miRNA Card

miRNA General Information
miRNA ID hsa-miR-1-5p
Description Homo sapiens miR-1-1 stem-loop
Comment Lagos-Quintana et al. [1] reported the cloning of miR-1b, miR-1c and miR-1d. The mature processed miR sequences are identical apart from the 3' residues (A in mir-1b, C in mir-1c and UU in mir-1d). The 3' residues of both miR-1b and miR-1c conflict with the predicted stem-loop precursor sequence shown here and these sequences are not found in current assemblies of human and mouse genomes. It is suggested that polyA polymerase may add 1-3 nts to the 3' end of the mature transcript (Tom Tuschl, pers. comm.). The common 21 nts of the 3 reported miR sequences have been rationalised here and named miR-1. There are 2 pairs of orthologous putative hairpin precursor structures named mir-1-1 (human MIR:MI0000651, mouse MIR:MI0000139), and mir-1-2 (human MIR:MI0000437, mouse MIR:MI0000652). The mature sequence shown here represents the most commonly cloned form from large-scale cloning studies [2].
Experiment
Sequence ACAUACUUCUUUAUAUGCCCAU
miRNA Expression in different cancers

    by mir_boxplot.py

circRNA-miRNA-gene regulatory network

Note about Netwrok:
This is a network diagram with miRNA (purple circle) as the center.
We used three tools(PITA, miRanda, targetScan) to predict the binding sites of circrna (green circle) and miRNA. Accordingly, for this miRNA that binds to circrna, we have three confidence levels, namely confident 1, confident 2 and confident 3. Confidence value indicates how many tools can deduce these results. For each confidence, we use different kinds of dashed lines.

Target circRNA with confidence

Confidence 3 (3 of 3 tools predicted)

CircID miRNA PITA miRanda targetScan

Confidence 1 (1 of 3 tools predicted)

CircID miRNA PITA miRanda targetScan
chr1:67412042|67412164 hsa-miR-1-5p 1 0 0
chr14:94622383|94622491 hsa-miR-1-5p 0 1 0
chr22:18088430|18088547 hsa-miR-1-5p 0 1 0
chr14:94622383|94622482 hsa-miR-1-5p 0 1 0
chr11:102772847|102772998 hsa-miR-1-5p 0 1 0
chr14:94622343|94622491 hsa-miR-1-5p 0 1 0
chr12:53063197|53063387 hsa-miR-1-5p 0 1 0
chr16:20309260|20309404 hsa-miR-1-5p 0 1 0
chr16:68226970|68227153 hsa-miR-1-5p 0 1 0
chr2:127070553|127070795 hsa-miR-1-5p 0 1 0
chr14:94622341|94622491 hsa-miR-1-5p 0 1 0
chr14:94622349|94622491 hsa-miR-1-5p 0 1 0
chr14:94622354|94622491 hsa-miR-1-5p 0 1 0
chr14:105708053|105708395 hsa-miR-1-5p 0 1 0
chr13:40557584|40557696 hsa-miR-1-5p 0 1 0
chr14:105708053|105708398 hsa-miR-1-5p 0 1 0
chr11:6614053|6614185 hsa-miR-1-5p 1 0 0
chr1:164846731|164846968 hsa-miR-1-5p 1 0 0
chr1:164846738|164846968 hsa-miR-1-5p 1 0 0
chr1:13780701|13780845 hsa-miR-1-5p 1 0 0
chr3:49015721|49015821 hsa-miR-1-5p 1 0 0
chr2:190934051|190934171 hsa-miR-1-5p 1 0 0
chr14:90871991|90872199 hsa-miR-1-5p 1 0 0
chr16:3963599|3963763 hsa-miR-1-5p 1 0 0
chr14:94619323|94622491 hsa-miR-1-5p 0 1 0
chr1:43971456|43971601 hsa-miR-1-5p 0 1 0
chr1:6223724|6223879 hsa-miR-1-5p 0 1 0
chr1:178458236|178458423 hsa-miR-1-5p 0 1 0
chrX:41232444|41232597 hsa-miR-1-5p 0 1 0
chr14:105708074|105708414 hsa-miR-1-5p 0 1 0
chr17:81823286|81823490 hsa-miR-1-5p 0 1 0
chr14:105708106|105708468 hsa-miR-1-5p 0 1 0
chr1:164848649|164848777 hsa-miR-1-5p 0 1 0
chr11:72697140|72697401 hsa-miR-1-5p 0 1 0
chr14:105708053|105708407 hsa-miR-1-5p 0 1 0
chr5:140445811|140445909 hsa-miR-1-5p 0 1 0
chr2:215419250|215419383 hsa-miR-1-5p 0 1 0
chr1:40059337|40059431 hsa-miR-1-5p 0 1 0
chr14:94622383~94622491 hsa-miR-1-5p 0 1 0
chr14:94622349~94622491 hsa-miR-1-5p 0 1 0
chr14:94622343~94622491 hsa-miR-1-5p 0 1 0
chr14:94622383~94622482 hsa-miR-1-5p 0 1 0
chr14:94622345~94622491 hsa-miR-1-5p 0 1 0
chr1:43971425~43971601 hsa-miR-1-5p 0 1 0
chr1:151537973~151538084 hsa-miR-1-5p 0 1 0
chr14:105708044~105708407 hsa-miR-1-5p 0 1 0
chr2:43485234~43485325 hsa-miR-1-5p 0 1 0
chr2:73074974~73075249 hsa-miR-1-5p 0 1 0
chr1:161123860~161124177 hsa-miR-1-5p 0 1 0
chr14:94622354~94622491 hsa-miR-1-5p 0 1 0
chr14:94622341~94622491 hsa-miR-1-5p 0 1 0
chr14:105708053~105708395 hsa-miR-1-5p 0 1 0
chr11:18506900~18509659 hsa-miR-1-5p 0 1 0
chr20:25020033~25020131 hsa-miR-1-5p 0 1 0
chr6:6145407|6145751 hsa-miR-1-5p 0 1 0
chr5:173318747~173318915 hsa-miR-1-5p 0 1 0
chr17:40171358|40171516 hsa-miR-1-5p 1 0 0
chr2:27026826|27026969 hsa-miR-1-5p 1 0 0
chr12:55834961|55835203 hsa-miR-1-5p 0 1 0
chr2:27382135|27382531 hsa-miR-1-5p 0 1 0
chr12:56311242|56311387 hsa-miR-1-5p 0 1 0
chr12:55835086|55835203 hsa-miR-1-5p 0 1 0
chr15:75497285|75497421 hsa-miR-1-5p 0 1 0
chr3:52524195|52524400 hsa-miR-1-5p 0 1 0
chr19:1611611|1611841 hsa-miR-1-5p 0 1 0
chr1:16638091|16638281 hsa-miR-1-5p 0 1 0
chrX:71103117|71103251 hsa-miR-1-5p 0 1 0
chr12:56719093|56719279 hsa-miR-1-5p 0 1 0
chr17:51526589|51526755 hsa-miR-1-5p 0 1 0
chr19:24050913|24051153 hsa-miR-1-5p 0 1 0
chr2:28415765|28415967 hsa-miR-1-5p 1 0 0
chr1:26183197|26183414 hsa-miR-1-5p 1 0 0
chr9:3827082|3827209 hsa-miR-1-5p 1 0 0
chr9:3827076|3827277 hsa-miR-1-5p 1 0 0
chr2:190934051|190934187 hsa-miR-1-5p 1 0 0
chr17:7512894|7513201 hsa-miR-1-5p 1 0 0
chr2:190934051|190934189 hsa-miR-1-5p 1 0 0
chr11:6614053|6614248 hsa-miR-1-5p 1 0 0
chr15:43403643|43403875 hsa-miR-1-5p 0 1 0
chr2:73075031|73075217 hsa-miR-1-5p 0 1 0
chr19:10285720|10285935 hsa-miR-1-5p 0 1 0
chr16:68021735|68021895 hsa-miR-1-5p 0 1 0
chr14:105708053|105708393 hsa-miR-1-5p 0 1 0
chr10:43556272|43556486 hsa-miR-1-5p 0 1 0
chr1:151537965|151538168 hsa-miR-1-5p 0 1 0
chr2:127070553|127076643 hsa-miR-1-5p 0 1 0
chr22:18088397|18088551 hsa-miR-1-5p 0 1 0
chr11:102772847|102772982 hsa-miR-1-5p 0 1 0
chr14:105708044|105708393 hsa-miR-1-5p 0 1 0
chr14:105708087|105708407 hsa-miR-1-5p 0 1 0
chr14:105708053|105708414 hsa-miR-1-5p 0 1 0
chr2:215419250|215419363 hsa-miR-1-5p 0 1 0
chr12:74539307|74539400 hsa-miR-1-5p 0 1 0
chr14:105708074|105708407 hsa-miR-1-5p 0 1 0
chr14:24185908|24186182 hsa-miR-1-5p 0 1 0
chr1:32321920|32322235 hsa-miR-1-5p 0 1 0
chr14:94622343|94622482 hsa-miR-1-5p 0 1 0
chr16:3486233|3486498 hsa-miR-1-5p 0 1 0
chr12:57796183|57796349 hsa-miR-1-5p 0 1 0
chr14:105708044|105708395 hsa-miR-1-5p 0 1 0
chr3:52199221|52202529 hsa-miR-1-5p 0 1 0
chr14:94622345|94622491 hsa-miR-1-5p -8 1 0
chr1:45002628|45002856 hsa-miR-1-5p 1 0 0
chr11:6614053|6614126 hsa-miR-1-5p 1 0 0
chr12:14696429|14696596 hsa-miR-1-5p 1 0 0
chr12:119681307|119681430 hsa-miR-1-5p 0 1 0
chr7:92104982|92105167 hsa-miR-1-5p 0 1 0
chr11:18506900|18509560 hsa-miR-1-5p 0 1 0
chr1:178458236|178458465 hsa-miR-1-5p 0 1 0
chr16:68021721|68021895 hsa-miR-1-5p 0 1 0
chr2:215419250|215419357 hsa-miR-1-5p 0 1 0
chrX:153350441|153350652 hsa-miR-1-5p 0 1 0
chr12:132623823|132623997 hsa-miR-1-5p 0 1 0
chr1:43971425|43971601 hsa-miR-1-5p 0 1 0
chr3:42536568|42536723 hsa-miR-1-5p 0 1 0
chr1:151537965|151538084 hsa-miR-1-5p 0 1 0
chr14:105708044|105708414 hsa-miR-1-5p 0 1 0
chr1:43971425|43971648 hsa-miR-1-5p 0 1 0
chr11:71478993|71479193 hsa-miR-1-5p 0 1 0
chr12:120211165|120211333 hsa-miR-1-5p 0 1 0
chr12:1952739|1952884 hsa-miR-1-5p 0 1 0
chr20:50583935|50584056 hsa-miR-1-5p 0 1 0
chr3:42536485|42536665 hsa-miR-1-5p 0 1 0
chr14:23354185|23354390 hsa-miR-1-5p 1 0 0
chr9:3827082|3827253 hsa-miR-1-5p 1 0 0
chr1:1228762|1228863 hsa-miR-1-5p 1 0 0
chr2:28415826|28415967 hsa-miR-1-5p 1 0 0
chr5:175881469|175881652 hsa-miR-1-5p 1 0 0
chr17:7512894|7513173 hsa-miR-1-5p 1 0 0
chr2:190934051|190934214 hsa-miR-1-5p 1 0 0
Target genes
miRNA Gene Gene Description HGNC ID details
hsa-miR-1-5p TNRC6B trinucleotide repeat containing adaptor 6B HGNC:29190 details
hsa-miR-1-5p PIGM phosphatidylinositol glycan anchor biosynthesis class M HGNC:18858 details
hsa-miR-1-5p RPN2 ribophorin II HGNC:10382 details
hsa-miR-1-5p G3BP1 G3BP stress granule assembly factor 1 HGNC:30292 details
hsa-miR-1-5p MZT1 mitotic spindle organizing protein 1 HGNC:33830 details
hsa-miR-1-5p NAPEPLD N-acyl phosphatidylethanolamine phospholipase D HGNC:21683 details
hsa-miR-1-5p ZNF138 zinc finger protein 138 HGNC:12922 details
hsa-miR-1-5p MTPAP mitochondrial poly(A) polymerase HGNC:25532 details
hsa-miR-1-5p TCF7L2 transcription factor 7 like 2 HGNC:11641 details
hsa-miR-1-5p CMBL carboxymethylenebutenolidase homolog HGNC:25090 details
hsa-miR-1-5p RTP4 receptor transporter protein 4 HGNC:23992 details
hsa-miR-1-5p CHAF1B chromatin assembly factor 1 subunit B HGNC:1911 details
hsa-miR-1-5p PRKAA1 protein kinase AMP-activated catalytic subunit alpha 1 HGNC:9376 details
hsa-miR-1-5p DDHD2 DDHD domain containing 2 HGNC:29106 details
hsa-miR-1-5p details
hsa-miR-1-5p SEC14L5 SEC14 like lipid binding 5 HGNC:29032 details
hsa-miR-1-5p DDTL D-dopachrome tautomerase like HGNC:33446 details
hsa-miR-1-5p RPS6KA5 ribosomal protein S6 kinase A5 HGNC:10434 details
hsa-miR-1-5p PRPF40A pre-mRNA processing factor 40 homolog A HGNC:16463 details
hsa-miR-1-5p WEE1 WEE1 G2 checkpoint kinase HGNC:12761 details
hsa-miR-1-5p HSBP1 heat shock factor binding protein 1 HGNC:5203 details
hsa-miR-1-5p CDKN2AIP CDKN2A interacting protein HGNC:24325 details
hsa-miR-1-5p SLC7A11 solute carrier family 7 member 11 HGNC:11059 details
hsa-miR-1-5p LONRF1 LON peptidase N-terminal domain and ring finger 1 HGNC:26302 details
hsa-miR-1-5p CNOT6L CCR4-NOT transcription complex subunit 6 like HGNC:18042 details
hsa-miR-1-5p POTEG POTE ankyrin domain family member G HGNC:33896 details
hsa-miR-1-5p HMGN5 high mobility group nucleosome binding domain 5 HGNC:8013 details
hsa-miR-1-5p USF3 upstream transcription factor family member 3 HGNC:30494 details
hsa-miR-1-5p GALM galactose mutarotase HGNC:24063 details
hsa-miR-1-5p KCNK5 potassium two pore domain channel subfamily K member 5 HGNC:6280 details
hsa-miR-1-5p SRFBP1 serum response factor binding protein 1 HGNC:26333 details
hsa-miR-1-5p HOXA13 homeobox A13 HGNC:5102 details
hsa-miR-1-5p C9orf64 chromosome 9 open reading frame 64 HGNC:28144 details
hsa-miR-1-5p HNRNPC heterogeneous nuclear ribonucleoprotein C HGNC:5035 details
hsa-miR-1-5p C2CD2L C2CD2 like HGNC:29000 details
hsa-miR-1-5p UCHL5 ubiquitin C-terminal hydrolase L5 HGNC:19678 details
hsa-miR-1-5p INSIG1 insulin induced gene 1 HGNC:6083 details
hsa-miR-1-5p CRAMP1 cramped chromatin regulator homolog 1 HGNC:14122 details
hsa-miR-1-5p ABHD15 abhydrolase domain containing 15 HGNC:26971 details
hsa-miR-1-5p GRHL1 grainyhead like transcription factor 1 HGNC:17923 details
hsa-miR-1-5p BDNF brain derived neurotrophic factor HGNC:1033 details
hsa-miR-1-5p VEGFA vascular endothelial growth factor A HGNC:12680 details
hsa-miR-1-5p LASP1 LIM and SH3 protein 1 HGNC:6513 details
hsa-miR-1-5p TAGLN2 transgelin 2 HGNC:11554 details
hsa-miR-1-5p CDK4 cyclin dependent kinase 4 HGNC:1773 details
hsa-miR-1-5p CDK6 cyclin dependent kinase 6 HGNC:1777 details
hsa-miR-1-5p CAPRIN1 cell cycle associated protein 1 HGNC:6743 details
hsa-miR-1-5p CXCL12 C-X-C motif chemokine ligand 12 HGNC:10672 details
hsa-miR-1-5p EGFR epidermal growth factor receptor HGNC:3236 details
hsa-miR-1-5p MET MET proto-oncogene, receptor tyrosine kinase HGNC:7029 details
hsa-miR-1-5p PDE7A phosphodiesterase 7A HGNC:8791 details
hsa-miR-1-5p details
hsa-miR-1-5p AAGAB alpha and gamma adaptin binding protein HGNC:25662 details
hsa-miR-1-5p IDE insulin degrading enzyme HGNC:5381 details
hsa-miR-1-5p SCYL3 SCY1 like pseudokinase 3 HGNC:19285 details
hsa-miR-1-5p ZNF286B zinc finger protein 286B (pseudogene) HGNC:33241 details
© 2021 Arieh Warshel Institute of Computational Biology, CUHK(SZ) | Designed by : Biomics Lab