo like kinase 2 HGNC:19699 details
hsa-miR-1-3p IQCD IQ motif containing D HGNC:25168 details
hsa-miR-1-3p CCDC134 coiled-coil domain containing 134 HGNC:26185 details
hsa-miR-1-3p ORMDL2 ORMDL sphingolipid biosynthesis regulator 2 HGNC:16037 details
hsa-miR-1-3p TRIM9 tripartite motif containing 9 HGNC:16288 details
hsa-miR-1-3p PPP2R2A protein phosphatase 2 regulatory subunit Balpha HGNC:9304 details
hsa-miR-1-3p AIM2 absent in melanoma 2 HGNC:357 details
hsa-miR-1-3p PHLDB2 pleckstrin homology like domain family B member 2 HGNC:29573 details
hsa-miR-1-3p TPD52L2 TPD52 like 2 HGNC:12007 details
hsa-miR-1-3p LNPEP leucyl and cystinyl aminopeptidase HGNC:6656 details
hsa-miR-1-3p RASSF5 Ras association domain family member 5 HGNC:17609 details
hsa-miR-1-3p KIF4A kinesin family member 4A HGNC:13339 details
hsa-miR-1-3p MIA2 MIA SH3 domain ER export factor 2 HGNC:18432 details
hsa-miR-1-3p PARVA parvin alpha HGNC:14652 details
hsa-miR-1-3p LIFR LIF receptor subunit alpha HGNC:6597 details
hsa-miR-1-3p PSAT1 phosphoserine aminotransferase 1 HGNC:19129 details
hsa-miR-1-3p FMNL3 formin like 3 HGNC:23698 details
hsa-miR-1-3p EFR3A EFR3 homolog A HGNC:28970 details
hsa-miR-1-3p CCND1 cyclin D1 HGNC:1582 details
hsa-miR-1-3p AP1S1 adaptor related protein complex 1 subunit sigma 1 HGNC:559 details
hsa-miR-1-3p B4GALT1 beta-1,4-galactosyltransferase 1 HGNC:924 details
hsa-miR-1-3p RAPGEF2 Rap guanine nucleotide exchange factor 2 HGNC:16854 details
hsa-miR-1-3p SRSF6 serine and arginine rich splicing factor 6 HGNC:10788 details
hsa-miR-1-3p HNRNPA1L2 heterogeneous nuclear ribonucleoprotein A1 like 2 HGNC:27067 details
hsa-miR-1-3p MARCKS myristoylated alanine rich protein kinase C substrate HGNC:6759 details
hsa-miR-1-3p SRI sorcin HGNC:11292 details
hsa-miR-1-3p E2F5 E2F transcription factor 5 HGNC:3119 details
hsa-miR-1-3p EIF4E eukaryotic translation initiation factor 4E HGNC:3287 details
hsa-miR-1-3p SIGMAR1 sigma non-opioid intracellular receptor 1 HGNC:8157 details
hsa-miR-1-3p GPC1 glypican 1 HGNC:4449 details
hsa-miR-1-3p CDK9 cyclin dependent kinase 9 HGNC:1780 details
hsa-miR-1-3p details
hsa-miR-1-3p CCDC22 coiled-coil domain containing 22 HGNC:28909 details
hsa-miR-1-3p FNDC3B fibronectin type III domain containing 3B HGNC:24670 details
hsa-miR-1-3p PDCD10 programmed cell death 10 HGNC:8761 details
hsa-miR-1-3p details
hsa-miR-1-3p BRDT bromodomain testis associated HGNC:1105 details
hsa-miR-1-3p PROCR protein C receptor HGNC:9452 details
hsa-miR-1-3p CPSF1 cleavage and polyadenylation specific factor 1 HGNC:2324 details
hsa-miR-1-3p RFC2 replication factor C subunit 2 HGNC:9970 details
hsa-miR-1-3p PACSIN3 protein kinase C and casein kinase substrate in neurons 3 HGNC:8572 details
hsa-miR-1-3p BCL6B BCL6B transcription repressor HGNC:1002 details
hsa-miR-1-3p HSD17B8 hydroxysteroid 17-beta dehydrogenase 8 HGNC:3554 details
hsa-miR-1-3p CXCL3 C-X-C motif chemokine ligand 3 HGNC:4604 details
hsa-miR-1-3p AMZ1 archaelysin family metallopeptidase 1 HGNC:22231 details
hsa-miR-1-3p FADD Fas associated via death domain HGNC:3573 details
hsa-miR-1-3p CLEC1A C-type lectin domain family 1 member A HGNC:24355 details
hsa-miR-1-3p ANGPTL4 angiopoietin like 4 HGNC:16039 details
hsa-miR-1-3p FRG1 FSHD region gene 1 HGNC:3954 details
hsa-miR-1-3p IL27RA interleukin 27 receptor subunit alpha HGNC:17290 details
hsa-miR-1-3p CA3 carbonic anhydrase 3 HGNC:1374 details
hsa-miR-1-3p PIGS phosphatidylinositol glycan anchor biosynthesis class S HGNC:14937 details
hsa-miR-1-3p MME membrane metalloendopeptidase HGNC:7154 details
hsa-miR-1-3p EPB41L4B erythrocyte membrane protein band 4.1 like 4B HGNC:19818 details
hsa-miR-1-3p ETNK1 ethanolamine kinase 1 HGNC:24649 details
hsa-miR-1-3p PLEKHG2 pleckstrin homology and RhoGEF domain containing G2 HGNC:29515 details
hsa-miR-1-3p IFIT2 interferon induced protein with tetratricopeptide repeats 2 HGNC:5409 details
hsa-miR-1-3p CRYGS crystallin gamma S HGNC:2417 details
hsa-miR-1-3p MCM2 minichromosome maintenance complex component 2 HGNC:6944 details
hsa-miR-1-3p GIMAP4 GTPase, IMAP family member 4 HGNC:21872 details
hsa-miR-1-3p ACTC1 actin alpha cardiac muscle 1 HGNC:143 details
hsa-miR-1-3p ANP32A acidic nuclear phosphoprotein 32 family member A HGNC:13233 details
hsa-miR-1-3p SMC4 structural maintenance of chromosomes 4 HGNC:14013 details
hsa-miR-1-3p YTHDF2 YTH N6-methyladenosine RNA binding protein 2 HGNC:31675 details
hsa-miR-1-3p ERMN ermin HGNC:29208 details
hsa-miR-1-3p RBM39 RNA binding motif protein 39 HGNC:15923 details
hsa-miR-1-3p IFI44 interferon induced protein 44 HGNC:16938 details
hsa-miR-1-3p TPSD1 tryptase delta 1 HGNC:14118 details
hsa-miR-1-3p details
hsa-miR-1-3p DROSHA drosha ribonuclease III HGNC:17904 details
hsa-miR-1-3p TTC37 tetratricopeptide repeat domain 37 HGNC:23639 details
hsa-miR-1-3p NUAK1 NUAK family kinase 1 HGNC:14311 details
hsa-miR-1-3p ZNF207 zinc finger protein 207 HGNC:12998 details
hsa-miR-1-3p GNRHR gonadotropin releasing hormone receptor HGNC:4421 details
hsa-miR-1-3p LEMD3 LEM domain containing 3 HGNC:28887 details
hsa-miR-1-3p UBA6 ubiquitin like modifier activating enzyme 6 HGNC:25581 details
hsa-miR-1-3p RHOC ras homolog family member C HGNC:669 details
hsa-miR-1-3p RAB30 RAB30, member RAS oncogene family HGNC:9770 details
hsa-miR-1-3p SCN3A sodium voltage-gated channel alpha subunit 3 HGNC:10590 details
hsa-miR-1-3p PRKG2 protein kinase cGMP-dependent 2 HGNC:9416 details
hsa-miR-1-3p PLCB3 phospholipase C beta 3 HGNC:9056 details
hsa-miR-1-3p PIR pirin HGNC:30048 details
hsa-miR-1-3p NAB1 NGFI-A binding protein 1 HGNC:7626 details
hsa-miR-1-3p FUBP3 far upstream element binding protein 3 HGNC:4005 details
hsa-miR-1-3p HSD17B11 hydroxysteroid 17-beta dehydrogenase 11 HGNC:22960 details
hsa-miR-1-3p FMNL2 formin like 2 HGNC:18267 details
hsa-miR-1-3p SMARCB1 SWI/SNF related, matrix associated, actin dependent regulator of chromatin, subfamily b, member 1 HGNC:11103 details
hsa-miR-1-3p SH3PXD2B SH3 and PX domains 2B HGNC:29242 details
hsa-miR-1-3p MRFAP1 Morf4 family associated protein 1 HGNC:24549 details
hsa-miR-1-3p CETN3 centrin 3 HGNC:1868 details
hsa-miR-1-3p details
hsa-miR-1-3p LIMS1 LIM zinc finger domain containing 1 HGNC:6616 details
hsa-miR-1-3p SUGP1 SURP and G-patch domain containing 1 HGNC:18643 details
hsa-miR-1-3p GNB2 G protein subunit beta 2 HGNC:4398 details
hsa-miR-1-3p LCP1 lymphocyte cytosolic protein 1 HGNC:6528 details
hsa-miR-1-3p CTTN cortactin HGNC:3338 details
hsa-miR-1-3p TMSB4X thymosin beta 4 X-linked HGNC:11881 details
hsa-miR-1-3p ZNF48 zinc finger protein 48 HGNC:13114 details
hsa-miR-1-3p POLD1 DNA polymerase delta 1, catalytic subunit HGNC:9175 details
hsa-miR-1-3p POLR2I RNA polymerase II subunit I HGNC:9196 details
hsa-miR-1-3p CSTF3 cleavage stimulation factor subunit 3 HGNC:2485 details
hsa-miR-1-3p MFN2 mitofusin 2 HGNC:16877 details
hsa-miR-1-3p DCTPP1 dCTP pyrophosphatase 1 HGNC:28777 details
hsa-miR-1-3p MTHFS methenyltetrahydrofolate synthetase HGNC:7437 details
hsa-miR-1-3p RPP40 ribonuclease P/MRP subunit p40 HGNC:20992 details
hsa-miR-1-3p details
hsa-miR-1-3p MINPP1 multiple inositol-polyphosphate phosphatase 1 HGNC:7102 details
hsa-miR-1-3p RRP36 ribosomal RNA processing 36 HGNC:21374 details
hsa-miR-1-3p ITGA1 integrin subunit alpha 1 HGNC:6134 details
hsa-miR-1-3p LCA5L lebercilin LCA5 like HGNC:1255 details
hsa-miR-1-3p UBE2I ubiquitin conjugating enzyme E2 I HGNC:12485 details
hsa-miR-1-3p DEFB125 defensin beta 125 HGNC:18105 details
hsa-miR-1-3p RHEB Ras homolog, mTORC1 binding HGNC:10011 details
hsa-miR-1-3p TSPAN19 tetraspanin 19 HGNC:31886 details
hsa-miR-1-3p BCAS4 breast carcinoma amplified sequence 4 HGNC:14367 details
hsa-miR-1-3p S100A11 S100 calcium binding protein A11 HGNC:10488 details
hsa-miR-1-3p MCM7 minichromosome maintenance complex component 7 HGNC:6950 details
hsa-miR-1-3p AP1M1 adaptor related protein complex 1 subunit mu 1 HGNC:13667 details
hsa-miR-1-3p GSTO1 glutathione S-transferase omega 1 HGNC:13312 details
hsa-miR-1-3p CXCL2 C-X-C motif chemokine ligand 2 HGNC:4603 details
hsa-miR-1-3p PACS2 phosphofurin acidic cluster sorting protein 2 HGNC:23794 details
hsa-miR-1-3p LRWD1 leucine rich repeats and WD repeat domain containing 1 HGNC:21769 details
hsa-miR-1-3p STXBP3 syntaxin binding protein 3 HGNC:11446 details
hsa-miR-1-3p ABCC4 ATP binding cassette subfamily C member 4 HGNC:55 details
hsa-miR-1-3p PTPN22 protein tyrosine phosphatase non-receptor type 22 HGNC:9652 details
hsa-miR-1-3p TAGLN transgelin HGNC:11553 details
hsa-miR-1-3p EXOC3 exocyst complex component 3 HGNC:30378 details
hsa-miR-1-3p ANKIB1 ankyrin repeat and IBR domain containing 1 HGNC:22215 details
hsa-miR-1-3p DDX60 DExD/H-box helicase 60 HGNC:25942 details
hsa-miR-1-3p FADS1 fatty acid desaturase 1 HGNC:3574 details
hsa-miR-1-3p SLC26A7 solute carrier family 26 member 7 HGNC:14467 details
hsa-miR-1-3p TRPA1 transient receptor potential cation channel subfamily A member 1 HGNC:497 details
hsa-miR-1-3p PPIA peptidylprolyl isomerase A HGNC:9253 details
hsa-miR-1-3p CAPG capping actin protein, gelsolin like HGNC:1474 details
hsa-miR-1-3p TLR4 toll like receptor 4 HGNC:11850 details
hsa-miR-1-3p HIGD1A HIG1 hypoxia inducible domain family member 1A HGNC:29527 details
hsa-miR-1-3p TMEM68 transmembrane protein 68 HGNC:26510 details
hsa-miR-1-3p SLC35A5 solute carrier family 35 member A5 HGNC:20792 details
hsa-miR-1-3p TMOD3 tropomodulin 3 HGNC:11873 details
hsa-miR-1-3p ZBTB6 zinc finger and BTB domain containing 6 HGNC:16764 details
hsa-miR-1-3p PLEKHH2 pleckstrin homology, MyTH4 and FERM domain containing H2 HGNC:30506 details
hsa-miR-1-3p DOK6 docking protein 6 HGNC:28301 details
hsa-miR-1-3p SEC61A1 SEC61 translocon subunit alpha 1 HGNC:18276 details
hsa-miR-1-3p SRSF7 serine and arginine rich splicing factor 7 HGNC:10789 details
hsa-miR-1-3p ZNF280C zinc finger protein 280C HGNC:25955 details
hsa-miR-1-3p CAPRIN1 cell cycle associated protein 1 HGNC:6743 details
hsa-miR-1-3p CLTC clathrin heavy chain HGNC:2092 details
hsa-miR-1-3p SMIM14 small integral membrane protein 14 HGNC:27321 details
hsa-miR-1-3p CHMP2A charged multivesicular body protein 2A HGNC:30216 details
hsa-miR-1-3p NUP160 nucleoporin 160 HGNC:18017 details
hsa-miR-1-3p CTDNEP1 CTD nuclear envelope phosphatase 1 HGNC:19085 details
hsa-miR-1-3p CNIH4 cornichon family AMPA receptor auxiliary protein 4 HGNC:25013 details
hsa-miR-1-3p EDF1 endothelial differentiation related factor 1 HGNC:3164 details
hsa-miR-1-3p GNAI3 G protein subunit alpha i3 HGNC:4387 details
hsa-miR-1-3p MYOCD myocardin HGNC:16067 details
hsa-miR-1-3p ZNF622 zinc finger protein 622 HGNC:30958 details
hsa-miR-1-3p GNB1 G protein subunit beta 1 HGNC:4396 details
hsa-miR-1-3p CD2AP CD2 associated protein HGNC:14258 details
hsa-miR-1-3p COPB1 COPI coat complex subunit beta 1 HGNC:2231 details
hsa-miR-1-3p HADH hydroxyacyl-CoA dehydrogenase HGNC:4799 details
hsa-miR-1-3p GPAA1 glycosylphosphatidylinositol anchor attachment 1 HGNC:4446 details
hsa-miR-1-3p S100G S100 calcium binding protein G HGNC:1436 details
hsa-miR-1-3p APEH acylaminoacyl-peptide hydrolase HGNC:586 details
hsa-miR-1-3p NDUFS4 NADH:ubiquinone oxidoreductase subunit S4 HGNC:7711 details
hsa-miR-1-3p HYI hydroxypyruvate isomerase (putative) HGNC:26948 details
hsa-miR-1-3p ELMOD2 ELMO domain containing 2 HGNC:28111 details
hsa-miR-1-3p NUP210 nucleoporin 210 HGNC:30052 details
hsa-miR-1-3p GLI2 GLI family zinc finger 2 HGNC:4318 details
hsa-miR-1-3p HIF3A hypoxia inducible factor 3 subunit alpha HGNC:15825 details
hsa-miR-1-3p RCOR2 REST corepressor 2 HGNC:27455 details
hsa-miR-1-3p SYPL1 synaptophysin like 1 HGNC:11507 details
hsa-miR-1-3p LRRC8D leucine rich repeat containing 8 VRAC subunit D HGNC:16992 details
hsa-miR-1-3p GPX1P1 glutathione peroxidase pseudogene 1 HGNC:4560 details
hsa-miR-1-3p MCM4 minichromosome maintenance complex component 4 HGNC:6947 details
hsa-miR-1-3p details
hsa-miR-1-3p DNAJC10 DnaJ heat shock protein family (Hsp40) member C10 HGNC:24637 details
hsa-miR-1-3p UNC45A unc-45 myosin chaperone A HGNC:30594 details
hsa-miR-1-3p PSME1 proteasome activator subunit 1 HGNC:9568 details
hsa-miR-1-3p FTSJ1 FtsJ RNA 2'-O-methyltransferase 1 HGNC:13254 details
hsa-miR-1-3p REM2 RRAD and GEM like GTPase 2 HGNC:20248 details
hsa-miR-1-3p ITGA3 integrin subunit alpha 3 HGNC:6139 details
hsa-miR-1-3p ISG15 ISG15 ubiquitin like modifier HGNC:4053 details
hsa-miR-1-3p NT5E 5'-nucleotidase ecto HGNC:8021 details
hsa-miR-1-3p PLGRKT plasminogen receptor with a C-terminal lysine HGNC:23633 details
hsa-miR-1-3p PKD1L1 polycystin 1 like 1, transient receptor potential channel interacting HGNC:18053 details
hsa-miR-1-3p ATP6V1E1 ATPase H+ transporting V1 subunit E1 HGNC:857 details
hsa-miR-1-3p DDX6 DEAD-box helicase 6 HGNC:2747 details
hsa-miR-1-3p NOC2L NOC2 like nucleolar associated transcriptional repressor HGNC:24517 details
hsa-miR-1-3p DPY19L1 dpy-19 like C-mannosyltransferase 1 HGNC:22205 details
hsa-miR-1-3p MCM5 minichromosome maintenance complex component 5 HGNC:6948 details
hsa-miR-1-3p details
hsa-miR-1-3p EFCAB1 EF-hand calcium binding domain 1 HGNC:25678 details
hsa-miR-1-3p LMNB1 lamin B1 HGNC:6637 details
hsa-miR-1-3p AIFM2 apoptosis inducing factor mitochondria associated 2 HGNC:21411 details
hsa-miR-1-3p FBXO45 F-box protein 45 HGNC:29148 details
hsa-miR-1-3p MYO18A myosin XVIIIA HGNC:31104 details
hsa-miR-1-3p details
hsa-miR-1-3p HERC5 HECT and RLD domain containing E3 ubiquitin protein ligase 5 HGNC:24368 details
hsa-miR-1-3p HS2ST1 heparan sulfate 2-O-sulfotransferase 1 HGNC:5193 details
hsa-miR-1-3p LONP2 lon peptidase 2, peroxisomal HGNC:20598 details
hsa-miR-1-3p SMARCA2 SWI/SNF related, matrix associated, actin dependent regulator of chromatin, subfamily a, member 2 HGNC:11098 details
hsa-miR-1-3p DDX42 DEAD-box helicase 42 HGNC:18676 details
hsa-miR-1-3p TTC17 tetratricopeptide repeat domain 17 HGNC:25596 details
hsa-miR-1-3p SRGAP1 SLIT-ROBO Rho GTPase activating protein 1 HGNC:17382 details
hsa-miR-1-3p AFAP1 actin filament associated protein 1 HGNC:24017 details
hsa-miR-1-3p PTPRD protein tyrosine phosphatase receptor type D HGNC:9668 details
hsa-miR-1-3p EML3 EMAP like 3 HGNC:26666 details
hsa-miR-1-3p ANKRD17 ankyrin repeat domain 17 HGNC:23575 details
hsa-miR-1-3p TRPS1 transcriptional repressor GATA binding 1 HGNC:12340 details
hsa-miR-1-3p XPOT exportin for tRNA HGNC:12826 details
hsa-miR-1-3p ALG2 ALG2 alpha-1,3/1,6-mannosyltransferase HGNC:23159 details
hsa-miR-1-3p HIPK3 homeodomain interacting protein kinase 3 HGNC:4915 details
hsa-miR-1-3p OSTF1 osteoclast stimulating factor 1 HGNC:8510 details
hsa-miR-1-3p IST1 IST1 factor associated with ESCRT-III HGNC:28977 details
hsa-miR-1-3p PTPN1 protein tyrosine phosphatase non-receptor type 1 HGNC:9642 details
hsa-miR-1-3p PQBP1 polyglutamine binding protein 1 HGNC:9330 details
hsa-miR-1-3p BAX BCL2 associated X, apoptosis regulator HGNC:959 details
hsa-miR-1-3p GNA13 G protein subunit alpha 13 HGNC:4381 details
hsa-miR-1-3p FOLR1 folate receptor alpha HGNC:3791 details
hsa-miR-1-3p PRDX2 peroxiredoxin 2 HGNC:9353 details
hsa-miR-1-3p AHNAK2 AHNAK nucleoprotein 2 HGNC:20125 details
hsa-miR-1-3p GNAT2 G protein subunit alpha transducin 2 HGNC:4394 details
hsa-miR-1-3p EFTUD2 elongation factor Tu GTP binding domain containing 2 HGNC:30858 details
hsa-miR-1-3p KRT75 keratin 75 HGNC:24431 details
hsa-miR-1-3p CTBP2 C-terminal binding protein 2 HGNC:2495 details
hsa-miR-1-3p DOLPP1 dolichyldiphosphatase 1 HGNC:29565 details
hsa-miR-1-3p CXCL1 C-X-C motif chemokine ligand 1 HGNC:4602 details
hsa-miR-1-3p KCNN4 potassium calcium-activated channel subfamily N member 4 HGNC:6293 details
hsa-miR-1-3p FILIP1 filamin A interacting protein 1 HGNC:21015 details
hsa-miR-1-3p PPP1R16A protein phosphatase 1 regulatory subunit 16A HGNC:14941 details
hsa-miR-1-3p MAST4 microtubule associated serine/threonine kinase family member 4 HGNC:19037 details
hsa-miR-1-3p ISG20 interferon stimulated exonuclease gene 20 HGNC:6130 details
hsa-miR-1-3p details
hsa-miR-1-3p UGGT1 UDP-glucose glycoprotein glucosyltransferase 1 HGNC:15663 details
hsa-miR-1-3p RAB39B RAB39B, member RAS oncogene family HGNC:16499 details
hsa-miR-1-3p HSD3B7 hydroxy-delta-5-steroid dehydrogenase, 3 beta- and steroid delta-isomerase 7 HGNC:18324 details
hsa-miR-1-3p details
hsa-miR-1-3p MMS22L MMS22 like, DNA repair protein HGNC:21475 details
hsa-miR-1-3p COTL1 coactosin like F-actin binding protein 1 HGNC:18304 details
hsa-miR-1-3p HNRNPD heterogeneous nuclear ribonucleoprotein D HGNC:5036 details
hsa-miR-1-3p F2 coagulation factor II, thrombin HGNC:3535 details
hsa-miR-1-3p C12orf40 chromosome 12 open reading frame 40 HGNC:26846 details
hsa-miR-1-3p BRPF3 bromodomain and PHD finger containing 3 HGNC:14256 details
hsa-miR-1-3p TRIM24 tripartite motif containing 24 HGNC:11812 details
hsa-miR-1-3p GATA3 GATA binding protein 3 HGNC:4172 details
hsa-miR-1-3p SEMA4D semaphorin 4D HGNC:10732 details
hsa-miR-1-3p POLRMT RNA polymerase mitochondrial HGNC:9200 details
hsa-miR-1-3p TIGD4 tigger transposable element derived 4 HGNC:18335 details
hsa-miR-1-3p SRSF5 serine and arginine rich splicing factor 5 HGNC:10787 details
hsa-miR-1-3p IMPDH1 inosine monophosphate dehydrogenase 1 HGNC:6052 details
hsa-miR-1-3p IFIT1 interferon induced protein with tetratricopeptide repeats 1 HGNC:5407 details
hsa-miR-1-3p RBM28 RNA binding motif protein 28 HGNC:21863 details
hsa-miR-1-3p CCDC102A coiled-coil domain containing 102A HGNC:28097 details
hsa-miR-1-3p KIF2C kinesin family member 2C HGNC:6393 details
hsa-miR-1-3p CTBP1 C-terminal binding protein 1 HGNC:2494 details
hsa-miR-1-3p MCM6 minichromosome maintenance complex component 6 HGNC:6949 details
hsa-miR-1-3p GTF2H1 general transcription factor IIH subunit 1 HGNC:4655 details
hsa-miR-1-3p FRMD7 FERM domain containing 7 HGNC:8079 details
hsa-miR-1-3p CBX2 chromobox 2 HGNC:1552 details
hsa-miR-1-3p TKT transketolase HGNC:11834 details
hsa-miR-1-3p LRRC8B leucine rich repeat containing 8 VRAC subunit B HGNC:30692 details
hsa-miR-1-3p CCDC180 coiled-coil domain containing 180 HGNC:29303 details
hsa-miR-1-3p RSF1 remodeling and spacing factor 1 HGNC:18118 details
hsa-miR-1-3p TBC1D9 TBC1 domain family member 9 HGNC:21710 details
hsa-miR-1-3p IPO9 importin 9 HGNC:19425 details
hsa-miR-1-3p HNRNPA1 heterogeneous nuclear ribonucleoprotein A1 HGNC:5031 details
hsa-miR-1-3p KIAA1522 KIAA1522 HGNC:29301 details
hsa-miR-1-3p UBR5 ubiquitin protein ligase E3 component n-recognin 5 HGNC:16806 details
hsa-miR-1-3p KDM2B lysine demethylase 2B HGNC:13610 details
hsa-miR-1-3p HP1BP3 heterochromatin protein 1 binding protein 3 HGNC:24973 details
hsa-miR-1-3p CDC42SE1 CDC42 small effector 1 HGNC:17719 details
hsa-miR-1-3p UNC119B unc-119 lipid binding chaperone B HGNC:16488 details
hsa-miR-1-3p CEBPZ CCAAT enhancer binding protein zeta HGNC:24218 details
hsa-miR-1-3p CCDC170 coiled-coil domain containing 170 HGNC:21177 details
hsa-miR-1-3p HNRNPA3 heterogeneous nuclear ribonucleoprotein A3 HGNC:24941 details
hsa-miR-1-3p UBAC2 UBA domain containing 2 HGNC:20486 details
hsa-miR-1-3p CALM3 calmodulin 3 HGNC:1449 details
hsa-miR-1-3p LGALS3BP galectin 3 binding protein HGNC:6564 details
hsa-miR-1-3p DCAKD dephospho-CoA kinase domain containing HGNC:26238 details
hsa-miR-1-3p COL12A1 collagen type XII alpha 1 chain HGNC:2188 details
hsa-miR-1-3p ABCC1 ATP binding cassette subfamily C member 1 HGNC:51 details
hsa-miR-1-3p CAMK2G calcium/calmodulin dependent protein kinase II gamma HGNC:1463 details
hsa-miR-1-3p DBN1 drebrin 1 HGNC:2695 details
hsa-miR-1-3p CALM1 calmodulin 1 HGNC:1442 details
hsa-miR-1-3p RPRD2 regulation of nuclear pre-mRNA domain containing 2 HGNC:29039 details
hsa-miR-1-3p ARPC5 actin related protein 2/3 complex subunit 5 HGNC:708 details
hsa-miR-1-3p RGS17 regulator of G protein signaling 17 HGNC:14088 details
hsa-miR-1-3p CCL2 C-C motif chemokine ligand 2 HGNC:10618 details
hsa-miR-1-3p SLC39A3 solute carrier family 39 member 3 HGNC:17128 details
hsa-miR-1-3p SEC16A SEC16 homolog A, endoplasmic reticulum export factor HGNC:29006 details
hsa-miR-1-3p ESYT1 extended synaptotagmin 1 HGNC:29534 details
hsa-miR-1-3p ISY1 ISY1 splicing factor homolog HGNC:29201 details
hsa-miR-1-3p TBCD tubulin folding cofactor D HGNC:11581 details
hsa-miR-1-3p NBL1 NBL1, DAN family BMP antagonist HGNC:7650 details
hsa-miR-1-3p TELO2 telomere maintenance 2 HGNC:29099 details
hsa-miR-1-3p ATP13A1 ATPase 13A1 HGNC:24215 details
hsa-miR-1-3p PLXNB2 plexin B2 HGNC:9104 details
hsa-miR-1-3p ZNF638 zinc finger protein 638 HGNC:17894 details
hsa-miR-1-3p ZNF568 zinc finger protein 568 HGNC:25392 details
hsa-miR-1-3p CDH13 cadherin 13 HGNC:1753 details
hsa-miR-1-3p FAM167A family with sequence similarity 167 member A HGNC:15549 details
hsa-miR-1-3p F11R F11 receptor HGNC:14685 details
hsa-miR-1-3p details
hsa-miR-1-3p S100A16 S100 calcium binding protein A16 HGNC:20441 details
hsa-miR-1-3p details
hsa-miR-1-3p SDR39U1 short chain dehydrogenase/reductase family 39U member 1 HGNC:20275 details
hsa-miR-1-3p VAMP7 vesicle associated membrane protein 7 HGNC:11486 details
hsa-miR-1-3p RIN1 Ras and Rab interactor 1 HGNC:18749 details
hsa-miR-1-3p ARG1 arginase 1 HGNC:663 details
hsa-miR-1-3p DDT D-dopachrome tautomerase HGNC:2732 details
hsa-miR-1-3p details
hsa-miR-1-3p FOXN4 forkhead box N4 HGNC:21399 details
hsa-miR-1-3p SFN stratifin HGNC:10773 details
hsa-miR-1-3p AKR1D1 aldo-keto reductase family 1 member D1 HGNC:388 details
hsa-miR-1-3p MYEF2 myelin expression factor 2 HGNC:17940 details
hsa-miR-1-3p RIPK2 receptor interacting serine/threonine kinase 2 HGNC:10020 details
hsa-miR-1-3p L1CAM L1 cell adhesion molecule HGNC:6470 details
hsa-miR-1-3p details
hsa-miR-1-3p FIG4 FIG4 phosphoinositide 5-phosphatase HGNC:16873 details
hsa-miR-1-3p OARD1 O-acyl-ADP-ribose deacylase 1 HGNC:21257 details
hsa-miR-1-3p DDX50 DExD-box helicase 50 HGNC:17906 details
hsa-miR-1-3p details
hsa-miR-1-3p ARGLU1 arginine and glutamate rich 1 HGNC:25482 details
hsa-miR-1-3p details
hsa-miR-1-3p details
hsa-miR-1-3p RXFP1 relaxin family peptide receptor 1 HGNC:19718 details
hsa-miR-1-3p SSR1 signal sequence receptor subunit 1 HGNC:11323 details
hsa-miR-1-3p MIER1 MIER1 transcriptional regulator HGNC:29657 details
hsa-miR-1-3p MAP4K2 mitogen-activated protein kinase kinase kinase kinase 2 HGNC:6864 details
hsa-miR-1-3p ACTB actin beta HGNC:132 details
hsa-miR-1-3p TRA2B transformer 2 beta homolog HGNC:10781 details
hsa-miR-1-3p CSNK2A2 casein kinase 2 alpha 2 HGNC:2459 details
hsa-miR-1-3p ANP32E acidic nuclear phosphoprotein 32 family member E HGNC:16673 details
hsa-miR-1-3p G3BP1 G3BP stress granule assembly factor 1 HGNC:30292 details
hsa-miR-1-3p THY1 Thy-1 cell surface antigen HGNC:11801 details
hsa-miR-1-3p CDH2 cadherin 2 HGNC:1759 details
hsa-miR-1-3p details
hsa-miR-1-3p FLNC filamin C HGNC:3756 details
hsa-miR-1-3p CDK4 cyclin dependent kinase 4 HGNC:1773 details
hsa-miR-1-3p CRIP2 cysteine rich protein 2 HGNC:2361 details
hsa-miR-1-3p EPB41L2 erythrocyte membrane protein band 4.1 like 2 HGNC:3379 details
hsa-miR-1-3p SP1 Sp1 transcription factor HGNC:11205 details
hsa-miR-1-3p FBXO22 F-box protein 22 HGNC:13593 details
hsa-miR-1-3p SOS2 SOS Ras/Rho guanine nucleotide exchange factor 2 HGNC:11188 details
hsa-miR-1-3p ETS1 ETS proto-oncogene 1, transcription factor HGNC:3488 details
hsa-miR-1-3p FASN fatty acid synthase HGNC:3594 details
hsa-miR-1-3p PIK3CA phosphatidylinositol-4,5-bisphosphate 3-kinase catalytic subunit alpha HGNC:8975 details
hsa-miR-1-3p ASXL2 ASXL transcriptional regulator 2 HGNC:23805 details
hsa-miR-1-3p C8A complement C8 alpha chain HGNC:1352 details
hsa-miR-1-3p details
hsa-miR-1-3p RIMS4 regulating synaptic membrane exocytosis 4 HGNC:16183 details
hsa-miR-1-3p FGD4 FYVE, RhoGEF and PH domain containing 4 HGNC:19125 details
hsa-miR-1-3p TOX4 TOX high mobility group box family member 4 HGNC:20161 details
hsa-miR-1-3p STAMBP STAM binding protein HGNC:16950 details
hsa-miR-1-3p NT5C1B-RDH14 NT5C1B-RDH14 readthrough HGNC:38831 details
hsa-miR-1-3p PPP2R1B protein phosphatase 2 scaffold subunit Abeta HGNC:9303 details
hsa-miR-1-3p PSMA7 proteasome 20S subunit alpha 7 HGNC:9536 details
hsa-miR-1-3p CHML CHM like Rab escort protein HGNC:1941 details
hsa-miR-1-3p SALL2 spalt like transcription factor 2 HGNC:10526 details
hsa-miR-1-3p MRPS27 mitochondrial ribosomal protein S27 HGNC:14512 details
hsa-miR-1-3p WEE1 WEE1 G2 checkpoint kinase HGNC:12761 details
hsa-miR-1-3p WBP2 WW domain binding protein 2 HGNC:12738 details
hsa-miR-1-3p STX6 syntaxin 6 HGNC:11441 details
hsa-miR-1-3p RGP1 RGP1 homolog, RAB6A GEF complex partner 1 HGNC:21965 details
hsa-miR-1-3p TSPAN1 tetraspanin 1 HGNC:20657 details
hsa-miR-1-3p EIF1AX eukaryotic translation initiation factor 1A X-linked HGNC:3250 details
hsa-miR-1-3p DDX19B DEAD-box helicase 19B HGNC:2742 details
hsa-miR-1-3p BSCL2 BSCL2 lipid droplet biogenesis associated, seipin HGNC:15832 details
hsa-miR-1-3p SMKR1 small lysine rich protein 1 HGNC:43561 details
hsa-miR-1-3p ANK1 ankyrin 1 HGNC:492 details
hsa-miR-1-3p RAB5C RAB5C, member RAS oncogene family HGNC:9785 details
hsa-miR-1-3p NFAT5 nuclear factor of activated T cells 5 HGNC:7774 details
hsa-miR-1-3p CRK CRK proto-oncogene, adaptor protein HGNC:2362 details
hsa-miR-1-3p ARPP19 cAMP regulated phosphoprotein 19 HGNC:16967 details
hsa-miR-1-3p ZCCHC3 zinc finger CCHC-type containing 3 HGNC:16230 details
hsa-miR-1-3p TFAM transcription factor A, mitochondrial HGNC:11741 details
hsa-miR-1-3p VSTM5 V-set and transmembrane domain containing 5 HGNC:34443 details
hsa-miR-1-3p SULT1B1 sulfotransferase family 1B member 1 HGNC:17845 details
hsa-miR-1-3p NUDT21 nudix hydrolase 21 HGNC:13870 details
hsa-miR-1-3p C5orf51 chromosome 5 open reading frame 51 HGNC:27750 details
hsa-miR-1-3p KLF13 Kruppel like factor 13 HGNC:13672 details
hsa-miR-1-3p LRRC59 leucine rich repeat containing 59 HGNC:28817 details
hsa-miR-1-3p ZNF215 zinc finger protein 215 HGNC:13007 details
hsa-miR-1-3p ZBED3 zinc finger BED-type containing 3 HGNC:20711 details
hsa-miR-1-3p QSER1 glutamine and serine rich 1 HGNC:26154 details
hsa-miR-1-3p FAM216B family with sequence similarity 216 member B HGNC:26883 details
hsa-miR-1-3p details
hsa-miR-1-3p FYB1 FYN binding protein 1 HGNC:4036 details
hsa-miR-1-3p SRP19 signal recognition particle 19 HGNC:11300 details
hsa-miR-1-3p PLAGL2 PLAG1 like zinc finger 2 HGNC:9047 details
hsa-miR-1-3p ZNF185 zinc finger protein 185 with LIM domain HGNC:12976 details
hsa-miR-1-3p ALPI alkaline phosphatase, intestinal HGNC:437 details
hsa-miR-1-3p TM4SF1 transmembrane 4 L six family member 1 HGNC:11853 details
hsa-miR-1-3p STX12 syntaxin 12 HGNC:11430 details
hsa-miR-1-3p ZNF79 zinc finger protein 79 HGNC:13153 details
hsa-miR-1-3p SPTLC3 serine palmitoyltransferase long chain base subunit 3 HGNC:16253 details
hsa-miR-1-3p details
hsa-miR-1-3p details
hsa-miR-1-3p FRS2 fibroblast growth factor receptor substrate 2 HGNC:16971 details
hsa-miR-1-3p FZD7 frizzled class receptor 7 HGNC:4045 details
hsa-miR-1-3p AGO1 argonaute RISC component 1 HGNC:3262 details
hsa-miR-1-3p details
hsa-miR-1-3p TH tyrosine hydroxylase HGNC:11782 details
hsa-miR-1-3p MPL MPL proto-oncogene, thrombopoietin receptor HGNC:7217 details
hsa-miR-1-3p API5 apoptosis inhibitor 5 HGNC:594 details
hsa-miR-1-3p SPRED1 sprouty related EVH1 domain containing 1 HGNC:20249 details
hsa-miR-1-3p ASPH aspartate beta-hydroxylase HGNC:757 details
hsa-miR-1-3p RARB retinoic acid receptor beta HGNC:9865 details
hsa-miR-1-3p KRAS KRAS proto-oncogene, GTPase HGNC:6407 details
hsa-miR-1-3p NAIP NLR family apoptosis inhibitory protein HGNC:7634 details
hsa-miR-1-3p VEGFA vascular endothelial growth factor A HGNC:12680 details
hsa-miR-1-3p BAG4 BAG cochaperone 4 HGNC:940 details
hsa-miR-1-3p ABCB1 ATP binding cassette subfamily B member 1 HGNC:40 details
hsa-miR-1-3p TWIST1 twist family bHLH transcription factor 1 HGNC:12428 details
hsa-miR-1-3p TNKS2 tankyrase 2 HGNC:15677 details
hsa-miR-1-3p CXCL12 C-X-C motif chemokine ligand 12 HGNC:10672 details
hsa-miR-1-3p PRR14L proline rich 14 like HGNC:28738 details
hsa-miR-1-3p STK35 serine/threonine kinase 35 HGNC:16254 details
hsa-miR-1-3p ZBTB20 zinc finger and BTB domain containing 20 HGNC:13503 details
hsa-miR-1-3p BCL7B BAF chromatin remodeling complex subunit BCL7B HGNC:1005 details
hsa-miR-1-3p CAPZA1 capping actin protein of muscle Z-line subunit alpha 1 HGNC:1488 details
hsa-miR-1-3p COQ7 coenzyme Q7, hydroxylase HGNC:2244 details
hsa-miR-1-3p EXOSC2 exosome component 2 HGNC:17097 details
hsa-miR-1-3p NDUFS1 NADH:ubiquinone oxidoreductase core subunit S1 HGNC:7707 details
hsa-miR-1-3p ABI2 abl interactor 2 HGNC:24011 details
hsa-miR-1-3p CREB3L2 cAMP responsive element binding protein 3 like 2 HGNC:23720 details
hsa-miR-1-3p TRIM56 tripartite motif containing 56 HGNC:19028 details
hsa-miR-1-3p DLK1 delta like non-canonical Notch ligand 1 HGNC:2907 details
© 2021 Arieh Warshel Institute of Computational Biology, CUHK(SZ) | Designed by : Biomics Lab