miRNA Card

miRNA General Information
miRNA ID hsa-miR-101-3p
Description Homo sapiens miR-101-1 stem-loop
Comment Reference [1] reports two miR-101 precursor hairpin structures in human, on chromosome 1 (MIR:MI0000103) and 9 (MIR:MI0000739, named mir-101-precursor-9 in [1]). The mature sequence shown here represents the most commonly cloned form from large-scale cloning studies [3].
Experiment cloned [1-4]
Sequence UACAGUACUGUGAUAACUGAA
miRNA Expression in different cancers

    by mir_boxplot.py

circRNA-miRNA-gene regulatory network

Note about Netwrok:
This is a network diagram with miRNA (purple circle) as the center.
We used three tools(PITA, miRanda, targetScan) to predict the binding sites of circrna (green circle) and miRNA. Accordingly, for this miRNA that binds to circrna, we have three confidence levels, namely confident 1, confident 2 and confident 3. Confidence value indicates how many tools can deduce these results. For each confidence, we use different kinds of dashed lines.

Target circRNA with confidence

Confidence 3 (3 of 3 tools predicted)

CircID miRNA PITA miRanda targetScan

Confidence 2 (2 of 3 tools predicted)

Confidence 1 (1 of 3 tools predicted)

CircID miRNA PITA miRanda targetScan
chr10:37294962|37295103 hsa-miR-101-3p 0 1 0
chr7:151235379|151235534 hsa-miR-101-3p 0 1 0
chr12:110719950|110720063 hsa-miR-101-3p 0 1 0
chr5:151663467|151663585 hsa-miR-101-3p 0 1 0
chr3:121693927|121694038 hsa-miR-101-3p 0 1 0
chr4:105682943|105683076 hsa-miR-101-3p 0 1 0
chr12:48767815|48767944 hsa-miR-101-3p 0 1 0
chr19:56525272|56525355 hsa-miR-101-3p 0 1 0
chr11:64242382|64242477 hsa-miR-101-3p 0 1 0
chr3:42647549|42647687 hsa-miR-101-3p 0 1 0
chr22:24322194|24322306 hsa-miR-101-3p 0 1 0
chr20:5544799|5544985 hsa-miR-101-3p 0 1 0
chr12:48767815|48767889 hsa-miR-101-3p 0 1 0
chr6:7889495|7889581 hsa-miR-101-3p 0 1 0
chr1:153661241|153661475 hsa-miR-101-3p 0 1 0
chr2:75717883|75718208 hsa-miR-101-3p 0 1 0
chr17:2324253|2324374 hsa-miR-101-3p 0 1 0
chr2:241352040|241352167 hsa-miR-101-3p 0 1 0
chr5:132829666|132829828 hsa-miR-101-3p 0 1 0
chr2:60794855|60795155 hsa-miR-101-3p 0 1 0
chr7:40094397|40094684 hsa-miR-101-3p 0 1 0
chr2:70087841|70088093 hsa-miR-101-3p 0 1 0
chr10:32010843|32011032 hsa-miR-101-3p 0 1 0
chr12:110719950|110720074 hsa-miR-101-3p 0 1 0
chr2:216675473|216675593 hsa-miR-101-3p 0 1 0
chr17:45023371|45023549 hsa-miR-101-3p 0 1 0
chr14:23564058|23564177 hsa-miR-101-3p 0 1 0
chr16:27779753|27779910 hsa-miR-101-3p 0 1 0
chr2:70087817|70088095 hsa-miR-101-3p 0 1 0
chr14:102027426|102027717 hsa-miR-101-3p 0 1 0
chrX:71574554|71574683 hsa-miR-101-3p 0 1 0
chr3:30672057|30672187 hsa-miR-101-3p 0 1 0
chr12:110719947|110720063 hsa-miR-101-3p 0 1 0
chr4:105682943~105683076 hsa-miR-101-3p 0 1 0
chr12:48767815~48767929 hsa-miR-101-3p 0 1 0
chr12:48767815~48767944 hsa-miR-101-3p 0 1 0
chr22:24322194~24322306 hsa-miR-101-3p 0 1 0
chr15:64867235~64867380 hsa-miR-101-3p 0 1 0
chr5:135444403~135444577 hsa-miR-101-3p 0 1 0
chr2:70087867~70088093 hsa-miR-101-3p 0 1 0
chr2:70087841~70088093 hsa-miR-101-3p 0 1 0
chr5:134741092|134741202 hsa-miR-101-3p 0 1 0
chr17:2324265~2324374 hsa-miR-101-3p 0 1 0
chr3:32003064~32003119 hsa-miR-101-3p 0 1 0
chr6:33201624~33201853 hsa-miR-101-3p 0 1 0
chr17:2324253~2324374 hsa-miR-101-3p 0 1 0
chr22:50627919~50628032 hsa-miR-101-3p 0 1 0
chr10:104028959|104029069 hsa-miR-101-3p 0 1 0
chr12:121916427~121916549 hsa-miR-101-3p 0 1 0
chr2:70087824~70088095 hsa-miR-101-3p 0 1 0
chr11:64242393~64242501 hsa-miR-101-3p 0 1 0
chr19:56525272~56525355 hsa-miR-101-3p 0 1 0
chr5:134741069~134741202 hsa-miR-101-3p 0 1 0
chr11:64242393~64243221 hsa-miR-101-3p 0 1 0
chr3:121693741|121693976 hsa-miR-101-3p 0 1 0
chr16:22239050|22239172 hsa-miR-101-3p 0 1 0
chr18:76897048|76897254 hsa-miR-101-3p 0 1 0
chr17:58279340|58279908 hsa-miR-101-3p 0 1 0
chr4:139717183|139717289 hsa-miR-101-3p 0 1 0
chr6:43515595|43515954 hsa-miR-101-3p 0 1 0
chr20:46684809|46684984 hsa-miR-101-3p 0 1 0
chr15:41811038|41811312 hsa-miR-101-3p 0 1 0
chr2:58162481|58162633 hsa-miR-101-3p 0 1 0
chr20:35004399|35004597 hsa-miR-101-3p 0 1 0
chr6:42842119|42842270 hsa-miR-101-3p 0 1 0
chr2:96594073|96594230 hsa-miR-101-3p 0 1 0
chrX:71298306|71298445 hsa-miR-101-3p 0 1 0
chr17:18061292|18061395 hsa-miR-101-3p 0 1 0
chr22:19117881|19118034 hsa-miR-101-3p 0 1 0
chr19:1474720|1474842 hsa-miR-101-3p 0 1 0
chr17:75503402|75503718 hsa-miR-101-3p 0 1 0
chr1:223548222|223548423 hsa-miR-101-3p 0 1 0
chr2:70087897|70088049 hsa-miR-101-3p 0 1 0
chr2:70087984|70088093 hsa-miR-101-3p 0 1 0
chr2:70087813|70088095 hsa-miR-101-3p 0 1 0
chr8:29798112|29798279 hsa-miR-101-3p 0 1 0
chr11:64242384|64242489 hsa-miR-101-3p 0 1 0
chr6:38061593|38061775 hsa-miR-101-3p 0 1 0
chr1:206652285|206652396 hsa-miR-101-3p 0 1 0
chr1:160214445|160214714 hsa-miR-101-3p 0 1 0
chr12:120721395|120721522 hsa-miR-101-3p 0 1 0
chr12:121916427|121916549 hsa-miR-101-3p 0 1 0
chr5:55941201|55941486 hsa-miR-101-3p 0 1 0
chr11:64242399|64243221 hsa-miR-101-3p 0 1 0
chr17:44011323|44011444 hsa-miR-101-3p 0 1 0
chr3:42647546|42647687 hsa-miR-101-3p 0 1 0
chr22:27983109|27983294 hsa-miR-101-3p 0 1 0
chr12:6330609|6330888 hsa-miR-101-3p 0 1 0
chr2:70087820|70088095 hsa-miR-101-3p 0 1 0
chr8:143926784|143927003 hsa-miR-101-3p 0 1 0
chr17:58490316|58490464 hsa-miR-101-3p 0 1 0
chrX:38687962|38688117 hsa-miR-101-3p 0 1 0
chr15:42283698|42283825 hsa-miR-101-3p 0 1 0
chr16:74912198|74912290 hsa-miR-101-3p 0 1 0
chr2:68807897|68808046 hsa-miR-101-3p 0 1 0
chr1:113585387|113594560 hsa-miR-101-3p 0 1 0
chr3:56592970|56594028 hsa-miR-101-3p 0 1 0
chr4:25676305|25676496 hsa-miR-101-3p 0 1 0
chr14:64934489|64934557 hsa-miR-101-3p 0 1 0
chr2:70087841|70088066 hsa-miR-101-3p 0 1 0
chr6:43621694|43622070 hsa-miR-101-3p 0 1 0
chr14:102027441|102027704 hsa-miR-101-3p 0 1 0
chr2:70087820|70088093 hsa-miR-101-3p 0 1 0
chr3:30672000|30672187 hsa-miR-101-3p 0 1 0
chr2:70087813|70088093 hsa-miR-101-3p 0 1 0
chr3:88055407|88055733 hsa-miR-101-3p 0 1 0
chr10:97333356|97333508 hsa-miR-101-3p 0 1 0
chr11:64242110|64242489 hsa-miR-101-3p 0 1 0
chr1:151117996|151118168 hsa-miR-101-3p 0 1 0
chr6:31163415|31163564 hsa-miR-101-3p 0 1 0
chrX:154358265|154358519 hsa-miR-101-3p 0 1 0
chr17:741899|742056 hsa-miR-101-3p 0 1 0
chr19:1474720|1474818 hsa-miR-101-3p 0 1 0
chr5:140674727|140675101 hsa-miR-101-3p 0 1 0
chr5:140674727|140675107 hsa-miR-101-3p 0 1 0
chr3:42647624|42647772 hsa-miR-101-3p 0 1 0
chrX:38687964|38688122 hsa-miR-101-3p 0 1 0
chr1:93152645|93152903 hsa-miR-101-3p -6 1 0
chr2:32310452|32310617 hsa-miR-101-3p -5 1 0
chr12:48767815|48767929 hsa-miR-101-3p -4 1 0
chr6:43621761|43622109 hsa-miR-101-3p 0 1 0
chr14:64934489|64934654 hsa-miR-101-3p -3 1 0
chr1:150576828|150576957 hsa-miR-101-3p -6 1 0
chr2:96594025|96594186 hsa-miR-101-3p 0 1 0
chr4:70819475|70819590 hsa-miR-101-3p 0 1 0
chr3:121693899|121694026 hsa-miR-101-3p 0 1 0
chr11:10854160|10854382 hsa-miR-101-3p 0 1 0
chr2:205778923|205779064 hsa-miR-101-3p 0 1 0
chr11:94460936|94461030 hsa-miR-101-3p 0 1 0
chr17:49600177|49600306 hsa-miR-101-3p 0 1 0
chr17:741890|742056 hsa-miR-101-3p 0 1 0
chr1:26280896|26281266 hsa-miR-101-3p 0 1 0
chr12:120721417|120721585 hsa-miR-101-3p 0 1 0
chrX:38688021|38688171 hsa-miR-101-3p 0 1 0
chrX:24211029|24211224 hsa-miR-101-3p 0 1 0
chr2:58162481|58162614 hsa-miR-101-3p 0 1 0
chr3:30671989|30672203 hsa-miR-101-3p 0 1 0
chr4:139717180|139717289 hsa-miR-101-3p 0 1 0
chr11:64242393|64242501 hsa-miR-101-3p 0 1 0
chr12:45928254|45928451 hsa-miR-101-3p 0 1 0
chr10:97333356|97333515 hsa-miR-101-3p 0 1 0
chr2:69320187|69320308 hsa-miR-101-3p 0 1 0
chr2:241668671|241668848 hsa-miR-101-3p 0 1 0
chrX:154506840|154507232 hsa-miR-101-3p 0 1 0
chr2:70087824|70088093 hsa-miR-101-3p 0 1 0
chr12:110719952|110720083 hsa-miR-101-3p 0 1 0
chr7:140721817|140721985 hsa-miR-101-3p 0 1 0
chr5:134741095|134741202 hsa-miR-101-3p 0 1 0
chr1:161209211|161209547 hsa-miR-101-3p 0 1 0
chr16:82035406|82035557 hsa-miR-101-3p 0 1 0
chr20:45176073|45176438 hsa-miR-101-3p 1 0 0
chr11:102402058|102402206 hsa-miR-101-3p 1 0 0
Target genes
miRNA Gene Gene Description HGNC ID details
hsa-miR-101-3p EZH2 enhancer of zeste 2 polycomb repressive complex 2 subunit HGNC:3527 details
hsa-miR-101-3p ATXN1 ataxin 1 HGNC:10548 details
hsa-miR-101-3p MYCN MYCN proto-oncogene, bHLH transcription factor HGNC:7559 details
hsa-miR-101-3p MCL1 MCL1 apoptosis regulator, BCL2 family member HGNC:6943 details
hsa-miR-101-3p details
hsa-miR-101-3p FBN2 fibrillin 2 HGNC:3604 details
hsa-miR-101-3p ARID1A AT-rich interaction domain 1A HGNC:11110 details
hsa-miR-101-3p FOS Fos proto-oncogene, AP-1 transcription factor subunit HGNC:3796 details
hsa-miR-101-3p SUZ12 SUZ12 polycomb repressive complex 2 subunit HGNC:17101 details
hsa-miR-101-3p EED embryonic ectoderm development HGNC:3188 details
hsa-miR-101-3p PTGS2 prostaglandin-endoperoxide synthase 2 HGNC:9605 details
hsa-miR-101-3p APP amyloid beta precursor protein HGNC:620 details
hsa-miR-101-3p details
hsa-miR-101-3p ATM ATM serine/threonine kinase HGNC:795 details
hsa-miR-101-3p DUSP1 dual specificity phosphatase 1 HGNC:3064 details
hsa-miR-101-3p STMN1 stathmin 1 HGNC:6510 details
hsa-miR-101-3p RAB5A RAB5A, member RAS oncogene family HGNC:9783 details
hsa-miR-101-3p ATG4D autophagy related 4D cysteine peptidase HGNC:20789 details
hsa-miR-101-3p details
hsa-miR-101-3p SOX9 SRY-box transcription factor 9 HGNC:11204 details
hsa-miR-101-3p DNMT3A DNA methyltransferase 3 alpha HGNC:2978 details
hsa-miR-101-3p FMR1 FMRP translational regulator 1 HGNC:3775 details
hsa-miR-101-3p ICOS inducible T cell costimulator HGNC:5351 details
hsa-miR-101-3p PPP4R1 protein phosphatase 4 regulatory subunit 1 HGNC:9320 details
hsa-miR-101-3p CERK ceramide kinase HGNC:19256 details
hsa-miR-101-3p ANKFY1 ankyrin repeat and FYVE domain containing 1 HGNC:20763 details
hsa-miR-101-3p GMEB2 glucocorticoid modulatory element binding protein 2 HGNC:4371 details
hsa-miR-101-3p TGFBR3 transforming growth factor beta receptor 3 HGNC:11774 details
hsa-miR-101-3p MRPL44 mitochondrial ribosomal protein L44 HGNC:16650 details
hsa-miR-101-3p MKNK2 MAPK interacting serine/threonine kinase 2 HGNC:7111 details
hsa-miR-101-3p UBE2B ubiquitin conjugating enzyme E2 B HGNC:12473 details
hsa-miR-101-3p VEGFA vascular endothelial growth factor A HGNC:12680 details
hsa-miR-101-3p CDC123 cell division cycle 123 HGNC:16827 details
hsa-miR-101-3p TOR1AIP1 torsin 1A interacting protein 1 HGNC:29456 details
hsa-miR-101-3p MSH2 mutS homolog 2 HGNC:7325 details
hsa-miR-101-3p ZNF567 zinc finger protein 567 HGNC:28696 details
hsa-miR-101-3p TMEM192 transmembrane protein 192 HGNC:26775 details
hsa-miR-101-3p PRPF38B pre-mRNA processing factor 38B HGNC:25512 details
hsa-miR-101-3p CDC7 cell division cycle 7 HGNC:1745 details
hsa-miR-101-3p LYSMD3 LysM domain containing 3 HGNC:26969 details
hsa-miR-101-3p RAB8B RAB8B, member RAS oncogene family HGNC:30273 details
hsa-miR-101-3p PIP4K2A phosphatidylinositol-5-phosphate 4-kinase type 2 alpha HGNC:8997 details
hsa-miR-101-3p KLHL23 kelch like family member 23 HGNC:27506 details
hsa-miR-101-3p SLC7A2 solute carrier family 7 member 2 HGNC:11060 details
hsa-miR-101-3p SLC38A2 solute carrier family 38 member 2 HGNC:13448 details
hsa-miR-101-3p REEP5 receptor accessory protein 5 HGNC:30077 details
hsa-miR-101-3p ZNF792 zinc finger protein 792 HGNC:24751 details
hsa-miR-101-3p LIN7C lin-7 homolog C, crumbs cell polarity complex component HGNC:17789 details
hsa-miR-101-3p MAP2K1 mitogen-activated protein kinase kinase 1 HGNC:6840 details
hsa-miR-101-3p TMEM168 transmembrane protein 168 HGNC:25826 details
hsa-miR-101-3p DIMT1 DIM1 rRNA methyltransferase and ribosome maturation factor HGNC:30217 details
hsa-miR-101-3p INA internexin neuronal intermediate filament protein alpha HGNC:6057 details
hsa-miR-101-3p XIAP X-linked inhibitor of apoptosis HGNC:592 details
hsa-miR-101-3p NR2F2 nuclear receptor subfamily 2 group F member 2 HGNC:7976 details
hsa-miR-101-3p KCNG3 potassium voltage-gated channel modifier subfamily G member 3 HGNC:18306 details
hsa-miR-101-3p CCDC125 coiled-coil domain containing 125 HGNC:28924 details
hsa-miR-101-3p RAB11FIP1 RAB11 family interacting protein 1 HGNC:30265 details
hsa-miR-101-3p GFPT2 glutamine-fructose-6-phosphate transaminase 2 HGNC:4242 details
hsa-miR-101-3p CHAMP1 chromosome alignment maintaining phosphoprotein 1 HGNC:20311 details
hsa-miR-101-3p MNX1 motor neuron and pancreas homeobox 1 HGNC:4979 details
hsa-miR-101-3p FRMD6 FERM domain containing 6 HGNC:19839 details
hsa-miR-101-3p PLAG1 PLAG1 zinc finger HGNC:9045 details
hsa-miR-101-3p AP3M1 adaptor related protein complex 3 subunit mu 1 HGNC:569 details
hsa-miR-101-3p MPPE1 metallophosphoesterase 1 HGNC:15988 details
hsa-miR-101-3p MRPL42 mitochondrial ribosomal protein L42 HGNC:14493 details
hsa-miR-101-3p RAC1 Rac family small GTPase 1 HGNC:9801 details
hsa-miR-101-3p SREK1IP1 SREK1 interacting protein 1 HGNC:26716 details
hsa-miR-101-3p OTUD4 OTU deubiquitinase 4 HGNC:24949 details
hsa-miR-101-3p C10orf88 chromosome 10 open reading frame 88 HGNC:25822 details
hsa-miR-101-3p details
hsa-miR-101-3p MORC3 MORC family CW-type zinc finger 3 HGNC:23572 details
hsa-miR-101-3p TGIF2 TGFB induced factor homeobox 2 HGNC:15764 details
hsa-miR-101-3p AKAP11 A-kinase anchoring protein 11 HGNC:369 details
hsa-miR-101-3p AP1S3 adaptor related protein complex 1 subunit sigma 3 HGNC:18971 details
hsa-miR-101-3p STAMBP STAM binding protein HGNC:16950 details
hsa-miR-101-3p UBE2D3 ubiquitin conjugating enzyme E2 D3 HGNC:12476 details
hsa-miR-101-3p AP1G1 adaptor related protein complex 1 subunit gamma 1 HGNC:555 details
hsa-miR-101-3p KDM3B lysine demethylase 3B HGNC:1337 details
hsa-miR-101-3p details
hsa-miR-101-3p KDM6B lysine demethylase 6B HGNC:29012 details
hsa-miR-101-3p MBNL2 muscleblind like splicing regulator 2 HGNC:16746 details
hsa-miR-101-3p RANBP9 RAN binding protein 9 HGNC:13727 details
hsa-miR-101-3p details
hsa-miR-101-3p details
hsa-miR-101-3p ZBTB21 zinc finger and BTB domain containing 21 HGNC:13083 details
hsa-miR-101-3p ARID5B AT-rich interaction domain 5B HGNC:17362 details
hsa-miR-101-3p ABHD17C abhydrolase domain containing 17C, depalmitoylase HGNC:26925 details
hsa-miR-101-3p MRGBP MRG domain binding protein HGNC:15866 details
hsa-miR-101-3p MOB4 MOB family member 4, phocein HGNC:17261 details
hsa-miR-101-3p INO80D INO80 complex subunit D HGNC:25997 details
hsa-miR-101-3p MEIS1 Meis homeobox 1 HGNC:7000 details
hsa-miR-101-3p DCTD dCMP deaminase HGNC:2710 details
hsa-miR-101-3p KCTD14 potassium channel tetramerization domain containing 14 HGNC:23295 details
hsa-miR-101-3p BIRC5 baculoviral IAP repeat containing 5 HGNC:593 details
hsa-miR-101-3p ZCCHC2 zinc finger CCHC-type containing 2 HGNC:22916 details
hsa-miR-101-3p RPS6KA5 ribosomal protein S6 kinase A5 HGNC:10434 details
hsa-miR-101-3p ACVR2B activin A receptor type 2B HGNC:174 details
hsa-miR-101-3p MKLN1 muskelin 1 HGNC:7109 details
hsa-miR-101-3p MBTD1 mbt domain containing 1 HGNC:19866 details
hsa-miR-101-3p AMMECR1L AMMECR1 like HGNC:28658 details
hsa-miR-101-3p KIF2C kinesin family member 2C HGNC:6393 details
hsa-miR-101-3p JUN Jun proto-oncogene, AP-1 transcription factor subunit HGNC:6204 details
hsa-miR-101-3p USP25 ubiquitin specific peptidase 25 HGNC:12624 details
hsa-miR-101-3p RARS2 arginyl-tRNA synthetase 2, mitochondrial HGNC:21406 details
hsa-miR-101-3p CD46 CD46 molecule HGNC:6953 details
hsa-miR-101-3p NOP2 NOP2 nucleolar protein HGNC:7867 details
hsa-miR-101-3p LTN1 listerin E3 ubiquitin protein ligase 1 HGNC:13082 details
hsa-miR-101-3p FZD6 frizzled class receptor 6 HGNC:4044 details
hsa-miR-101-3p VAPA VAMP associated protein A HGNC:12648 details
hsa-miR-101-3p XPO7 exportin 7 HGNC:14108 details
hsa-miR-101-3p BTG2 BTG anti-proliferation factor 2 HGNC:1131 details
hsa-miR-101-3p MMS22L MMS22 like, DNA repair protein HGNC:21475 details
hsa-miR-101-3p FOXP4 forkhead box P4 HGNC:20842 details
hsa-miR-101-3p RPL7L1 ribosomal protein L7 like 1 HGNC:21370 details
hsa-miR-101-3p SPATA2 spermatogenesis associated 2 HGNC:14681 details
hsa-miR-101-3p FBXO11 F-box protein 11 HGNC:13590 details
hsa-miR-101-3p RNF44 ring finger protein 44 HGNC:19180 details
hsa-miR-101-3p E2F3 E2F transcription factor 3 HGNC:3115 details
hsa-miR-101-3p LMNB1 lamin B1 HGNC:6637 details
hsa-miR-101-3p TMTC3 transmembrane O-mannosyltransferase targeting cadherins 3 HGNC:26899 details
hsa-miR-101-3p HOXA9 homeobox A9 HGNC:5109 details
hsa-miR-101-3p FAR1 fatty acyl-CoA reductase 1 HGNC:26222 details
hsa-miR-101-3p GPAM glycerol-3-phosphate acyltransferase, mitochondrial HGNC:24865 details
hsa-miR-101-3p ADO 2-aminoethanethiol dioxygenase HGNC:23506 details
hsa-miR-101-3p RTN4 reticulon 4 HGNC:14085 details
hsa-miR-101-3p ELAVL2 ELAV like RNA binding protein 2 HGNC:3313 details
hsa-miR-101-3p CTR9 CTR9 homolog, Paf1/RNA polymerase II complex component HGNC:16850 details
hsa-miR-101-3p CERS2 ceramide synthase 2 HGNC:14076 details
hsa-miR-101-3p LZIC leucine zipper and CTNNBIP1 domain containing HGNC:17497 details
hsa-miR-101-3p VEZT vezatin, adherens junctions transmembrane protein HGNC:18258 details
hsa-miR-101-3p SMARCD1 SWI/SNF related, matrix associated, actin dependent regulator of chromatin, subfamily d, member 1 HGNC:11106 details
hsa-miR-101-3p RIOK2 RIO kinase 2 HGNC:18999 details
hsa-miR-101-3p CBX4 chromobox 4 HGNC:1554 details
hsa-miR-101-3p details
hsa-miR-101-3p QSER1 glutamine and serine rich 1 HGNC:26154 details
hsa-miR-101-3p MYO9A myosin IXA HGNC:7608 details
hsa-miR-101-3p CAPN2 calpain 2 HGNC:1479 details
hsa-miR-101-3p TFAP4 transcription factor AP-4 HGNC:11745 details
hsa-miR-101-3p details
hsa-miR-101-3p TBC1D12 TBC1 domain family member 12 HGNC:29082 details
hsa-miR-101-3p SPAG1 sperm associated antigen 1 HGNC:11212 details
hsa-miR-101-3p ZNF800 zinc finger protein 800 HGNC:27267 details
hsa-miR-101-3p details
hsa-miR-101-3p BLOC1S6 biogenesis of lysosomal organelles complex 1 subunit 6 HGNC:8549 details
hsa-miR-101-3p SPIRE1 spire type actin nucleation factor 1 HGNC:30622 details
hsa-miR-101-3p FRS2 fibroblast growth factor receptor substrate 2 HGNC:16971 details
hsa-miR-101-3p TMEM170B transmembrane protein 170B HGNC:34244 details
hsa-miR-101-3p AFF4 AF4/FMR2 family member 4 HGNC:17869 details
hsa-miR-101-3p GNB1 G protein subunit beta 1 HGNC:4396 details
hsa-miR-101-3p LBR lamin B receptor HGNC:6518 details
hsa-miR-101-3p ZFX zinc finger protein X-linked HGNC:12869 details
hsa-miR-101-3p KLF12 Kruppel like factor 12 HGNC:6346 details
hsa-miR-101-3p PHF3 PHD finger protein 3 HGNC:8921 details
hsa-miR-101-3p C1orf52 chromosome 1 open reading frame 52 HGNC:24871 details
hsa-miR-101-3p TSPAN12 tetraspanin 12 HGNC:21641 details
hsa-miR-101-3p FAM217B family with sequence similarity 217 member B HGNC:16170 details
hsa-miR-101-3p SUB1 SUB1 regulator of transcription HGNC:19985 details
hsa-miR-101-3p BCL9 BCL9 transcription coactivator HGNC:1008 details
hsa-miR-101-3p SACM1L SAC1 like phosphatidylinositide phosphatase HGNC:17059 details
hsa-miR-101-3p ARAP2 ArfGAP with RhoGAP domain, ankyrin repeat and PH domain 2 HGNC:16924 details
hsa-miR-101-3p TRERF1 transcriptional regulating factor 1 HGNC:18273 details
hsa-miR-101-3p NUFIP2 nuclear FMR1 interacting protein 2 HGNC:17634 details
hsa-miR-101-3p PIP5K1C phosphatidylinositol-4-phosphate 5-kinase type 1 gamma HGNC:8996 details
hsa-miR-101-3p PAFAH1B1 platelet activating factor acetylhydrolase 1b regulatory subunit 1 HGNC:8574 details
hsa-miR-101-3p DDIT4 DNA damage inducible transcript 4 HGNC:24944 details
hsa-miR-101-3p TGFBR1 transforming growth factor beta receptor 1 HGNC:11772 details
hsa-miR-101-3p LRCH2 leucine rich repeats and calponin homology domain containing 2 HGNC:29292 details
hsa-miR-101-3p LIFR LIF receptor subunit alpha HGNC:6597 details
hsa-miR-101-3p FBXW7 F-box and WD repeat domain containing 7 HGNC:16712 details
hsa-miR-101-3p POU2F1 POU class 2 homeobox 1 HGNC:9212 details
hsa-miR-101-3p CBFA2T2 CBFA2/RUNX1 partner transcriptional co-repressor 2 HGNC:1536 details
hsa-miR-101-3p LCOR ligand dependent nuclear receptor corepressor HGNC:29503 details
hsa-miR-101-3p AEBP2 AE binding protein 2 HGNC:24051 details
hsa-miR-101-3p NEK7 NIMA related kinase 7 HGNC:13386 details
hsa-miR-101-3p MFSD6 major facilitator superfamily domain containing 6 HGNC:24711 details
hsa-miR-101-3p CDH5 cadherin 5 HGNC:1764 details
hsa-miR-101-3p ZEB1 zinc finger E-box binding homeobox 1 HGNC:11642 details
hsa-miR-101-3p PTGER4 prostaglandin E receptor 4 HGNC:9596 details
hsa-miR-101-3p CPEB1 cytoplasmic polyadenylation element binding protein 1 HGNC:21744 details
hsa-miR-101-3p MTOR mechanistic target of rapamycin kinase HGNC:3942 details
hsa-miR-101-3p CFTR CF transmembrane conductance regulator HGNC:1884 details
hsa-miR-101-3p KLF6 Kruppel like factor 6 HGNC:2235 details
hsa-miR-101-3p ZEB2 zinc finger E-box binding homeobox 2 HGNC:14881 details
hsa-miR-101-3p ZNF480 zinc finger protein 480 HGNC:23305 details
hsa-miR-101-3p ANKRD17 ankyrin repeat domain 17 HGNC:23575 details
hsa-miR-101-3p ZNF654 zinc finger protein 654 HGNC:25612 details
hsa-miR-101-3p USP36 ubiquitin specific peptidase 36 HGNC:20062 details
hsa-miR-101-3p QDPR quinoid dihydropteridine reductase HGNC:9752 details
hsa-miR-101-3p RMI1 RecQ mediated genome instability 1 HGNC:25764 details
hsa-miR-101-3p SLC25A33 solute carrier family 25 member 33 HGNC:29681 details
hsa-miR-101-3p L2HGDH L-2-hydroxyglutarate dehydrogenase HGNC:20499 details
hsa-miR-101-3p SLC11A2 solute carrier family 11 member 2 HGNC:10908 details
hsa-miR-101-3p COX10 cytochrome c oxidase assembly factor heme A:farnesyltransferase COX10 HGNC:2260 details
hsa-miR-101-3p SNRNP27 small nuclear ribonucleoprotein U4/U6.U5 subunit 27 HGNC:30240 details
hsa-miR-101-3p ZC3H11A zinc finger CCCH-type containing 11A HGNC:29093 details
hsa-miR-101-3p TSN translin HGNC:12379 details
hsa-miR-101-3p TNFAIP1 TNF alpha induced protein 1 HGNC:11894 details
hsa-miR-101-3p TMED5 transmembrane p24 trafficking protein 5 HGNC:24251 details
hsa-miR-101-3p TGOLN2 trans-golgi network protein 2 HGNC:15450 details
hsa-miR-101-3p TGFBR2 transforming growth factor beta receptor 2 HGNC:11773 details
hsa-miR-101-3p STYX serine/threonine/tyrosine interacting protein HGNC:11447 details
hsa-miR-101-3p STX16 syntaxin 16 HGNC:11431 details
hsa-miR-101-3p SREBF2 sterol regulatory element binding transcription factor 2 HGNC:11290 details
hsa-miR-101-3p SGPL1 sphingosine-1-phosphate lyase 1 HGNC:10817 details
hsa-miR-101-3p RRM2 ribonucleotide reductase regulatory subunit M2 HGNC:10452 details
hsa-miR-101-3p REL REL proto-oncogene, NF-kB subunit HGNC:9954 details
hsa-miR-101-3p PSPC1 paraspeckle component 1 HGNC:20320 details
hsa-miR-101-3p PRKAA1 protein kinase AMP-activated catalytic subunit alpha 1 HGNC:9376 details
hsa-miR-101-3p PPP2R5E protein phosphatase 2 regulatory subunit B'epsilon HGNC:9313 details
hsa-miR-101-3p PPP1R15B protein phosphatase 1 regulatory subunit 15B HGNC:14951 details
hsa-miR-101-3p PPP1CC protein phosphatase 1 catalytic subunit gamma HGNC:9283 details
hsa-miR-101-3p PIK3C2B phosphatidylinositol-4-phosphate 3-kinase catalytic subunit type 2 beta HGNC:8972 details
hsa-miR-101-3p details
hsa-miR-101-3p NCKAP1 NCK associated protein 1 HGNC:7666 details
hsa-miR-101-3p NACC1 nucleus accumbens associated 1 HGNC:20967 details
hsa-miR-101-3p KPNA2 karyopherin subunit alpha 2 HGNC:6395 details
hsa-miR-101-3p TOR1AIP2 torsin 1A interacting protein 2 HGNC:24055 details
hsa-miR-101-3p HNRNPF heterogeneous nuclear ribonucleoprotein F HGNC:5039 details
hsa-miR-101-3p G3BP1 G3BP stress granule assembly factor 1 HGNC:30292 details
hsa-miR-101-3p FNDC3A fibronectin type III domain containing 3A HGNC:20296 details
hsa-miR-101-3p DAZAP2 DAZ associated protein 2 HGNC:2684 details
hsa-miR-101-3p CPS1 carbamoyl-phosphate synthase 1 HGNC:2323 details
hsa-miR-101-3p CDKN1A cyclin dependent kinase inhibitor 1A HGNC:1784 details
hsa-miR-101-3p CD81 CD81 molecule HGNC:1701 details
hsa-miR-101-3p CCNF cyclin F HGNC:1591 details
hsa-miR-101-3p CARNMT1 carnosine N-methyltransferase 1 HGNC:23435 details
hsa-miR-101-3p details
hsa-miR-101-3p BZW1 basic leucine zipper and W2 domains 1 HGNC:18380 details
hsa-miR-101-3p BCL2L11 BCL2 like 11 HGNC:994 details
hsa-miR-101-3p ANKRD11 ankyrin repeat domain 11 HGNC:21316 details
hsa-miR-101-3p DICER1 dicer 1, ribonuclease III HGNC:17098 details
hsa-miR-101-3p SLC35F5 solute carrier family 35 member F5 HGNC:23617 details
hsa-miR-101-3p MAP3K4 mitogen-activated protein kinase kinase kinase 4 HGNC:6856 details
hsa-miR-101-3p DNAJC28 DnaJ heat shock protein family (Hsp40) member C28 HGNC:1297 details
hsa-miR-101-3p details
hsa-miR-101-3p details
hsa-miR-101-3p PGBD4 piggyBac transposable element derived 4 HGNC:19401 details
hsa-miR-101-3p C1orf147 chromosome 1 open reading frame 147 HGNC:32061 details
hsa-miR-101-3p CLIC4 chloride intracellular channel 4 HGNC:13518 details
hsa-miR-101-3p DNAJA1 DnaJ heat shock protein family (Hsp40) member A1 HGNC:5229 details
hsa-miR-101-3p BTRC beta-transducin repeat containing E3 ubiquitin protein ligase HGNC:1144 details
hsa-miR-101-3p IL20RB interleukin 20 receptor subunit beta HGNC:6004 details
hsa-miR-101-3p FKBP14 FKBP prolyl isomerase 14 HGNC:18625 details
hsa-miR-101-3p UBE2A ubiquitin conjugating enzyme E2 A HGNC:12472 details
hsa-miR-101-3p RNF111 ring finger protein 111 HGNC:17384 details
hsa-miR-101-3p PEX5L peroxisomal biogenesis factor 5 like HGNC:30024 details
hsa-miR-101-3p ZNF100 zinc finger protein 100 HGNC:12880 details
hsa-miR-101-3p TBX18 T-box transcription factor 18 HGNC:11595 details
hsa-miR-101-3p SLC30A5 solute carrier family 30 member 5 HGNC:19089 details
hsa-miR-101-3p PIAS1 protein inhibitor of activated STAT 1 HGNC:2752 details
hsa-miR-101-3p NAP1L1 nucleosome assembly protein 1 like 1 HGNC:7637 details
hsa-miR-101-3p GRIK3 glutamate ionotropic receptor kainate type subunit 3 HGNC:4581 details
hsa-miR-101-3p DCAF12L2 DDB1 and CUL4 associated factor 12 like 2 HGNC:32950 details
hsa-miR-101-3p UGT2A1 UDP glucuronosyltransferase family 2 member A1 complex locus HGNC:12542 details
hsa-miR-101-3p UGT2A2 UDP glucuronosyltransferase family 2 member A2 HGNC:28183 details
hsa-miR-101-3p ZNF223 zinc finger protein 223 HGNC:13016 details
hsa-miR-101-3p NANOGNB NANOG neighbor homeobox HGNC:24958 details
hsa-miR-101-3p NXT2 nuclear transport factor 2 like export factor 2 HGNC:18151 details
hsa-miR-101-3p ZNF827 zinc finger protein 827 HGNC:27193 details
hsa-miR-101-3p RORA RAR related orphan receptor A HGNC:10258 details
hsa-miR-101-3p RNF152 ring finger protein 152 HGNC:26811 details
hsa-miR-101-3p N4BP1 NEDD4 binding protein 1 HGNC:29850 details
hsa-miR-101-3p LEFTY1 left-right determination factor 1 HGNC:6552 details
hsa-miR-101-3p IPO7 importin 7 HGNC:9852 details
hsa-miR-101-3p GPR135 G protein-coupled receptor 135 HGNC:19991 details
hsa-miR-101-3p FGF2 fibroblast growth factor 2 HGNC:3676 details
hsa-miR-101-3p DYRK2 dual specificity tyrosine phosphorylation regulated kinase 2 HGNC:3093 details
hsa-miR-101-3p HSP90AA1 heat shock protein 90 alpha family class A member 1 HGNC:5253 details
hsa-miR-101-3p JCAD junctional cadherin 5 associated HGNC:29283 details
hsa-miR-101-3p SLC39A6 solute carrier family 39 member 6 HGNC:18607 details
hsa-miR-101-3p TNRC18P2 trinucleotide repeat containing 18 pseudogene 2 HGNC:34014 details
hsa-miR-101-3p TNPO1 transportin 1 HGNC:6401 details
hsa-miR-101-3p NAA30 N-alpha-acetyltransferase 30, NatC catalytic subunit HGNC:19844 details
hsa-miR-101-3p MAML3 mastermind like transcriptional coactivator 3 HGNC:16272 details
hsa-miR-101-3p GOLGA7 golgin A7 HGNC:24876 details
hsa-miR-101-3p ATXN1L ataxin 1 like HGNC:33279 details
hsa-miR-101-3p ZNF490 zinc finger protein 490 HGNC:23705 details
hsa-miR-101-3p ZNF431 zinc finger protein 431 HGNC:20809 details
hsa-miR-101-3p ZFP36L2 ZFP36 ring finger protein like 2 HGNC:1108 details
hsa-miR-101-3p TVP23C trans-golgi network vesicle protein 23 homolog C HGNC:30453 details
hsa-miR-101-3p RAP2C RAP2C, member of RAS oncogene family HGNC:21165 details
hsa-miR-101-3p RAB39B RAB39B, member RAS oncogene family HGNC:16499 details
hsa-miR-101-3p RAB33B RAB33B, member RAS oncogene family HGNC:16075 details
hsa-miR-101-3p PURB purine rich element binding protein B HGNC:9702 details
hsa-miR-101-3p NT5C3A 5'-nucleotidase, cytosolic IIIA HGNC:17820 details
hsa-miR-101-3p PLEKHA3 pleckstrin homology domain containing A3 HGNC:14338 details
hsa-miR-101-3p PLEKHA1 pleckstrin homology domain containing A1 HGNC:14335 details
hsa-miR-101-3p GLRX5 glutaredoxin 5 HGNC:20134 details
hsa-miR-101-3p EIF4G2 eukaryotic translation initiation factor 4 gamma 2 HGNC:3297 details
hsa-miR-101-3p DIDO1 death inducer-obliterator 1 HGNC:2680 details
hsa-miR-101-3p BICD2 BICD cargo adaptor 2 HGNC:17208 details
hsa-miR-101-3p BEND4 BEN domain containing 4 HGNC:23815 details
hsa-miR-101-3p details
hsa-miR-101-3p PPP2R2A protein phosphatase 2 regulatory subunit Balpha HGNC:9304 details
hsa-miR-101-3p AGO4 argonaute RISC component 4 HGNC:18424 details
hsa-miR-101-3p NACA2 nascent polypeptide associated complex subunit alpha 2 HGNC:23290 details
hsa-miR-101-3p KIAA1586 KIAA1586 HGNC:21360 details
hsa-miR-101-3p details
hsa-miR-101-3p WNK1 WNK lysine deficient protein kinase 1 HGNC:14540 details
hsa-miR-101-3p UBN2 ubinuclein 2 HGNC:21931 details
hsa-miR-101-3p TTC37 tetratricopeptide repeat domain 37 HGNC:23639 details
hsa-miR-101-3p RREB1 ras responsive element binding protein 1 HGNC:10449 details
hsa-miR-101-3p PCCB propionyl-CoA carboxylase subunit beta HGNC:8654 details
hsa-miR-101-3p MBNL1 muscleblind like splicing regulator 1 HGNC:6923 details
hsa-miR-101-3p LRRC1 leucine rich repeat containing 1 HGNC:14307 details
hsa-miR-101-3p HSPE1-MOB4 HSPE1-MOB4 readthrough HGNC:49184 details
hsa-miR-101-3p HSPA13 heat shock protein family A (Hsp70) member 13 HGNC:11375 details
hsa-miR-101-3p HNRNPAB heterogeneous nuclear ribonucleoprotein A/B HGNC:5034 details
hsa-miR-101-3p details
hsa-miR-101-3p ZNF284 zinc finger protein 284 HGNC:13078 details
hsa-miR-101-3p ALG14 ALG14 UDP-N-acetylglucosaminyltransferase subunit HGNC:28287 details
hsa-miR-101-3p ZNF207 zinc finger protein 207 HGNC:12998 details
hsa-miR-101-3p SMARCA5 SWI/SNF related, matrix associated, actin dependent regulator of chromatin, subfamily a, member 5 HGNC:11101 details
hsa-miR-101-3p SIX4 SIX homeobox 4 HGNC:10890 details
hsa-miR-101-3p RBM12B RNA binding motif protein 12B HGNC:32310 details
hsa-miR-101-3p ZNF350 zinc finger protein 350 HGNC:16656 details
hsa-miR-101-3p CMTM6 CKLF like MARVEL transmembrane domain containing 6 HGNC:19177 details
hsa-miR-101-3p NACA nascent polypeptide associated complex subunit alpha HGNC:7629 details
hsa-miR-101-3p CADM1 cell adhesion molecule 1 HGNC:5951 details
hsa-miR-101-3p TSC22D2 TSC22 domain family member 2 HGNC:29095 details
hsa-miR-101-3p WNT7A Wnt family member 7A HGNC:12786 details
hsa-miR-101-3p PABPC1L2A poly(A) binding protein cytoplasmic 1 like 2A HGNC:27989 details
hsa-miR-101-3p RNF213 ring finger protein 213 HGNC:14539 details
hsa-miR-101-3p NKX3-2 NK3 homeobox 2 HGNC:951 details
hsa-miR-101-3p PAK3 p21 (RAC1) activated kinase 3 HGNC:8592 details
hsa-miR-101-3p EEA1 early endosome antigen 1 HGNC:3185 details
hsa-miR-101-3p ZDHHC15 zinc finger DHHC-type palmitoyltransferase 15 HGNC:20342 details
hsa-miR-101-3p MLEC malectin HGNC:28973 details
hsa-miR-101-3p ZBTB7A zinc finger and BTB domain containing 7A HGNC:18078 details
hsa-miR-101-3p PANK1 pantothenate kinase 1 HGNC:8598 details
hsa-miR-101-3p DENND5B DENN domain containing 5B HGNC:28338 details
hsa-miR-101-3p CNEP1R1 CTD nuclear envelope phosphatase 1 regulatory subunit 1 HGNC:26759 details
hsa-miR-101-3p AMD1 adenosylmethionine decarboxylase 1 HGNC:457 details
hsa-miR-101-3p GPR50 G protein-coupled receptor 50 HGNC:4506 details
hsa-miR-101-3p KCNQ5 potassium voltage-gated channel subfamily Q member 5 HGNC:6299 details
hsa-miR-101-3p RAP1B RAP1B, member of RAS oncogene family HGNC:9857 details
hsa-miR-101-3p NLK nemo like kinase HGNC:29858 details
hsa-miR-101-3p TET2 tet methylcytosine dioxygenase 2 HGNC:25941 details
hsa-miR-101-3p MITF melanocyte inducing transcription factor HGNC:7105 details
hsa-miR-101-3p MET MET proto-oncogene, receptor tyrosine kinase HGNC:7029 details
hsa-miR-101-3p PRDM1 PR/SET domain 1 HGNC:9346 details
hsa-miR-101-3p JAK2 Janus kinase 2 HGNC:6192 details
hsa-miR-101-3p PIK3CB phosphatidylinositol-4,5-bisphosphate 3-kinase catalytic subunit beta HGNC:8976 details
hsa-miR-101-3p VEGFC vascular endothelial growth factor C HGNC:12682 details
hsa-miR-101-3p PIM1 Pim-1 proto-oncogene, serine/threonine kinase HGNC:8986 details
hsa-miR-101-3p NOTCH1 notch receptor 1 HGNC:7881 details
hsa-miR-101-3p GCLC glutamate-cysteine ligase catalytic subunit HGNC:4311 details
hsa-miR-101-3p THRB thyroid hormone receptor beta HGNC:11799 details
hsa-miR-101-3p PRDM16 PR/SET domain 16 HGNC:14000 details
hsa-miR-101-3p LIN28B lin-28 homolog B HGNC:32207 details
hsa-miR-101-3p PRKAB1 protein kinase AMP-activated non-catalytic subunit beta 1 HGNC:9378 details
hsa-miR-101-3p RHOA ras homolog family member A HGNC:667 details
hsa-miR-101-3p SRF serum response factor HGNC:11291 details
hsa-miR-101-3p RUNX1 RUNX family transcription factor 1 HGNC:10471 details
hsa-miR-101-3p CDK8 cyclin dependent kinase 8 HGNC:1779 details
hsa-miR-101-3p CTNNB1 catenin beta 1 HGNC:2514 details
hsa-miR-101-3p CCND1 cyclin D1 HGNC:1582 details
hsa-miR-101-3p SNHG1 small nucleolar RNA host gene 1 HGNC:32688 details
hsa-miR-101-3p EYA1 EYA transcriptional coactivator and phosphatase 1 HGNC:3519 details
hsa-miR-101-3p VHL von Hippel-Lindau tumor suppressor HGNC:12687 details
hsa-miR-101-3p GRSF1 G-rich RNA sequence binding factor 1 HGNC:4610 details
hsa-miR-101-3p ITGA3 integrin subunit alpha 3 HGNC:6139 details
hsa-miR-101-3p ATG12 autophagy related 12 HGNC:588 details
hsa-miR-101-3p CD180 CD180 molecule HGNC:6726 details
hsa-miR-101-3p DCBLD2 discoidin, CUB and LCCL domain containing 2 HGNC:24627 details
hsa-miR-101-3p HNRNPU heterogeneous nuclear ribonucleoprotein U HGNC:5048 details
hsa-miR-101-3p HSP90B1 heat shock protein 90 beta family member 1 HGNC:12028 details
hsa-miR-101-3p details
hsa-miR-101-3p ORAI2 ORAI calcium release-activated calcium modulator 2 HGNC:21667 details
hsa-miR-101-3p PIK3CD phosphatidylinositol-4,5-bisphosphate 3-kinase catalytic subunit delta HGNC:8977 details
hsa-miR-101-3p SZRD1 SUZ RNA binding domain containing 1 HGNC:30232 details
hsa-miR-101-3p TRIB1 tribbles pseudokinase 1 HGNC:16891 details
hsa-miR-101-3p ANKDD1A ankyrin repeat and death domain containing 1A HGNC:28002 details
hsa-miR-101-3p B3GALNT2 beta-1,3-N-acetylgalactosaminyltransferase 2 HGNC:28596 details
hsa-miR-101-3p CAPZB capping actin protein of muscle Z-line subunit beta HGNC:1491 details
hsa-miR-101-3p CDC42EP4 CDC42 effector protein 4 HGNC:17147 details
hsa-miR-101-3p DDX19B DEAD-box helicase 19B HGNC:2742 details
hsa-miR-101-3p DSC1 desmocollin 1 HGNC:3035 details
hsa-miR-101-3p DYNC1LI2 dynein cytoplasmic 1 light intermediate chain 2 HGNC:2966 details
hsa-miR-101-3p EXTL3 exostosin like glycosyltransferase 3 HGNC:3518 details
hsa-miR-101-3p GAN gigaxonin HGNC:4137 details
hsa-miR-101-3p HFE homeostatic iron regulator HGNC:4886 details
hsa-miR-101-3p IER5 immediate early response 5 HGNC:5393 details
hsa-miR-101-3p NKAP NFKB activating protein HGNC:29873 details
hsa-miR-101-3p NR2F6 nuclear receptor subfamily 2 group F member 6 HGNC:7977 details
hsa-miR-101-3p SHMT1 serine hydroxymethyltransferase 1 HGNC:10850 details
hsa-miR-101-3p SMN2 survival of motor neuron 2, centromeric HGNC:11118 details
hsa-miR-101-3p SNRNP35 small nuclear ribonucleoprotein U11/U12 subunit 35 HGNC:30852 details
hsa-miR-101-3p TAF13 TATA-box binding protein associated factor 13 HGNC:11546 details
hsa-miR-101-3p TBX20 T-box transcription factor 20 HGNC:11598 details
hsa-miR-101-3p ZDHHC24 zinc finger DHHC-type containing 24 HGNC:27387 details
hsa-miR-101-3p ZNF124 zinc finger protein 124 HGNC:12907 details
hsa-miR-101-3p ELAVL3 ELAV like RNA binding protein 3 HGNC:3314 details
hsa-miR-101-3p LANCL3 LanC like 3 HGNC:24767 details
hsa-miR-101-3p LDB1 LIM domain binding 1 HGNC:6532 details
hsa-miR-101-3p PDK1 pyruvate dehydrogenase kinase 1 HGNC:8809 details
© 2021 Arieh Warshel Institute of Computational Biology, CUHK(SZ) | Designed by : Biomics Lab