miRNA Card

miRNA General Information
miRNA ID hsa-miR-124-3p
Description Homo sapiens miR-124-1 stem-loop
Comment miR-124 was first identified by cloning studies in mouse [1]. Its expression was later verified in human embryonic stem cells [2]. The mature sequence shown here represents the most commonly cloned form from large-scale cloning studies [5]. The 5' end of the miRNA may be offset with respect to previous annotations.
Experiment cloned [2,4-5]
Sequence UAAGGCACGCGGUGAAUGCC
miRNA Expression in different cancers

    by mir_boxplot.py

circRNA-miRNA-gene regulatory network

Note about Netwrok:
This is a network diagram with miRNA (purple circle) as the center.
We used three tools(PITA, miRanda, targetScan) to predict the binding sites of circrna (green circle) and miRNA. Accordingly, for this miRNA that binds to circrna, we have three confidence levels, namely confident 1, confident 2 and confident 3. Confidence value indicates how many tools can deduce these results. For each confidence, we use different kinds of dashed lines.

Target circRNA with confidence

Confidence 3 (3 of 3 tools predicted)

CircID miRNA PITA miRanda targetScan
chr3:27379249|27437526 hsa-miR-124-3p 1 1 1

Confidence 2 (2 of 3 tools predicted)

CircID miRNA PITA miRanda targetScan
chr4:2249183|2249293 hsa-miR-124-3p 1 1 0
chr2:231455232|231455475 hsa-miR-124-3p 1 1 0
chr7:157416038|157416185 hsa-miR-124-3p 1 1 0
chr20:17607791|17608113 hsa-miR-124-3p 1 1 0
chr17:74837740|74837897 hsa-miR-124-3p 1 1 0
chr2:30259027|30259158 hsa-miR-124-3p 1 1 0
chr3:149371709|149371852 hsa-miR-124-3p 1 1 0
chr9:107487028|107487143 hsa-miR-124-3p 1 1 0
chr6:31954120|31954363 hsa-miR-124-3p 1 1 0
chr9:37780926|37781057 hsa-miR-124-3p 1 1 0
chr3:39102783|39102914 hsa-miR-124-3p 1 1 0
chr19:7391461|7391606 hsa-miR-124-3p 1 1 0
chr16:3685311|3685462 hsa-miR-124-3p 1 1 0
chr21:34085847|34085940 hsa-miR-124-3p 1 1 0
chr20:17620077|17620225 hsa-miR-124-3p 1 1 0
chr15:78921804|78921948 hsa-miR-124-3p 1 1 0
chr15:78921778|78922023 hsa-miR-124-3p 1 1 0
chr11:43446102|43446258 hsa-miR-124-3p 1 1 0
chr2:231455232|231455442 hsa-miR-124-3p 1 1 0
chr7:12224226|12229819 hsa-miR-124-3p 1 1 0
chr17:64043798|64043892 hsa-miR-124-3p 1 1 0
chr7:157416051|157416255 hsa-miR-124-3p 1 1 0
chr7:101206008|101206286 hsa-miR-124-3p 1 1 0
chr7:157416051|157416244 hsa-miR-124-3p 1 1 0
chr10:93694618|93694803 hsa-miR-124-3p 1 1 0
chr19:49635327|49635459 hsa-miR-124-3p 1 1 0
chr15:78921831|78922023 hsa-miR-124-3p 1 1 0
chr6:33406379|33406630 hsa-miR-124-3p 1 1 0
chr6:166931615|166931720 hsa-miR-124-3p 1 1 0
chr2:231455232|231455433 hsa-miR-124-3p 1 1 0
chr4:186588749|186588910 hsa-miR-124-3p 1 1 0
chr5:14711166|14711240 hsa-miR-124-3p 1 1 0
chr4:183097353|183097508 hsa-miR-124-3p 1 1 0

Confidence 1 (1 of 3 tools predicted)

CircID miRNA PITA miRanda targetScan
chr11:94619814|94620050 hsa-miR-124-3p 1 0 0
chr6:43013233|43013359 hsa-miR-124-3p 1 0 0
chr1:160427791|160427895 hsa-miR-124-3p 1 0 0
chr1:155184299|155184439 hsa-miR-124-3p 1 0 0
chr22:49961139|49961465 hsa-miR-124-3p 1 0 0
chr4:94575747|94575892 hsa-miR-124-3p 1 0 0
chr8:10428630|10428785 hsa-miR-124-3p 1 0 0
chr1:33499195|33499297 hsa-miR-124-3p 1 0 0
chr9:131495999|131496167 hsa-miR-124-3p 1 0 0
chr3:129315569|129315674 hsa-miR-124-3p 1 0 0
chr19:13831818|13831967 hsa-miR-124-3p 1 0 0
chr15:40902658|40902904 hsa-miR-124-3p 1 0 0
chr12:51393855|51394029 hsa-miR-124-3p 0 1 0
chr19:38729730|38729887 hsa-miR-124-3p 0 1 0
chr2:85319991|85320184 hsa-miR-124-3p 0 1 0
chr17:80393976|80394107 hsa-miR-124-3p 0 1 0
chr5:179609866|179609975 hsa-miR-124-3p 0 1 0
chr6:31268945|31269173 hsa-miR-124-3p 0 1 0
chr12:54286165|54286286 hsa-miR-124-3p 0 1 0
chr16:11178744|11179072 hsa-miR-124-3p 0 1 0
chr14:93237817|93237931 hsa-miR-124-3p 0 1 0
chr8:143923104|143923220 hsa-miR-124-3p 0 1 0
chr5:59090278|59090398 hsa-miR-124-3p 0 1 0
chr22:41907035|41907238 hsa-miR-124-3p 0 1 0
chr2:202475362|202475609 hsa-miR-124-3p 0 1 0
chr3:15648828|15648990 hsa-miR-124-3p 0 1 0
chr10:79354027|79354223 hsa-miR-124-3p 0 1 0
chr11:46382587|46382748 hsa-miR-124-3p 0 1 0
chr15:90081363|90081541 hsa-miR-124-3p 0 1 0
chr6:26056036|26056195 hsa-miR-124-3p 0 1 0
chr11:46382364|46382748 hsa-miR-124-3p 0 1 0
chr16:15703200|15703353 hsa-miR-124-3p 0 1 0
chr3:51945911|51946261 hsa-miR-124-3p 0 1 0
chr13:98385755|98388418 hsa-miR-124-3p 0 1 0
chr5:150401856|150402004 hsa-miR-124-3p 0 1 0
chr16:31189731|31190105 hsa-miR-124-3p 0 1 0
chr3:13328823|13328928 hsa-miR-124-3p 0 1 0
chr6:31355173|31355436 hsa-miR-124-3p 0 1 0
chr5:141625685|141626042 hsa-miR-124-3p 0 1 0
chr16:29816961|29817292 hsa-miR-124-3p 0 1 0
chr16:31189737|31190105 hsa-miR-124-3p 0 1 0
chr5:83542070|83542268 hsa-miR-124-3p 0 1 0
chr2:58146316|58146474 hsa-miR-124-3p 0 1 0
chr12:57234245|57234489 hsa-miR-124-3p 0 1 0
chr19:38729763|38729887 hsa-miR-124-3p 0 1 0
chr17:9055405|9055588 hsa-miR-124-3p 0 1 0
chr1:226086836|226087004 hsa-miR-124-3p 0 1 0
chr12:53060705|53061051 hsa-miR-124-3p 0 1 0
chr6:31355146|31355436 hsa-miR-124-3p 0 1 0
chr9:732487|732600 hsa-miR-124-3p 0 1 0
chr1:183142745|183143021 hsa-miR-124-3p 0 1 0
chr11:46382647|46382748 hsa-miR-124-3p 0 1 0
chr19:48495855|48495998 hsa-miR-124-3p 0 1 0
chr18:3254775|3254882 hsa-miR-124-3p 0 1 0
chr1:31434268|31434438 hsa-miR-124-3p 0 1 0
chr8:37861915|37862089 hsa-miR-124-3p 0 1 0
chr3:39397226|39397328 hsa-miR-124-3p 0 1 0
chr5:150401856|150401986 hsa-miR-124-3p 0 1 0
chr6:31270220|31270363 hsa-miR-124-3p 0 1 0
chr10:44999206|44999316 hsa-miR-124-3p 0 1 0
chr19:1924108|1924248 hsa-miR-124-3p 0 1 0
chr16:31189735|31190108 hsa-miR-124-3p 0 1 0
chr22:41907077|41907172 hsa-miR-124-3p 0 1 0
chr5:83542101|83545561 hsa-miR-124-3p 0 1 0
chr17:7859569|7859703 hsa-miR-124-3p 0 1 0
chr7:100097614|100097856 hsa-miR-124-3p 0 1 0
chr17:67922840|67924589 hsa-miR-124-3p 0 1 0
chr7:87345062|87345179 hsa-miR-124-3p 0 1 0
chr10:5894804|5894948 hsa-miR-124-3p 0 1 0
chr9:37883606|37883732 hsa-miR-124-3p 0 1 0
chr6:31354159|31354296 hsa-miR-124-3p 0 1 0
chr6:160043196|160043288 hsa-miR-124-3p 0 1 0
chr16:31189777|31190108 hsa-miR-124-3p 0 1 0
chr19:40233073|40233145 hsa-miR-124-3p 0 1 0
chr12:53253370|53253544 hsa-miR-124-3p 0 1 0
chr16:31189768|31190108 hsa-miR-124-3p 0 1 0
chr9:82980380|82980511 hsa-miR-124-3p 0 1 0
chr16:23467140|23467366 hsa-miR-124-3p 0 1 0
chr6:41161588|41163141 hsa-miR-124-3p 0 1 0
chr15:65155793|65156863 hsa-miR-124-3p 0 1 0
chr5:133104327|133104416 hsa-miR-124-3p 0 1 0
chr6:31355177|31355436 hsa-miR-124-3p 0 1 0
chr7:127701206|127702463 hsa-miR-124-3p 0 1 0
chr16:2770081|2770233 hsa-miR-124-3p 0 1 0
chr19:11441256|11441357 hsa-miR-124-3p 0 1 0
chr19:11441240|11441357 hsa-miR-124-3p 0 1 0
chr16:642835|642987 hsa-miR-124-3p 0 1 0
chr9:137242714|137242890 hsa-miR-124-3p 0 1 0
chr6:160043154|160043258 hsa-miR-124-3p 0 1 0
chr12:56102395|56102498 hsa-miR-124-3p 0 1 0
chr9:93672408|93672563 hsa-miR-124-3p 0 1 0
chr6:43013233|43013356 hsa-miR-124-3p 1 0 0
chr1:202134220|202134364 hsa-miR-124-3p 1 0 0
chr2:101855985|101856138 hsa-miR-124-3p 1 0 0
chr1:19112722|19112790 hsa-miR-124-3p 1 0 0
chr19:50314473|50314527 hsa-miR-124-3p 1 0 0
chr2:101855985|101856123 hsa-miR-124-3p 1 0 0
chr7:30923981|30924192 hsa-miR-124-3p 1 0 0
chr16:47699298|47699500 hsa-miR-124-3p 1 0 0
chr2:74370676|74370804 hsa-miR-124-3p 1 0 0
chr22:50275384|50275499 hsa-miR-124-3p 1 0 0
chr2:101855990|101856138 hsa-miR-124-3p 1 0 0
chr14:104794471|104794603 hsa-miR-124-3p 1 0 0
chr22:49961139|49961347 hsa-miR-124-3p 1 0 0
chr19:55103409|55103533 hsa-miR-124-3p 1 0 0
chr6:31951221|31951593 hsa-miR-124-3p 1 0 0
chr6:31951197|31951406 hsa-miR-124-3p 1 0 0
chr17:75603919|75604110 hsa-miR-124-3p 1 0 0
chr17:58201414|58201565 hsa-miR-124-3p 1 0 0
chr16:47699323|47699500 hsa-miR-124-3p 1 0 0
chr11:65211357|65211475 hsa-miR-124-3p 1 0 0
chr7:157416058|157416244 hsa-miR-124-3p 1 0 0
chr6:159681614|159681849 hsa-miR-124-3p 1 0 0
chr16:67725459|67725574 hsa-miR-124-3p 1 0 0
chr4:110051540|110051703 hsa-miR-124-3p 1 0 0
chr8:143915388|143915641 hsa-miR-124-3p 1 0 0
chr1:166859204|166859297 hsa-miR-124-3p 1 0 0
chr12:56275996|56276118 hsa-miR-124-3p 1 0 0
chr12:557613|557761 hsa-miR-124-3p 1 0 0
chr9:124350944|124351022 hsa-miR-124-3p 0 1 0
chr19:2426718|2426843 hsa-miR-124-3p 0 1 0
chr16:30778720|30778964 hsa-miR-124-3p 0 1 0
chr21:42313498|42313623 hsa-miR-124-3p 0 1 0
chr21:42312209|42313623 hsa-miR-124-3p 0 1 0
chr19:10572775|10573083 hsa-miR-124-3p 0 1 0
chr1:156239681|156239830 hsa-miR-124-3p 0 1 0
chr6:30731065|30740521 hsa-miR-124-3p 0 1 0
chr20:23633932|23635317 hsa-miR-124-3p 0 1 0
chr21:33449178|33449322 hsa-miR-124-3p 0 1 0
chr12:52058904|52059061 hsa-miR-124-3p 0 1 0
chr17:58357143|58357302 hsa-miR-124-3p 0 1 0
chr1:9101396|9101566 hsa-miR-124-3p 0 1 0
chr7:131503804|131503946 hsa-miR-124-3p 0 1 0
chr13:98385684|98385814 hsa-miR-124-3p 0 1 0
chr4:16236319|16236454 hsa-miR-124-3p 0 1 0
chr16:31189737|31190108 hsa-miR-124-3p 0 1 0
chr19:38729763|38729976 hsa-miR-124-3p 0 1 0
chr16:31189735|31190105 hsa-miR-124-3p 0 1 0
chr11:66563686|66563835 hsa-miR-124-3p 0 1 0
chr12:120700163|120700400 hsa-miR-124-3p 0 1 0
chr2:97669462|97669581 hsa-miR-124-3p 0 1 0
chr19:38729760|38729887 hsa-miR-124-3p 0 1 0
chr8:143915714|143915938 hsa-miR-124-3p 0 1 0
chr14:22847163|22847334 hsa-miR-124-3p 0 1 0
chr6:31354159|31354509 hsa-miR-124-3p 0 1 0
chr3:49012976|49013155 hsa-miR-124-3p 0 1 0
chr6:30723491|30723620 hsa-miR-124-3p 0 1 0
chr19:38729727|38729887 hsa-miR-124-3p 0 1 0
chr12:52287997|52288148 hsa-miR-124-3p 0 1 0
chr6:30723540|30723743 hsa-miR-124-3p 0 1 0
chr11:66599187|66599514 hsa-miR-124-3p 0 1 0
chr9:33122713|33122840 hsa-miR-124-3p 0 1 0
chr5:102974295|102974436 hsa-miR-124-3p 0 1 0
chr17:80393976|80394177 hsa-miR-124-3p 0 1 0
chr5:175709350|175709546 hsa-miR-124-3p 0 1 0
chr16:29816946|29817292 hsa-miR-124-3p 0 1 0
chr19:11059832|11060167 hsa-miR-124-3p 0 1 0
chr6:26056036|26056290 hsa-miR-124-3p 0 1 0
chr19:44227790|44227889 hsa-miR-124-3p 0 1 0
chr19:11059864|11060132 hsa-miR-124-3p 0 1 0
chr12:9074560|9153343 hsa-miR-124-3p 0 1 0
chr1:31434268|31434428 hsa-miR-124-3p 0 1 0
chr17:28880195|28880386 hsa-miR-124-3p 0 1 0
chr11:46382598|46382748 hsa-miR-124-3p 0 1 0
chr16:30069499|30069673 hsa-miR-124-3p 0 1 0
chr10:79354005|79354223 hsa-miR-124-3p 0 1 0
chr2:218404667|218404914 hsa-miR-124-3p 0 1 0
chr6:31355168|31355492 hsa-miR-124-3p 0 1 0
chr6:26056036|26056173 hsa-miR-124-3p 0 1 0
chr5:83542166|83542268 hsa-miR-124-3p 0 1 0
chr6:38152732|38152893 hsa-miR-124-3p 0 1 0
chr19:11059849|11060132 hsa-miR-124-3p 0 1 0
chr16:57154242|57154369 hsa-miR-124-3p 0 1 0
chr5:150401856|150401990 hsa-miR-124-3p 0 1 0
chr19:48874007|48874132 hsa-miR-124-3p 0 1 0
chr5:150401652|150401990 hsa-miR-124-3p 0 1 0
chr20:23633947|23635305 hsa-miR-124-3p 0 1 0
chr11:85748272|85748389 hsa-miR-124-3p 0 1 0
chr16:31189735|31190120 hsa-miR-124-3p 0 1 0
chr6:7579678|7579772 hsa-miR-124-3p 0 1 0
chrX:40663003|40663088 hsa-miR-124-3p 0 1 0
chr4:168890922|168894606 hsa-miR-124-3p 0 1 0
chr16:4381136|4381402 hsa-miR-124-3p 0 1 0
chr14:91785271|91785347 hsa-miR-124-3p 0 1 0
chr2:27238431|27238547 hsa-miR-124-3p 0 1 0
chr2:189053930|189057016 hsa-miR-124-3p 0 1 0
chr12:56122586|56122763 hsa-miR-124-3p 0 1 0
chr3:49123716|49123930 hsa-miR-124-3p 0 1 0
chr10:79354031|79354223 hsa-miR-124-3p 0 1 0
chr19:38729760|38729934 hsa-miR-124-3p 0 1 0
chr6:31355177|31355441 hsa-miR-124-3p 0 1 0
chr6:31354178|31354526 hsa-miR-124-3p 0 1 0
chrX:48902008|48902374 hsa-miR-124-3p 0 1 0
chr16:31189774|31190141 hsa-miR-124-3p 0 1 0
chr7:2538302|2538460 hsa-miR-124-3p 0 1 0
chr21:42312220|42313599 hsa-miR-124-3p 0 1 0
chr19:39383210|39383596 hsa-miR-124-3p 0 1 0
chr19:11059852|11060132 hsa-miR-124-3p 0 1 0
chr8:143923104|143923244 hsa-miR-124-3p 0 1 0
chr11:46382587|46382736 hsa-miR-124-3p 0 1 0
chr16:67882546|67882743 hsa-miR-124-3p 0 1 0
chr6:31268982|31269144 hsa-miR-124-3p 0 1 0
chr11:65115916|65116120 hsa-miR-124-3p 0 1 0
chr11:66599187|66599502 hsa-miR-124-3p 0 1 0
chr7:100097614|100097852 hsa-miR-124-3p 0 1 0
chr17:80393370|80393606 hsa-miR-124-3p 0 1 0
chr17:17812395|17812640 hsa-miR-124-3p 0 1 0
chr12:57823408|57823676 hsa-miR-124-3p 0 1 0
chr10:100987978|100988229 hsa-miR-124-3p 0 1 0
chr6:2854428|2854573 hsa-miR-124-3p 0 1 0
chr11:75796346|75796475 hsa-miR-124-3p 0 1 0
chr19:38729722|38729894 hsa-miR-124-3p 0 1 0
chr2:218405332|218405544 hsa-miR-124-3p 0 1 0
chr12:53060982|53061140 hsa-miR-124-3p 0 1 0
chr16:29801707|29801838 hsa-miR-124-3p 0 1 0
chr11:43446153|43446241 hsa-miR-124-3p 0 1 0
chr19:1108069|1108248 hsa-miR-124-3p 0 1 0
chr16:31189774|31190108 hsa-miR-124-3p 0 1 0
chr9:137242696|137242814 hsa-miR-124-3p 0 1 0
chr11:65044361|65044465 hsa-miR-124-3p 0 1 0
chr16:30069528|30069673 hsa-miR-124-3p 0 1 0
chr2:97658255|97658620 hsa-miR-124-3p 0 1 0
chr1:108934804|108934884 hsa-miR-124-3p 0 1 0
chr8:143924788|143924888 hsa-miR-124-3p 0 1 0
chr11:65188422|65188746 hsa-miR-124-3p 0 1 0
chr17:68422762|68422993 hsa-miR-124-3p 0 1 0
chr16:31189735~31190108 hsa-miR-124-3p 0 1 0
chr19:12875688~12875976 hsa-miR-124-3p 0 1 0
chr10:79354027~79354223 hsa-miR-124-3p 0 1 0
chr10:46005556~46005651 hsa-miR-124-3p 0 1 0
chr11:821058~821199 hsa-miR-124-3p 0 1 0
chr16:31189737~31190120 hsa-miR-124-3p 0 1 0
chr20:35279632~35279732 hsa-miR-124-3p 0 1 0
chr12:132833100~132833221 hsa-miR-124-3p 0 1 0
chr16:31189735~31190105 hsa-miR-124-3p 0 1 0
chr16:15703227~15703353 hsa-miR-124-3p 0 1 0
chr19:38729722~38729976 hsa-miR-124-3p 0 1 0
chr11:43446114~43446241 hsa-miR-124-3p 0 1 0
chr16:31189708~31190105 hsa-miR-124-3p 0 1 0
chr6:32443758|32443921 hsa-miR-124-3p 0 1 0
chr16:67229631~67229857 hsa-miR-124-3p 0 1 0
chr1:31434268~31434428 hsa-miR-124-3p 0 1 0
chr19:38729760~38729887 hsa-miR-124-3p 0 1 0
chr2:30259027~30259158 hsa-miR-124-3p 0 1 0
chr6:31354159~31354653 hsa-miR-124-3p 0 1 0
chr16:31189731~31190108 hsa-miR-124-3p 0 1 0
chr1:156239741~156239927 hsa-miR-124-3p 0 1 0
chr16:31189737~31190108 hsa-miR-124-3p 0 1 0
chr14:22847143~22847334 hsa-miR-124-3p 0 1 0
chr6:26056036~26056173 hsa-miR-124-3p 0 1 0
chr8:656511~656715 hsa-miR-124-3p 0 1 0
chr2:138901958~138902208 hsa-miR-124-3p 0 1 0
chr2:75664409~75664532 hsa-miR-124-3p 0 1 0
chr11:46382587~46382705 hsa-miR-124-3p 0 1 0
chr17:81466004~81466177 hsa-miR-124-3p 0 1 0
chr11:66563686~66563833 hsa-miR-124-3p 0 1 0
chr12:53060927~53061140 hsa-miR-124-3p 0 1 0
chr3:58430818~58430910 hsa-miR-124-3p 0 1 0
chr5:179609866~179609975 hsa-miR-124-3p 0 1 0
chr5:150401856~150402004 hsa-miR-124-3p 0 1 0
chr11:46382638~46382748 hsa-miR-124-3p 0 1 0
chr14:93237817~93237931 hsa-miR-124-3p 0 1 0
chr16:31189737~31190105 hsa-miR-124-3p 0 1 0
chr19:47209186~47209297 hsa-miR-124-3p 0 1 0
chr21:42313498~42313623 hsa-miR-124-3p 0 1 0
chr6:31268998~31269144 hsa-miR-124-3p 0 1 0
chr16:31189712~31190108 hsa-miR-124-3p 0 1 0
chr11:61313893~61314173 hsa-miR-124-3p 0 1 0
chr2:233471040~233471233 hsa-miR-124-3p 0 1 0
chr12:9654926~9655051 hsa-miR-124-3p 0 1 0
chr19:48874050~48874172 hsa-miR-124-3p 0 1 0
chr1:223759294~223759415 hsa-miR-124-3p 0 1 0
chr5:43105654~43105781 hsa-miR-124-3p 0 1 0
chr9:129008207~129008374 hsa-miR-124-3p 0 1 0
chr11:43446069~43446241 hsa-miR-124-3p 0 1 0
chr2:85581593~85581728 hsa-miR-124-3p 0 1 0
chr6:31355146~31355436 hsa-miR-124-3p 0 1 0
chr8:143922177~143922302 hsa-miR-124-3p 0 1 0
chr15:78932541~78932660 hsa-miR-124-3p 0 1 0
chr16:31189712~31190105 hsa-miR-124-3p 0 1 0
chr2:227560592~227560650 hsa-miR-124-3p 0 1 0
chr7:157416058~157416244 hsa-miR-124-3p 0 1 0
chr11:46382587~46382748 hsa-miR-124-3p 0 1 0
chr9:137242696~137243024 hsa-miR-124-3p 0 1 0
chr11:65653881|65653944 hsa-miR-124-3p 0 1 0
chr1:156464860|156465066 hsa-miR-124-3p 0 1 0
chr11:46382647~46382748 hsa-miR-124-3p 0 1 0
chr19:11059867~11060187 hsa-miR-124-3p 0 1 0
chr19:49491935~49492126 hsa-miR-124-3p 0 1 0
chr1:156464860~156465066 hsa-miR-124-3p 0 1 0
chr6:31268945~31269173 hsa-miR-124-3p 0 1 0
chr6:31355177~31355436 hsa-miR-124-3p 0 1 0
chr16:31189735~31190117 hsa-miR-124-3p 0 1 0
chr17:5628304~5628414 hsa-miR-124-3p 0 1 0
chr5:60488293~60489674 hsa-miR-124-3p 0 1 0
chr19:38729730~38729887 hsa-miR-124-3p 0 1 0
chr2:85581596~85581742 hsa-miR-124-3p 0 1 0
chr6:32443792~32443921 hsa-miR-124-3p 0 1 0
chr3:69171766~69171938 hsa-miR-124-3p 0 1 0
chr16:2765547~2765747 hsa-miR-124-3p 0 1 0
chr6:31354178~31354290 hsa-miR-124-3p 0 1 0
chr10:12122972~12123088 hsa-miR-124-3p 0 1 0
chr16:31189731~31190105 hsa-miR-124-3p 0 1 0
chr5:150401856~150402011 hsa-miR-124-3p 0 1 0
chr6:31268982~31269144 hsa-miR-124-3p 0 1 0
chr15:65196777~65197054 hsa-miR-124-3p 0 1 0
chr1:149944007~149944202 hsa-miR-124-3p 0 1 0
chr6:163411581|163411869 hsa-miR-124-3p 1 0 0
chrX:134413491|134413966 hsa-miR-124-3p 1 0 0
chr3:49807682|49807795 hsa-miR-124-3p 1 0 0
chr19:19505684|19505771 hsa-miR-124-3p 1 0 0
chr12:6581044|6581143 hsa-miR-124-3p 1 0 0
chr14:76220131|76220288 hsa-miR-124-3p 1 0 0
chr19:13765213|13765373 hsa-miR-124-3p 1 0 0
chr6:37637702|37637845 hsa-miR-124-3p 0 1 0
chr19:810899|811168 hsa-miR-124-3p 0 1 0
chr9:137084057|137084158 hsa-miR-124-3p 0 1 0
chrX:119442165|119442269 hsa-miR-124-3p 0 1 0
chr14:23050579|23050765 hsa-miR-124-3p 0 1 0
chr19:55608636|55608784 hsa-miR-124-3p 0 1 0
chr17:58279340|58279908 hsa-miR-124-3p 0 1 0
chr9:77852396|77852567 hsa-miR-124-3p 0 1 0
chr20:430451|430638 hsa-miR-124-3p 0 1 0
chr2:27366759|27366893 hsa-miR-124-3p 0 1 0
chr17:57971782|57971958 hsa-miR-124-3p 0 1 0
chr7:44666266|44666430 hsa-miR-124-3p 0 1 0
chr2:85607718|85607878 hsa-miR-124-3p 0 1 0
chr1:31365065|31365259 hsa-miR-124-3p 0 1 0
chr17:58279358|58279590 hsa-miR-124-3p 0 1 0
chr17:3940996|3941252 hsa-miR-124-3p 0 1 0
chr2:218404794|218404914 hsa-miR-124-3p 0 1 0
chrX:56993006|56993124 hsa-miR-124-3p 0 1 0
chr8:38834353|38834563 hsa-miR-124-3p 0 1 0
chr19:12938892|12939008 hsa-miR-124-3p 0 1 0
chr22:19719806|19720152 hsa-miR-124-3p 0 1 0
chr6:35576755|35576844 hsa-miR-124-3p 0 1 0
chr3:42095942|42096148 hsa-miR-124-3p 0 1 0
chr6:30644924|30645162 hsa-miR-124-3p 0 1 0
chr18:79717627|79717879 hsa-miR-124-3p 0 1 0
chr17:81466004|81466177 hsa-miR-124-3p 0 1 0
chr1:171504545|171504698 hsa-miR-124-3p 0 1 0
chr16:2769986|2770116 hsa-miR-124-3p 0 1 0
chr6:31269037|31269356 hsa-miR-124-3p 0 1 0
chr21:15030839|15030988 hsa-miR-124-3p 0 1 0
chr17:30468403|30468621 hsa-miR-124-3p 0 1 0
chr7:98289383|98289581 hsa-miR-124-3p 0 1 0
chr2:218403386|218403580 hsa-miR-124-3p 0 1 0
chr1:231700679|231700810 hsa-miR-124-3p 0 1 0
chr6:30723560|30723724 hsa-miR-124-3p 0 1 0
chr16:57470023|57470354 hsa-miR-124-3p 0 1 0
chr15:57307293|57307414 hsa-miR-124-3p 0 1 0
chr8:143950464|143950595 hsa-miR-124-3p 1 0 0
chr3:10291240|10291386 hsa-miR-124-3p 1 0 0
chr11:65436582|65436810 hsa-miR-124-3p 1 0 0
chr5:131694611|131694729 hsa-miR-124-3p 1 0 0
chr12:6581044|6581134 hsa-miR-124-3p 1 0 0
chr17:58270683|58279398 hsa-miR-124-3p 1 0 0
chr11:64776498|64776626 hsa-miR-124-3p 1 0 0
chr18:77105211|77105286 hsa-miR-124-3p 1 0 0
chr9:127947686|127947924 hsa-miR-124-3p 0 1 0
chr22:37925979|37926207 hsa-miR-124-3p 0 1 0
chr11:65120821|65121078 hsa-miR-124-3p 0 1 0
chr16:12173146|12173327 hsa-miR-124-3p 0 1 0
chr3:121634207|121634344 hsa-miR-124-3p 0 1 0
chr17:4973968|4974076 hsa-miR-124-3p 0 1 0
chrX:154364259|154364543 hsa-miR-124-3p 0 1 0
chr5:172983860|172994798 hsa-miR-124-3p 0 1 0
chr1:230263643|230263754 hsa-miR-124-3p 0 1 0
chr6:31269037|31269368 hsa-miR-124-3p 0 1 0
chr14:99170586|99170767 hsa-miR-124-3p 0 1 0
chr6:28158960|28159145 hsa-miR-124-3p 0 1 0
chr17:28880217|28880386 hsa-miR-124-3p 0 1 0
chr22:26579161|26579319 hsa-miR-124-3p 0 1 0
chr6:30491237|30491583 hsa-miR-124-3p 0 1 0
chr16:2765547|2765717 hsa-miR-124-3p 0 1 0
chr16:67882502|67882865 hsa-miR-124-3p 0 1 0
chr17:57551412|57551553 hsa-miR-124-3p 0 1 0
chr3:37166627|37166787 hsa-miR-124-3p 0 1 0
chr12:4274310|4274442 hsa-miR-124-3p 0 1 0
chr13:28030394|28030515 hsa-miR-124-3p 0 1 0
chr18:79717627|79717909 hsa-miR-124-3p 0 1 0
chr22:24302679|24302806 hsa-miR-124-3p 0 1 0
chr1:12319497|12319587 hsa-miR-124-3p 0 1 0
chr1:156239681|156239815 hsa-miR-124-3p 0 1 0
chr19:54215007|54215154 hsa-miR-124-3p 0 1 0
chr6:72797963|72798089 hsa-miR-124-3p 0 1 0
chr2:178653238|178663902 hsa-miR-124-3p 0 1 0
chr17:4893521|4893668 hsa-miR-124-3p 0 1 0
chr3:9810869|9811070 hsa-miR-124-3p 0 1 0
chr3:98515686|98515807 hsa-miR-124-3p 0 1 0
chr17:21172252|21172444 hsa-miR-124-3p 0 1 0
chr11:73972168|73972336 hsa-miR-124-3p 0 1 0
chr11:3119761|3120046 hsa-miR-124-3p 0 1 0
chr1:52441657|52441822 hsa-miR-124-3p 0 1 0
chr2:96250227|96250437 hsa-miR-124-3p 1 0 0
chr14:67199466|67199782 hsa-miR-124-3p 1 0 0
chr15:40767410|40767560 hsa-miR-124-3p 1 0 0
chrX:153930079|153930193 hsa-miR-124-3p 1 0 0
chr6:159681681|159681872 hsa-miR-124-3p 1 0 0
chr6:30601533|30601647 hsa-miR-124-3p 1 0 0
chr8:143915298|143915641 hsa-miR-124-3p 1 0 0
chr7:38776382|38776529 hsa-miR-124-3p 1 0 0
chr19:13831788|13831967 hsa-miR-124-3p 1 0 0
chr2:27449714|27450032 hsa-miR-124-3p 1 0 0
chr17:5210068|5210142 hsa-miR-124-3p 1 0 0
chr5:132761494|132761826 hsa-miR-124-3p 1 0 0
chr6:31951221|31951406 hsa-miR-124-3p 1 0 0
chr22:50275321|50275465 hsa-miR-124-3p 1 0 0
chr19:7535741|7535971 hsa-miR-124-3p 1 0 0
chr15:40767410|40767568 hsa-miR-124-3p 1 0 0
chr6:159681678|159681846 hsa-miR-124-3p 1 0 0
chr19:5993859|5993960 hsa-miR-124-3p 1 0 0
chrX:12976786|12977000 hsa-miR-124-3p 1 0 0
chr6:26452346|26452465 hsa-miR-124-3p 1 0 0
chr2:214767482|214781509 hsa-miR-124-3p 1 0 0
chrX:53086139|53086310 hsa-miR-124-3p 1 0 0
chr8:144411046|144411215 hsa-miR-124-3p 1 0 0
chr8:143915433|143915634 hsa-miR-124-3p 1 0 0
chr16:47699395|47699500 hsa-miR-124-3p 1 0 0
chr19:3496571|3496836 hsa-miR-124-3p 1 0 0
chr9:131495999|131496144 hsa-miR-124-3p 1 0 0
chr19:2247615|2247878 hsa-miR-124-3p 1 0 0
chr11:65211362|65211648 hsa-miR-124-3p 1 0 0
chr1:150965718|150965906 hsa-miR-124-3p 1 0 0
chr7:30923973|30924179 hsa-miR-124-3p 1 0 0
chr11:17087316|17087449 hsa-miR-124-3p 1 0 0
chr19:57261352|57261515 hsa-miR-124-3p 1 0 0
chr18:79193183|79214038 hsa-miR-124-3p 1 0 0
chr12:132833100|132833221 hsa-miR-124-3p 0 1 0
chr11:65605398|65605510 hsa-miR-124-3p 0 1 0
chr1:227661691|227661796 hsa-miR-124-3p 0 1 0
chr6:30731032|30740521 hsa-miR-124-3p 0 1 0
chr19:48874047|48874213 hsa-miR-124-3p 0 1 0
chr19:10285774|10285961 hsa-miR-124-3p 0 1 0
chr19:48874047|48874167 hsa-miR-124-3p 0 1 0
chr1:20650937|20651116 hsa-miR-124-3p 0 1 0
chr14:22847163|22847289 hsa-miR-124-3p 0 1 0
chr3:45679580|45679729 hsa-miR-124-3p 0 1 0
chr6:42692312|42692592 hsa-miR-124-3p 0 1 0
chr16:64949650|64949816 hsa-miR-124-3p 0 1 0
chr6:31354159|31354260 hsa-miR-124-3p 0 1 0
chr6:31354178|31354509 hsa-miR-124-3p 0 1 0
chr16:31189731|31190120 hsa-miR-124-3p 0 1 0
chr7:2253178|2253296 hsa-miR-124-3p 0 1 0
chr22:29049644|29049741 hsa-miR-124-3p 0 1 0
chr19:10285619|10285961 hsa-miR-124-3p 0 1 0
chr5:102974287|102974436 hsa-miR-124-3p 0 1 0
chr1:223759284|223759415 hsa-miR-124-3p 0 1 0
chr16:28844004|28844309 hsa-miR-124-3p 0 1 0
chr19:48874027|48874172 hsa-miR-124-3p 0 1 0
chr14:69711314|69711494 hsa-miR-124-3p 0 1 0
chr19:10643847|10644083 hsa-miR-124-3p 0 1 0
chr6:31355182|31355492 hsa-miR-124-3p 0 1 0
chr5:132272025|132272279 hsa-miR-124-3p 0 1 0
chr13:98385760|98385814 hsa-miR-124-3p 0 1 0
chr9:136497128|136497276 hsa-miR-124-3p 0 1 0
chr6:31354178|31354274 hsa-miR-124-3p 0 1 0
chr17:27643775|27643905 hsa-miR-124-3p 0 1 0
chr5:150401856|150402011 hsa-miR-124-3p 0 1 0
chr11:66563686|66563848 hsa-miR-124-3p 0 1 0
chr12:47751472|47751770 hsa-miR-124-3p 0 1 0
chr17:7501348|7501587 hsa-miR-124-3p 0 1 0
chr6:63280251|63280350 hsa-miR-124-3p 0 1 0
chr1:20650819|20650994 hsa-miR-124-3p 0 1 0
chr11:71435311|71435461 hsa-miR-124-3p 0 1 0
chr16:31189735|31190117 hsa-miR-124-3p 0 1 0
chr17:80393951|80394177 hsa-miR-124-3p 0 1 0
chr2:162267678|162267889 hsa-miR-124-3p 0 1 0
chr8:123182855|123183033 hsa-miR-124-3p 0 1 0
chr19:2426653|2426829 hsa-miR-124-3p 0 1 0
chr16:31189731|31190108 hsa-miR-124-3p 0 1 0
chr7:2253178|2253387 hsa-miR-124-3p 0 1 0
chr11:43446107|43446241 hsa-miR-124-3p 0 1 0
chr2:95053570|95053676 hsa-miR-124-3p 0 1 0
chr19:811075|811172 hsa-miR-124-3p 0 1 0
chr11:45881659|45882028 hsa-miR-124-3p 0 1 0
chr16:19497990|19498095 hsa-miR-124-3p 0 1 0
chr20:45960309|45960504 hsa-miR-124-3p 0 1 0
chr19:57844956|57845090 hsa-miR-124-3p 0 1 0
chr17:21418182|21418384 hsa-miR-124-3p 0 1 0
chr16:29819314|29819416 hsa-miR-124-3p 0 1 0
chr19:10643847|10644027 hsa-miR-124-3p 0 1 0
chr1:183244661|183244838 hsa-miR-124-3p 0 1 0
chr2:218404667|218404841 hsa-miR-124-3p 0 1 0
chr16:31189737|31190117 hsa-miR-124-3p 0 1 0
chr11:43445950|43446241 hsa-miR-124-3p 0 1 0
chr6:31269037|31269513 hsa-miR-124-3p 0 1 0
chr17:7228089|7228301 hsa-miR-124-3p 0 1 0
chr11:46382638|46382748 hsa-miR-124-3p 0 1 0
chr15:43408965|43409088 hsa-miR-124-3p 0 1 0
chr16:31189712|31190108 hsa-miR-124-3p 0 1 0
chr16:61373|61651 hsa-miR-124-3p 0 1 0
chr22:35665442|35665574 hsa-miR-124-3p 0 1 0
chr13:20974083|20974237 hsa-miR-124-3p 0 1 0
chr16:28844079|28844467 hsa-miR-124-3p 0 1 0
chr5:150401856|150401957 hsa-miR-124-3p 0 1 0
chr17:78345771|78346106 hsa-miR-124-3p 0 1 0
chr6:31354159|31354653 hsa-miR-124-3p 0 1 0
chr3:50258912|50259076 hsa-miR-124-3p 0 1 0
chr11:46382604|46382748 hsa-miR-124-3p 0 1 0
chr12:120212289|120212424 hsa-miR-124-3p 0 1 0
chr2:85581633|85581835 hsa-miR-124-3p 0 1 0
chr4:184656181|184656300 hsa-miR-124-3p 0 1 0
chr19:10285768|10285961 hsa-miR-124-3p 0 1 0
chr5:102974253|102974436 hsa-miR-124-3p 0 1 0
chr17:76084027|76084280 hsa-miR-124-3p 0 1 0
chr16:29816976|29817292 hsa-miR-124-3p 0 1 0
chr17:77215285|77215500 hsa-miR-124-3p 0 1 0
chrX:48901991|48902374 hsa-miR-124-3p 0 1 0
chr21:45223459|45223616 hsa-miR-124-3p 0 1 0
chr12:54286137|54286282 hsa-miR-124-3p 0 1 0
chr1:155187295|155187525 hsa-miR-124-3p 0 1 0
chr20:37943990|37944106 hsa-miR-124-3p 0 1 0
chr3:105702252|105702362 hsa-miR-124-3p 0 1 0
chr11:824872|825065 hsa-miR-124-3p 0 1 0
chr19:46624997|46625105 hsa-miR-124-3p 0 1 0
chr19:49491955|49492196 hsa-miR-124-3p 0 1 0
chr11:65115904|65116120 hsa-miR-124-3p 0 1 0
chr15:64680232|64680334 hsa-miR-124-3p 0 1 0
chr2:135135591|135135719 hsa-miR-124-3p 0 1 0
chr6:31354159|31354656 hsa-miR-124-3p 0 1 0
chr10:63623365|63623498 hsa-miR-124-3p 0 1 0
chr6:78939142|78939328 hsa-miR-124-3p 0 1 0
chr11:63570638|63570722 hsa-miR-124-3p 0 1 0
chr17:28880195|28880352 hsa-miR-124-3p 0 1 0
chrX:154449718|154450099 hsa-miR-124-3p 0 1 0
chr11:43446102|43446241 hsa-miR-124-3p 0 1 0
chr19:37363433|37363555 hsa-miR-124-3p 0 1 0
chr20:45960299|45960507 hsa-miR-124-3p 0 1 0
chr14:89161973|89162051 hsa-miR-124-3p 0 1 0
chr17:75899525|75899622 hsa-miR-124-3p 0 1 0
chr22:49963158|49963310 hsa-miR-124-3p 0 1 0
chr9:69248019|69248224 hsa-miR-124-3p 0 1 0
chr7:74705164|74718941 hsa-miR-124-3p 0 1 0
chr6:38575947|38576023 hsa-miR-124-3p 0 1 0
chr4:168890922|168903906 hsa-miR-124-3p 0 1 0
chr3:32703868|32704972 hsa-miR-124-3p 0 1 0
chr8:86402019|86402203 hsa-miR-124-3p 0 1 0
chr6:43621694|43622025 hsa-miR-124-3p 0 1 0
chr12:49653734|49653874 hsa-miR-124-3p 0 1 0
chr15:40161039|40161248 hsa-miR-124-3p 0 1 0
chr1:20650779|20650994 hsa-miR-124-3p 0 1 0
chr1:20650934|20651116 hsa-miR-124-3p 0 1 0
chr7:92093164|92093316 hsa-miR-124-3p 0 1 0
chr5:169604284|169604401 hsa-miR-124-3p 0 1 0
chr2:62000701|62000982 hsa-miR-124-3p 0 1 0
chr3:128262128|128264781 hsa-miR-124-3p 0 1 0
chr19:10285774|10285967 hsa-miR-124-3p 0 1 0
chr5:102974318|102974436 hsa-miR-124-3p 0 1 0
chr16:2036749|2036998 hsa-miR-124-3p 0 1 0
chr3:50258967|50259185 hsa-miR-124-3p 0 1 0
chr6:43621694|43622070 hsa-miR-124-3p 0 1 0
chr19:38729760|38729976 hsa-miR-124-3p 0 1 0
chr19:38729722|38729976 hsa-miR-124-3p 0 1 0
chr21:42312209|42313581 hsa-miR-124-3p 0 1 0
chr2:75191557|75191775 hsa-miR-124-3p 0 1 0
chr7:143305665|143305844 hsa-miR-124-3p 0 1 0
chr19:48874050|48874167 hsa-miR-124-3p 0 1 0
chr19:10285666|10285961 hsa-miR-124-3p 0 1 0
chr15:78932541|78932696 hsa-miR-124-3p 0 1 0
chr12:122862077|122862210 hsa-miR-124-3p 0 1 0
chr6:31270044|31270334 hsa-miR-124-3p 0 1 0
chr16:28844004|28844324 hsa-miR-124-3p 0 1 0
chr6:26056036|26056171 hsa-miR-124-3p 0 1 0
chr6:30740158|30740256 hsa-miR-124-3p 0 1 0
chr6:30723509|30723620 hsa-miR-124-3p 0 1 0
chr16:31189777|31190141 hsa-miR-124-3p 0 1 0
chr9:128062307|128062505 hsa-miR-124-3p 0 1 0
chr17:80344747|80344970 hsa-miR-124-3p 0 1 0
chr6:31354159|31354526 hsa-miR-124-3p 0 1 0
chr6:26056036|26056269 hsa-miR-124-3p 0 1 0
chr19:38729722|38729887 hsa-miR-124-3p 0 1 0
chr6:31354159|31354522 hsa-miR-124-3p 0 1 0
chr11:65411739|65411867 hsa-miR-124-3p 0 1 0
chr6:30731065|30740310 hsa-miR-124-3p 0 1 0
chr7:143305665|143305846 hsa-miR-124-3p 0 1 0
chr16:29816985|29817292 hsa-miR-124-3p 0 1 0
chr3:52401283|52401536 hsa-miR-124-3p 0 1 0
chr6:159681649|159681774 hsa-miR-124-3p 0 1 0
chr16:31189768|31190105 hsa-miR-124-3p 0 1 0
chr15:85748315|85748418 hsa-miR-124-3p 0 1 0
chr19:11059849|11060187 hsa-miR-124-3p 0 1 0
chr17:42673399|42673519 hsa-miR-124-3p 0 1 0
chr17:4938557|4938915 hsa-miR-124-3p 0 1 0
chr19:6751328|6751442 hsa-miR-124-3p 0 1 0
chr8:123182811|123183012 hsa-miR-124-3p 0 1 0
chr3:9784028|9784140 hsa-miR-124-3p 0 1 0
chr11:43446069|43446241 hsa-miR-124-3p 0 1 0
chr5:179805234|179805389 hsa-miR-124-3p 0 1 0
chr7:139423105|139423342 hsa-miR-124-3p 0 1 0
chr5:150401856|150402000 hsa-miR-124-3p 0 1 0
chr5:102974320|102974436 hsa-miR-124-3p 0 1 0
chr10:15515298|15515444 hsa-miR-124-3p 0 1 0
chr11:46382416|46382748 hsa-miR-124-3p 0 1 0
chr12:53060949|53061140 hsa-miR-124-3p 0 1 0
chr16:31189708|31190105 hsa-miR-124-3p 0 1 0
chr19:41426725|41426851 hsa-miR-124-3p 0 1 0
chr1:15733966|15734155 hsa-miR-124-3p 0 1 0
chr1:151697328|151697574 hsa-miR-124-3p 0 1 0
chr19:19055791|19055922 hsa-miR-124-3p 0 1 0
chr1:180197698|180197970 hsa-miR-124-3p 0 1 0
chr4:131977941|131978155 hsa-miR-124-3p 0 1 0
chr6:31270039|31270334 hsa-miR-124-3p 0 1 0
chr22:41906912|41907228 hsa-miR-124-3p 0 1 0
chr9:128328254|128328401 hsa-miR-124-3p 0 1 0
chr16:2765646|2765955 hsa-miR-124-3p 0 1 0
chr5:112834959|112835138 hsa-miR-124-3p 0 1 0
chr16:89300242|89300446 hsa-miR-124-3p 0 1 0
chr10:70562017|70562160 hsa-miR-124-3p 0 1 0
chr19:48873933|48874172 hsa-miR-124-3p 0 1 0
chr5:150401856|150401936 hsa-miR-124-3p 0 1 0
chr19:49491918|49492126 hsa-miR-124-3p 0 1 0
chr1:241594209|241594321 hsa-miR-124-3p 0 1 0
chr6:32443792|32443921 hsa-miR-124-3p 0 1 0
chr19:10285810|10285967 hsa-miR-124-3p 0 1 0
chr22:30026342|30026504 hsa-miR-124-3p 0 1 0
chr19:54217010|54217142 hsa-miR-124-3p 0 1 0
chr3:50108086|50109631 hsa-miR-124-3p 0 1 0
chr9:137614032|137614160 hsa-miR-124-3p 0 1 0
chr19:10285810|10285961 hsa-miR-124-3p 0 1 0
chr6:26545370|26545475 hsa-miR-124-3p 0 1 0
chr6:32443785|32443921 hsa-miR-124-3p 0 1 0
chr13:72758586|72758729 hsa-miR-124-3p 0 1 0
chr6:32443794|32443921 hsa-miR-124-3p 0 1 0
chr6:32443756|32443921 hsa-miR-124-3p 0 1 0
chr6:43520075|43520172 hsa-miR-124-3p 0 1 0
chr8:143725574|143725702 hsa-miR-124-3p 0 1 0
chr10:72887259|72887425 hsa-miR-124-3p 0 1 0
chr19:11441247|11441357 hsa-miR-124-3p 0 1 0
chr8:143725591|143725702 hsa-miR-124-3p 0 1 0
chr3:50108125|50109631 hsa-miR-124-3p 0 1 0
chrX:5890185|5890310 hsa-miR-124-3p 0 1 0
chr4:154584420|154584550 hsa-miR-124-3p -12 1 0
chr6:31355177|31355420 hsa-miR-124-3p -4 1 0
chr17:28880237|28880386 hsa-miR-124-3p -13 1 0
chr6:35427306|35427662 hsa-miR-124-3p -10 1 0
chr7:139423156|139423342 hsa-miR-124-3p -12 1 0
chr8:97277766|97277922 hsa-miR-124-3p -14 1 0
chr1:67340978|67341180 hsa-miR-124-3p -13 1 0
chr12:16600714|16600833 hsa-miR-124-3p -11 1 0
chr17:32393891|32394065 hsa-miR-124-3p -6 1 0
chr19:19495851|19496165 hsa-miR-124-3p -5 1 0
chr8:143922126|143922281 hsa-miR-124-3p -6 1 0
chr6:31355177|31355458 hsa-miR-124-3p -4 1 0
chr2:24205378|24205597 hsa-miR-124-3p -11 1 0
chr1:10379219|10379388 hsa-miR-124-3p -13 1 0
chr14:22847137|22847289 hsa-miR-124-3p -15 1 0
chr10:133415859|133416018 hsa-miR-124-3p -18 1 0
chr4:107952010|107952176 hsa-miR-124-3p -9 1 0
chr21:34525061|34525228 hsa-miR-124-3p 0 1 0
chr5:84060316|84060454 hsa-miR-124-3p 1 0 0
chr17:40922921|40923048 hsa-miR-124-3p 1 0 0
chr22:49961318|49961465 hsa-miR-124-3p 1 0 0
chr5:146083262|146083340 hsa-miR-124-3p 1 0 0
chr2:27449922|27450047 hsa-miR-124-3p 1 0 0
chr15:40767410|40767547 hsa-miR-124-3p 1 0 0
chr8:140511979|140512067 hsa-miR-124-3p 1 0 0
chr2:101844294|101856138 hsa-miR-124-3p 1 0 0
chr22:50275351|50275465 hsa-miR-124-3p 1 0 0
chr6:159681726|159681849 hsa-miR-124-3p 1 0 0
chr6:31951221|31951473 hsa-miR-124-3p 1 0 0
chrX:73827398|73827602 hsa-miR-124-3p 1 0 0
chr15:40767410|40767664 hsa-miR-124-3p 1 0 0
chr20:18011329|18011545 hsa-miR-124-3p 1 0 0
chr15:64947164|64947322 hsa-miR-124-3p 1 0 0
chr12:51048488|51048759 hsa-miR-124-3p 1 0 0
chr11:65211352|65211591 hsa-miR-124-3p 1 0 0
chr19:54168228|54168484 hsa-miR-124-3p 1 0 0
chr2:74370697|74370804 hsa-miR-124-3p 1 0 0
chr19:13831794|13831982 hsa-miR-124-3p 1 0 0
chr2:96250220|96250347 hsa-miR-124-3p 1 0 0
chr3:42223797|42223946 hsa-miR-124-3p 1 0 0
chr17:2712715|2712829 hsa-miR-124-3p 1 0 0
chr4:7060937|7061176 hsa-miR-124-3p 1 0 0
chr5:141863371|141863486 hsa-miR-124-3p 1 0 0
chr1:38839504|38839695 hsa-miR-124-3p 1 0 0
chr22:49961130|49961355 hsa-miR-124-3p 1 0 0
chrX:51743611|51743838 hsa-miR-124-3p 1 0 0
chr7:92534524|92534624 hsa-miR-124-3p 1 0 0
chr9:98783994|98784136 hsa-miR-124-3p 1 0 0
chr1:9850006|9850132 hsa-miR-124-3p 1 0 0
chr2:101855990|101856123 hsa-miR-124-3p 1 0 0
chr6:143828203|143828340 hsa-miR-124-3p 1 0 0
chr16:2765560|2765747 hsa-miR-124-3p 0 1 0
chr12:120212267|120212424 hsa-miR-124-3p 0 1 0
chr16:15703227|15703353 hsa-miR-124-3p 0 1 0
chr14:73964154|73964448 hsa-miR-124-3p 0 1 0
chr16:28844017|28844307 hsa-miR-124-3p 0 1 0
chr14:104937337|104937498 hsa-miR-124-3p 0 1 0
chr11:65887600|65887950 hsa-miR-124-3p 0 1 0
chr9:33121073|33121164 hsa-miR-124-3p 0 1 0
chr19:10572775|10572928 hsa-miR-124-3p 0 1 0
chr3:193647071|193647180 hsa-miR-124-3p 0 1 0
chr7:101206140|101206277 hsa-miR-124-3p 0 1 0
chr6:31355146|31355492 hsa-miR-124-3p 0 1 0
chr1:31434285|31434432 hsa-miR-124-3p 0 1 0
chr19:48874050|48874172 hsa-miR-124-3p 0 1 0
chr19:10923589|10923865 hsa-miR-124-3p 0 1 0
chr6:31355146|31355420 hsa-miR-124-3p 0 1 0
chr19:38729641|38729894 hsa-miR-124-3p 0 1 0
chr22:49963161|49963381 hsa-miR-124-3p 0 1 0
chr6:31270017|31270363 hsa-miR-124-3p 0 1 0
chr20:35279673|35280055 hsa-miR-124-3p 0 1 0
chr6:31354159|31354290 hsa-miR-124-3p 0 1 0
chr2:240578141|240578376 hsa-miR-124-3p 0 1 0
chr8:39077247|39077411 hsa-miR-124-3p 0 1 0
chr1:31434268|31434603 hsa-miR-124-3p 0 1 0
chr5:180244865|180245055 hsa-miR-124-3p 0 1 0
chr19:14088886|14089163 hsa-miR-124-3p 0 1 0
chr7:2253178|2253304 hsa-miR-124-3p 0 1 0
chr2:231460152|231460529 hsa-miR-124-3p 0 1 0
chr16:548204|548287 hsa-miR-124-3p 0 1 0
chr5:145758238|145758329 hsa-miR-124-3p 0 1 0
chrX:53420132|53420238 hsa-miR-124-3p 0 1 0
chr14:104718839|104719039 hsa-miR-124-3p 0 1 0
chr14:64177388|64177483 hsa-miR-124-3p 0 1 0
chr16:2707942|2708202 hsa-miR-124-3p 0 1 0
chr16:85455900|85456077 hsa-miR-124-3p 0 1 0
chr1:31364038|31364213 hsa-miR-124-3p 0 1 0
chr10:32267814|32267961 hsa-miR-124-3p 0 1 0
chr17:42569995|42570183 hsa-miR-124-3p 0 1 0
chr1:18907808|18907967 hsa-miR-124-3p 0 1 0
chr6:31354120|31354266 hsa-miR-124-3p 0 1 0
chr17:45397180|45397346 hsa-miR-124-3p 0 1 0
chr16:46929023|46929218 hsa-miR-124-3p 0 1 0
chr5:141625685|141626045 hsa-miR-124-3p 0 1 0
chr4:165434431|165434617 hsa-miR-124-3p 0 1 0
chr17:16441778|16441867 hsa-miR-124-3p 0 1 0
chr21:42312220|42313623 hsa-miR-124-3p 0 1 0
chr11:65682511|65682776 hsa-miR-124-3p 0 1 0
chr7:127701233|127702466 hsa-miR-124-3p 0 1 0
chr6:31268945|31269167 hsa-miR-124-3p 0 1 0
chr9:35056679|35056903 hsa-miR-124-3p 0 1 0
chr15:41900488|41900586 hsa-miR-124-3p 0 1 0
chr7:100097614|100097894 hsa-miR-124-3p 0 1 0
chr1:119625875|119626045 hsa-miR-124-3p 0 1 0
chr9:137615083|137615318 hsa-miR-124-3p 0 1 0
chr17:57971831|57971958 hsa-miR-124-3p 0 1 0
chr16:31189737|31190120 hsa-miR-124-3p 0 1 0
chr19:11059837|11060187 hsa-miR-124-3p 0 1 0
chr12:71700832|71701015 hsa-miR-124-3p 0 1 0
chr9:732478|732600 hsa-miR-124-3p 0 1 0
chr16:28844004|28844307 hsa-miR-124-3p 0 1 0
chr1:156285575|156285658 hsa-miR-124-3p 0 1 0
chr6:33287965|33288224 hsa-miR-124-3p 0 1 0
chr3:113000875|113001198 hsa-miR-124-3p 0 1 0
chr16:31189712|31190105 hsa-miR-124-3p 0 1 0
chr6:31268945|31269138 hsa-miR-124-3p 0 1 0
chr6:31270044|31270358 hsa-miR-124-3p 0 1 0
chr13:44434226|44434391 hsa-miR-124-3p 0 1 0
chr19:39383231|39383593 hsa-miR-124-3p 0 1 0
chr13:44434317|44434468 hsa-miR-124-3p 0 1 0
chr9:95446922|95447149 hsa-miR-124-3p 0 1 0
chr6:16143608|16143756 hsa-miR-124-3p 0 1 0
chr9:137242696|137242791 hsa-miR-124-3p 0 1 0
chr16:19115716|19115892 hsa-miR-124-3p 0 1 0
chr20:62963814|62964080 hsa-miR-124-3p 0 1 0
chr10:100988065|100988269 hsa-miR-124-3p 0 1 0
chr3:50258848|50259076 hsa-miR-124-3p 0 1 0
chr20:37518675|37518795 hsa-miR-124-3p 0 1 0
chr19:2426744|2426843 hsa-miR-124-3p 0 1 0
chr14:104718839|104719042 hsa-miR-124-3p 0 1 0
chr12:70329445|70329570 hsa-miR-124-3p 0 1 0
chr2:109501710|109501831 hsa-miR-124-3p 0 1 0
chr11:67508549|67508640 hsa-miR-124-3p 0 1 0
chr12:49273066|49273195 hsa-miR-124-3p 0 1 0
chr20:18315471|18315674 hsa-miR-124-3p 0 1 0
chr10:102815794|102816024 hsa-miR-124-3p 0 1 0
chr7:151035909|151036118 hsa-miR-124-3p 0 1 0
chr19:11449076|11449295 hsa-miR-124-3p 0 1 0
chr5:145758238|145758450 hsa-miR-124-3p 0 1 0
chr14:55673234|55675918 hsa-miR-124-3p 0 1 0
chr2:218266523|218266916 hsa-miR-124-3p 0 1 0
chr19:11059864|11060151 hsa-miR-124-3p 0 1 0
chr19:48874044|48874167 hsa-miR-124-3p 0 1 0
chr20:34534680|34534795 hsa-miR-124-3p 0 1 0
chr5:143226734|143226877 hsa-miR-124-3p 0 1 0
chr19:48874027|48874167 hsa-miR-124-3p 0 1 0
chr6:2948213|2948462 hsa-miR-124-3p 0 1 0
chr16:67723942|67724041 hsa-miR-124-3p 0 1 0
chr19:11441244|11441357 hsa-miR-124-3p 0 1 0
chrX:153772972|153773310 hsa-miR-124-3p 0 1 0
chr3:50300126|50300291 hsa-miR-124-3p 0 1 0
chr7:5231883|5232115 hsa-miR-124-3p 0 1 0
chr6:107871424|107871559 hsa-miR-124-3p 0 1 0
chr10:101037976|101038094 hsa-miR-124-3p 0 1 0
chr21:42312200|42313623 hsa-miR-124-3p 0 1 0
chr6:44003416|44003680 hsa-miR-124-3p 0 1 0
chr6:31269016|31269138 hsa-miR-124-3p 0 1 0
chr12:112148076|112148211 hsa-miR-124-3p 0 1 0
chr16:1510774|1510908 hsa-miR-124-3p 1 0 0
chr22:49961142|49961483 hsa-miR-124-3p 1 0 0
chr19:39833426|39833525 hsa-miR-124-3p 1 0 0
chr19:49635327|49635448 hsa-miR-124-3p 1 0 0
chr7:2610543|2610650 hsa-miR-124-3p 1 0 0
chr4:127920077|127920184 hsa-miR-124-3p 1 0 0
chr20:17607791|17607931 hsa-miR-124-3p 1 0 0
chr8:100918964|100919215 hsa-miR-124-3p 1 0 0
chrX:51896875|51897062 hsa-miR-124-3p 1 0 0
chr17:35724620|35724955 hsa-miR-124-3p 1 0 0
chr7:139405717|139405787 hsa-miR-124-3p 1 0 0
chr6:33406355|33406626 hsa-miR-124-3p 1 0 0
chr19:13831788|13831982 hsa-miR-124-3p 1 0 0
chr6:43013175|43013356 hsa-miR-124-3p 1 0 0
chr19:2247615|2247848 hsa-miR-124-3p 1 0 0
chr1:160427791|160427910 hsa-miR-124-3p 1 0 0
chr12:93409661|93409847 hsa-miR-124-3p 1 0 0
chr8:143837463|143837725 hsa-miR-124-3p 1 0 0
chr22:35332588|35332701 hsa-miR-124-3p 1 0 0
chr1:160998687|160998889 hsa-miR-124-3p 1 0 0
chr7:101160055|101160190 hsa-miR-124-3p 1 0 0
chr12:546508|546614 hsa-miR-124-3p 1 0 0
chr7:157416036|157416255 hsa-miR-124-3p 1 0 0
chr5:141511834|141512123 hsa-miR-124-3p 1 0 0
chr1:31670416|31670578 hsa-miR-124-3p 1 0 0
chr15:40767380|40767560 hsa-miR-124-3p 1 0 0
chr12:56314851|56315236 hsa-miR-124-3p 1 0 0
chrX:135285918|135286118 hsa-miR-124-3p 1 0 0
chr4:183253861|183253999 hsa-miR-124-3p 1 0 0
chr17:81199719|81200369 hsa-miR-124-3p 1 0 0
chr9:131495999|131496101 hsa-miR-124-3p 1 0 0
chr1:231563530|231563747 hsa-miR-124-3p 1 0 0
chr22:49961151|49961465 hsa-miR-124-3p 1 0 0
chr4:7060946|7061176 hsa-miR-124-3p 1 0 0
Target genes
miRNA Gene Gene Description HGNC ID details
hsa-miR-124-3p RDH10 retinol dehydrogenase 10 HGNC:19975 details
hsa-miR-124-3p CEBPA CCAAT enhancer binding protein alpha HGNC:1833 details
hsa-miR-124-3p ATP6V0E1 ATPase H+ transporting V0 subunit e1 HGNC:863 details
hsa-miR-124-3p VAMP3 vesicle associated membrane protein 3 HGNC:12644 details
hsa-miR-124-3p RAVER2 ribonucleoprotein, PTB binding 2 HGNC:25577 details
hsa-miR-124-3p MAGT1 magnesium transporter 1 HGNC:28880 details
hsa-miR-124-3p LAMC1 laminin subunit gamma 1 HGNC:6492 details
hsa-miR-124-3p CD164 CD164 molecule HGNC:1632 details
hsa-miR-124-3p ACAA2 acetyl-CoA acyltransferase 2 HGNC:83 details
hsa-miR-124-3p SUCLG2 succinate-CoA ligase GDP-forming subunit beta HGNC:11450 details
hsa-miR-124-3p GAS2L1 growth arrest specific 2 like 1 HGNC:16955 details
hsa-miR-124-3p SERP1 stress associated endoplasmic reticulum protein 1 HGNC:10759 details
hsa-miR-124-3p SURF4 surfeit 4 HGNC:11476 details
hsa-miR-124-3p SLC16A1 solute carrier family 16 member 1 HGNC:10922 details
hsa-miR-124-3p ELOVL5 ELOVL fatty acid elongase 5 HGNC:21308 details
hsa-miR-124-3p CDK6 cyclin dependent kinase 6 HGNC:1777 details
hsa-miR-124-3p PODXL podocalyxin like HGNC:9171 details
hsa-miR-124-3p PLP2 proteolipid protein 2 HGNC:9087 details
hsa-miR-124-3p PLOD3 procollagen-lysine,2-oxoglutarate 5-dioxygenase 3 HGNC:9083 details
hsa-miR-124-3p ECI2 enoyl-CoA delta isomerase 2 HGNC:14601 details
hsa-miR-124-3p PGM1 phosphoglucomutase 1 HGNC:8905 details
hsa-miR-124-3p PGRMC2 progesterone receptor membrane component 2 HGNC:16089 details
hsa-miR-124-3p PHF19 PHD finger protein 19 HGNC:24566 details
hsa-miR-124-3p TTC7A tetratricopeptide repeat domain 7A HGNC:19750 details
hsa-miR-124-3p TRIM29 tripartite motif containing 29 HGNC:17274 details
hsa-miR-124-3p TOM1L1 target of myb1 like 1 membrane trafficking protein HGNC:11983 details
hsa-miR-124-3p PTBP1 polypyrimidine tract binding protein 1 HGNC:9583 details
hsa-miR-124-3p TMBIM1 transmembrane BAX inhibitor motif containing 1 HGNC:23410 details
hsa-miR-124-3p RARG retinoic acid receptor gamma HGNC:9866 details
hsa-miR-124-3p PTTG1IP PTTG1 interacting protein HGNC:13524 details
hsa-miR-124-3p PPP1R13L protein phosphatase 1 regulatory subunit 13 like HGNC:18838 details
hsa-miR-124-3p PTPN12 protein tyrosine phosphatase non-receptor type 12 HGNC:9645 details
hsa-miR-124-3p RYK receptor like tyrosine kinase HGNC:10481 details
hsa-miR-124-3p BACE1 beta-secretase 1 HGNC:933 details
hsa-miR-124-3p ZBED3 zinc finger BED-type containing 3 HGNC:20711 details
hsa-miR-124-3p TLN1 talin 1 HGNC:11845 details
hsa-miR-124-3p PARP16 poly(ADP-ribose) polymerase family member 16 HGNC:26040 details
hsa-miR-124-3p ARHGAP29 Rho GTPase activating protein 29 HGNC:30207 details
hsa-miR-124-3p OSBPL8 oxysterol binding protein like 8 HGNC:16396 details
hsa-miR-124-3p UHRF1 ubiquitin like with PHD and ring finger domains 1 HGNC:12556 details
hsa-miR-124-3p TWIST2 twist family bHLH transcription factor 2 HGNC:20670 details
hsa-miR-124-3p RNPEPL1 arginyl aminopeptidase like 1 HGNC:10079 details
hsa-miR-124-3p RELA RELA proto-oncogene, NF-kB subunit HGNC:9955 details
hsa-miR-124-3p RASSF5 Ras association domain family member 5 HGNC:17609 details
hsa-miR-124-3p SLC22A5 solute carrier family 22 member 5 HGNC:10969 details
hsa-miR-124-3p SLC17A5 solute carrier family 17 member 5 HGNC:10933 details
hsa-miR-124-3p SLC15A4 solute carrier family 15 member 4 HGNC:23090 details
hsa-miR-124-3p TJP2 tight junction protein 2 HGNC:11828 details
hsa-miR-124-3p TSC22D4 TSC22 domain family member 4 HGNC:21696 details
hsa-miR-124-3p TARBP1 TAR (HIV-1) RNA binding protein 1 HGNC:11568 details
hsa-miR-124-3p SWAP70 switching B cell complex subunit SWAP70 HGNC:17070 details
hsa-miR-124-3p NAA15 N-alpha-acetyltransferase 15, NatA auxiliary subunit HGNC:30782 details
hsa-miR-124-3p SYPL1 synaptophysin like 1 HGNC:11507 details
hsa-miR-124-3p details
hsa-miR-124-3p STOM stomatin HGNC:3383 details
hsa-miR-124-3p SNAI2 snail family transcriptional repressor 2 HGNC:11094 details
hsa-miR-124-3p SP1 Sp1 transcription factor HGNC:11205 details
hsa-miR-124-3p SEC11A SEC11 homolog A, signal peptidase complex subunit HGNC:17718 details
hsa-miR-124-3p CDK2 cyclin dependent kinase 2 HGNC:1771 details
hsa-miR-124-3p CCL2 C-C motif chemokine ligand 2 HGNC:10618 details
hsa-miR-124-3p EFNB1 ephrin B1 HGNC:3226 details
hsa-miR-124-3p PEA15 proliferation and apoptosis adaptor protein 15 HGNC:8822 details
hsa-miR-124-3p TNFRSF21 TNF receptor superfamily member 21 HGNC:13469 details
hsa-miR-124-3p USP48 ubiquitin specific peptidase 48 HGNC:18533 details
hsa-miR-124-3p NR3C1 nuclear receptor subfamily 3 group C member 1 HGNC:7978 details
hsa-miR-124-3p TSC22D3 TSC22 domain family member 3 HGNC:3051 details
hsa-miR-124-3p ELK3 ETS transcription factor ELK3 HGNC:3325 details
hsa-miR-124-3p LOX lysyl oxidase HGNC:6664 details
hsa-miR-124-3p NR3C2 nuclear receptor subfamily 3 group C member 2 HGNC:7979 details
hsa-miR-124-3p VIM vimentin HGNC:12692 details
hsa-miR-124-3p SMYD3 SET and MYND domain containing 3 HGNC:15513 details
hsa-miR-124-3p E2F6 E2F transcription factor 6 HGNC:3120 details
hsa-miR-124-3p IQGAP1 IQ motif containing GTPase activating protein 1 HGNC:6110 details
hsa-miR-124-3p OAF out at first homolog HGNC:28752 details
hsa-miR-124-3p NME4 NME/NM23 nucleoside diphosphate kinase 4 HGNC:7852 details
hsa-miR-124-3p NEK6 NIMA related kinase 6 HGNC:7749 details
hsa-miR-124-3p MYH9 myosin heavy chain 9 HGNC:7579 details
hsa-miR-124-3p MPHOSPH9 M-phase phosphoprotein 9 HGNC:7215 details
hsa-miR-124-3p TMEM109 transmembrane protein 109 HGNC:28771 details
hsa-miR-124-3p TUBB6 tubulin beta 6 class V HGNC:20776 details
hsa-miR-124-3p details
hsa-miR-124-3p MAPK14 mitogen-activated protein kinase 14 HGNC:6876 details
hsa-miR-124-3p LRRC1 leucine rich repeat containing 1 HGNC:14307 details
hsa-miR-124-3p SLC50A1 solute carrier family 50 member 1 HGNC:30657 details
hsa-miR-124-3p LITAF lipopolysaccharide induced TNF factor HGNC:16841 details
hsa-miR-124-3p CERS2 ceramide synthase 2 HGNC:14076 details
hsa-miR-124-3p UHMK1 U2AF homology motif kinase 1 HGNC:19683 details
hsa-miR-124-3p LIMCH1 LIM and calponin homology domains 1 HGNC:29191 details
hsa-miR-124-3p ENDOD1 endonuclease domain containing 1 HGNC:29129 details
hsa-miR-124-3p ITGB1 integrin subunit beta 1 HGNC:6153 details
hsa-miR-124-3p IFRD2 interferon related developmental regulator 2 HGNC:5457 details
hsa-miR-124-3p HTATIP2 HIV-1 Tat interactive protein 2 HGNC:16637 details
hsa-miR-124-3p HEBP2 heme binding protein 2 HGNC:15716 details
hsa-miR-124-3p HADH hydroxyacyl-CoA dehydrogenase HGNC:4799 details
hsa-miR-124-3p GSN gelsolin HGNC:4620 details
hsa-miR-124-3p GNG10 G protein subunit gamma 10 HGNC:4402 details
hsa-miR-124-3p GNAI3 G protein subunit alpha i3 HGNC:4387 details
hsa-miR-124-3p GCA grancalcin HGNC:15990 details
hsa-miR-124-3p SMCO4 single-pass membrane protein with coiled-coil domains 4 HGNC:24810 details
hsa-miR-124-3p FAM83H family with sequence similarity 83 member H HGNC:24797 details
hsa-miR-124-3p ASPRV1 aspartic peptidase retroviral like 1 HGNC:26321 details
hsa-miR-124-3p VPS37C VPS37C subunit of ESCRT-I HGNC:26097 details
hsa-miR-124-3p SPDL1 spindle apparatus coiled-coil protein 1 HGNC:26010 details
hsa-miR-124-3p RBM47 RNA binding motif protein 47 HGNC:30358 details
hsa-miR-124-3p DRAM1 DNA damage regulated autophagy modulator 1 HGNC:25645 details
hsa-miR-124-3p NECAP2 NECAP endocytosis associated 2 HGNC:25528 details
hsa-miR-124-3p FCHO2 FCH and mu domain containing endocytic adaptor 2 HGNC:25180 details
hsa-miR-124-3p details
hsa-miR-124-3p F11R F11 receptor HGNC:14685 details
hsa-miR-124-3p EYA4 EYA transcriptional coactivator and phosphatase 4 HGNC:3522 details
hsa-miR-124-3p ELOVL1 ELOVL fatty acid elongase 1 HGNC:14418 details
hsa-miR-124-3p ELF4 E74 like ETS transcription factor 4 HGNC:3319 details
hsa-miR-124-3p TSKU tsukushi, small leucine rich proteoglycan HGNC:28850 details
hsa-miR-124-3p DNM2 dynamin 2 HGNC:2974 details
hsa-miR-124-3p DNAJC1 DnaJ heat shock protein family (Hsp40) member C1 HGNC:20090 details
hsa-miR-124-3p DHCR24 24-dehydrocholesterol reductase HGNC:2859 details
hsa-miR-124-3p DFFB DNA fragmentation factor subunit beta HGNC:2773 details
hsa-miR-124-3p DCTD dCMP deaminase HGNC:2710 details
hsa-miR-124-3p CHST14 carbohydrate sulfotransferase 14 HGNC:24464 details
hsa-miR-124-3p CYP1B1 cytochrome P450 family 1 subfamily B member 1 HGNC:2597 details
hsa-miR-124-3p CTNND1 catenin delta 1 HGNC:2515 details
hsa-miR-124-3p details
hsa-miR-124-3p CTDSP2 CTD small phosphatase 2 HGNC:17077 details
hsa-miR-124-3p CTDSP1 CTD small phosphatase 1 HGNC:21614 details
hsa-miR-124-3p details
hsa-miR-124-3p CREB3L2 cAMP responsive element binding protein 3 like 2 HGNC:23720 details
hsa-miR-124-3p CPNE3 copine 3 HGNC:2316 details
hsa-miR-124-3p CHSY1 chondroitin sulfate synthase 1 HGNC:17198 details
hsa-miR-124-3p CDK4 cyclin dependent kinase 4 HGNC:1773 details
hsa-miR-124-3p CDC14B cell division cycle 14B HGNC:1719 details
hsa-miR-124-3p CDCA7 cell division cycle associated 7 HGNC:14628 details
hsa-miR-124-3p CD59 CD59 molecule (CD59 blood group) HGNC:1689 details
hsa-miR-124-3p CAV1 caveolin 1 HGNC:1527 details
hsa-miR-124-3p details
hsa-miR-124-3p CLDND1 claudin domain containing 1 HGNC:1322 details
hsa-miR-124-3p ZCCHC24 zinc finger CCHC-type containing 24 HGNC:26911 details
hsa-miR-124-3p B4GALT1 beta-1,4-galactosyltransferase 1 HGNC:924 details
hsa-miR-124-3p ARPC1B actin related protein 2/3 complex subunit 1B HGNC:704 details
hsa-miR-124-3p ARHGEF1 Rho guanine nucleotide exchange factor 1 HGNC:681 details
hsa-miR-124-3p LDLRAP1 low density lipoprotein receptor adaptor protein 1 HGNC:18640 details
hsa-miR-124-3p ARAF A-Raf proto-oncogene, serine/threonine kinase HGNC:646 details
hsa-miR-124-3p APEX2 apurinic/apyrimidinic endodeoxyribonuclease 2 HGNC:17889 details
hsa-miR-124-3p AP1M2 adaptor related protein complex 1 subunit mu 2 HGNC:558 details
hsa-miR-124-3p ANXA8 annexin A8 HGNC:546 details
hsa-miR-124-3p ANKRD27 ankyrin repeat domain 27 HGNC:25310 details
hsa-miR-124-3p KANK1 KN motif and ankyrin repeat domains 1 HGNC:19309 details
hsa-miR-124-3p ALDH9A1 aldehyde dehydrogenase 9 family member A1 HGNC:412 details
hsa-miR-124-3p AK2 adenylate kinase 2 HGNC:362 details
hsa-miR-124-3p AHR aryl hydrocarbon receptor HGNC:348 details
hsa-miR-124-3p ACTR8 actin related protein 8 HGNC:14672 details
hsa-miR-124-3p ABHD5 abhydrolase domain containing 5, lysophosphatidic acid acyltransferase HGNC:21396 details
hsa-miR-124-3p NFKBIZ NFKB inhibitor zeta HGNC:29805 details
hsa-miR-124-3p AR androgen receptor HGNC:644 details
hsa-miR-124-3p ROCK2 Rho associated coiled-coil containing protein kinase 2 HGNC:10252 details
hsa-miR-124-3p EZH2 enhancer of zeste 2 polycomb repressive complex 2 subunit HGNC:3527 details
hsa-miR-124-3p IL6R interleukin 6 receptor HGNC:6019 details
hsa-miR-124-3p HMGA1 high mobility group AT-hook 1 HGNC:5010 details
hsa-miR-124-3p details
hsa-miR-124-3p ROCK1 Rho associated coiled-coil containing protein kinase 1 HGNC:10251 details
hsa-miR-124-3p RHOG ras homolog family member G HGNC:672 details
hsa-miR-124-3p PIK3CA phosphatidylinositol-4,5-bisphosphate 3-kinase catalytic subunit alpha HGNC:8975 details
hsa-miR-124-3p FXN frataxin HGNC:3951 details
hsa-miR-124-3p MECP2 methyl-CpG binding protein 2 HGNC:6990 details
hsa-miR-124-3p SPTA1 spectrin alpha, erythrocytic 1 HGNC:11272 details
hsa-miR-124-3p FOXF2 forkhead box F2 HGNC:3810 details
hsa-miR-124-3p MYO10 myosin X HGNC:7593 details
hsa-miR-124-3p LRRC4 leucine rich repeat containing 4 HGNC:15586 details
hsa-miR-124-3p SGK1 serum/glucocorticoid regulated kinase 1 HGNC:10810 details
hsa-miR-124-3p DEFB118 defensin beta 118 HGNC:16196 details
hsa-miR-124-3p RFT1 RFT1 homolog HGNC:30220 details
hsa-miR-124-3p USH2A usherin HGNC:12601 details
hsa-miR-124-3p ARMCX2 armadillo repeat containing X-linked 2 HGNC:16869 details
hsa-miR-124-3p BAG5 BAG cochaperone 5 HGNC:941 details
hsa-miR-124-3p ARHGAP22 Rho GTPase activating protein 22 HGNC:30320 details
hsa-miR-124-3p VNN2 vanin 2 HGNC:12706 details
hsa-miR-124-3p FAM104A family with sequence similarity 104 member A HGNC:25918 details
hsa-miR-124-3p YBX3 Y-box binding protein 3 HGNC:2428 details
hsa-miR-124-3p TRIM38 tripartite motif containing 38 HGNC:10059 details
hsa-miR-124-3p C9orf85 chromosome 9 open reading frame 85 HGNC:28784 details
hsa-miR-124-3p CDCA7L cell division cycle associated 7 like HGNC:30777 details
hsa-miR-124-3p STX2 syntaxin 2 HGNC:3403 details
hsa-miR-124-3p PLA2G4C phospholipase A2 group IVC HGNC:9037 details
hsa-miR-124-3p MVP major vault protein HGNC:7531 details
hsa-miR-124-3p SEC24D SEC24 homolog D, COPII coat complex component HGNC:10706 details
hsa-miR-124-3p SENP8 SUMO peptidase family member, NEDD8 specific HGNC:22992 details
hsa-miR-124-3p XRCC2 X-ray repair cross complementing 2 HGNC:12829 details
hsa-miR-124-3p HLA-A major histocompatibility complex, class I, A HGNC:4931 details
hsa-miR-124-3p GMPR2 guanosine monophosphate reductase 2 HGNC:4377 details
hsa-miR-124-3p SNX18 sorting nexin 18 HGNC:19245 details
hsa-miR-124-3p TBXA2R thromboxane A2 receptor HGNC:11608 details
hsa-miR-124-3p SH2D3A SH2 domain containing 3A HGNC:16885 details
hsa-miR-124-3p MFAP4 microfibril associated protein 4 HGNC:7035 details
hsa-miR-124-3p MICAL2 microtubule associated monooxygenase, calponin and LIM domain containing 2 HGNC:24693 details
hsa-miR-124-3p EREG epiregulin HGNC:3443 details
hsa-miR-124-3p LRRC2 leucine rich repeat containing 2 HGNC:14676 details
hsa-miR-124-3p BIRC2 baculoviral IAP repeat containing 2 HGNC:590 details
hsa-miR-124-3p JAKMIP1 janus kinase and microtubule interacting protein 1 HGNC:26460 details
hsa-miR-124-3p ADPRH ADP-ribosylarginine hydrolase HGNC:269 details
hsa-miR-124-3p XKRX XK related X-linked HGNC:29845 details
hsa-miR-124-3p LAMA4 laminin subunit alpha 4 HGNC:6484 details
hsa-miR-124-3p EFNA1 ephrin A1 HGNC:3221 details
hsa-miR-124-3p LSM10 LSM10, U7 small nuclear RNA associated HGNC:17562 details
hsa-miR-124-3p ADCY6 adenylate cyclase 6 HGNC:237 details
hsa-miR-124-3p details
hsa-miR-124-3p ADAM15 ADAM metallopeptidase domain 15 HGNC:193 details
hsa-miR-124-3p DSEL dermatan sulfate epimerase like HGNC:18144 details
hsa-miR-124-3p EPB41L5 erythrocyte membrane protein band 4.1 like 5 HGNC:19819 details
hsa-miR-124-3p ZHX3 zinc fingers and homeoboxes 3 HGNC:15935 details
hsa-miR-124-3p SMPD4 sphingomyelin phosphodiesterase 4 HGNC:32949 details
hsa-miR-124-3p MAML1 mastermind like transcriptional coactivator 1 HGNC:13632 details
hsa-miR-124-3p SLC46A3 solute carrier family 46 member 3 HGNC:27501 details
hsa-miR-124-3p RRAS RAS related HGNC:10447 details
hsa-miR-124-3p NUDT19 nudix hydrolase 19 HGNC:32036 details
hsa-miR-124-3p details
hsa-miR-124-3p SPRY2 sprouty RTK signaling antagonist 2 HGNC:11270 details
hsa-miR-124-3p MTHFSD methenyltetrahydrofolate synthetase domain containing HGNC:25778 details
hsa-miR-124-3p JAG2 jagged canonical Notch ligand 2 HGNC:6189 details
hsa-miR-124-3p STK36 serine/threonine kinase 36 HGNC:17209 details
hsa-miR-124-3p METAP2 methionyl aminopeptidase 2 HGNC:16672 details
hsa-miR-124-3p KDELR2 KDEL endoplasmic reticulum protein retention receptor 2 HGNC:6305 details
hsa-miR-124-3p ECE1 endothelin converting enzyme 1 HGNC:3146 details
hsa-miR-124-3p SBNO2 strawberry notch homolog 2 HGNC:29158 details
hsa-miR-124-3p PRRX1 paired related homeobox 1 HGNC:9142 details
hsa-miR-124-3p TOR3A torsin family 3 member A HGNC:11997 details
hsa-miR-124-3p LHX2 LIM homeobox 2 HGNC:6594 details
hsa-miR-124-3p RAB34 RAB34, member RAS oncogene family HGNC:16519 details
hsa-miR-124-3p ARHGAP28 Rho GTPase activating protein 28 HGNC:25509 details
hsa-miR-124-3p COL4A1 collagen type IV alpha 1 chain HGNC:2202 details
hsa-miR-124-3p USP10 ubiquitin specific peptidase 10 HGNC:12608 details
hsa-miR-124-3p GPATCH4 G-patch domain containing 4 HGNC:25982 details
hsa-miR-124-3p DHX33 DEAH-box helicase 33 HGNC:16718 details
hsa-miR-124-3p LIN7C lin-7 homolog C, crumbs cell polarity complex component HGNC:17789 details
hsa-miR-124-3p DDX51 DEAD-box helicase 51 HGNC:20082 details
hsa-miR-124-3p ZNF740 zinc finger protein 740 HGNC:27465 details
hsa-miR-124-3p GINM1 glycoprotein integral membrane 1 HGNC:21074 details
hsa-miR-124-3p GRSF1 G-rich RNA sequence binding factor 1 HGNC:4610 details
hsa-miR-124-3p COLGALT1 collagen beta(1-O)galactosyltransferase 1 HGNC:26182 details
hsa-miR-124-3p details
hsa-miR-124-3p FAM171B family with sequence similarity 171 member B HGNC:29412 details
hsa-miR-124-3p SERPINB6 serpin family B member 6 HGNC:8950 details
hsa-miR-124-3p IL6 interleukin 6 HGNC:6018 details
hsa-miR-124-3p CAPN11 calpain 11 HGNC:1478 details
hsa-miR-124-3p DYNC2H1 dynein cytoplasmic 2 heavy chain 1 HGNC:2962 details
hsa-miR-124-3p TRIP11 thyroid hormone receptor interactor 11 HGNC:12305 details
hsa-miR-124-3p CABP1 calcium binding protein 1 HGNC:1384 details
hsa-miR-124-3p METTL7A methyltransferase like 7A HGNC:24550 details
hsa-miR-124-3p FGF1 fibroblast growth factor 1 HGNC:3665 details
hsa-miR-124-3p SERPINE1 serpin family E member 1 HGNC:8583 details
hsa-miR-124-3p RBMS1 RNA binding motif single stranded interacting protein 1 HGNC:9907 details
hsa-miR-124-3p SLC43A3 solute carrier family 43 member 3 HGNC:17466 details
hsa-miR-124-3p PUS1 pseudouridine synthase 1 HGNC:15508 details
hsa-miR-124-3p CALCRL calcitonin receptor like receptor HGNC:16709 details
hsa-miR-124-3p CAPRIN2 caprin family member 2 HGNC:21259 details
hsa-miR-124-3p MDFIC MyoD family inhibitor domain containing HGNC:28870 details
hsa-miR-124-3p SAMD11 sterile alpha motif domain containing 11 HGNC:28706 details
hsa-miR-124-3p details
hsa-miR-124-3p AVEN apoptosis and caspase activation inhibitor HGNC:13509 details
hsa-miR-124-3p ZNHIT6 zinc finger HIT-type containing 6 HGNC:26089 details
hsa-miR-124-3p CDRT4 CMT1A duplicated region transcript 4 HGNC:14383 details
hsa-miR-124-3p GPR161 G protein-coupled receptor 161 HGNC:23694 details
hsa-miR-124-3p EPGN epithelial mitogen HGNC:17470 details
hsa-miR-124-3p details
hsa-miR-124-3p INO80C INO80 complex subunit C HGNC:26994 details
hsa-miR-124-3p GMCL1 germ cell-less 1, spermatogenesis associated HGNC:23843 details
hsa-miR-124-3p MAPKAPK2 MAPK activated protein kinase 2 HGNC:6887 details
hsa-miR-124-3p ERCC5 ERCC excision repair 5, endonuclease HGNC:3437 details
hsa-miR-124-3p TAX1BP3 Tax1 binding protein 3 HGNC:30684 details
hsa-miR-124-3p CHRDL1 chordin like 1 HGNC:29861 details
hsa-miR-124-3p CCDC3 coiled-coil domain containing 3 HGNC:23813 details
hsa-miR-124-3p MVK mevalonate kinase HGNC:7530 details
hsa-miR-124-3p INF2 inverted formin 2 HGNC:23791 details
hsa-miR-124-3p ZNF410 zinc finger protein 410 HGNC:20144 details
hsa-miR-124-3p PPP2R1B protein phosphatase 2 scaffold subunit Abeta HGNC:9303 details
hsa-miR-124-3p CYBRD1 cytochrome b reductase 1 HGNC:20797 details
hsa-miR-124-3p LNX2 ligand of numb-protein X 2 HGNC:20421 details
hsa-miR-124-3p TMEM79 transmembrane protein 79 HGNC:28196 details
hsa-miR-124-3p MRPL49 mitochondrial ribosomal protein L49 HGNC:1176 details
hsa-miR-124-3p DNMBP dynamin binding protein HGNC:30373 details
hsa-miR-124-3p OGFOD2 2-oxoglutarate and iron dependent oxygenase domain containing 2 HGNC:25823 details
hsa-miR-124-3p CPNE8 copine 8 HGNC:23498 details
hsa-miR-124-3p TRAIP TRAF interacting protein HGNC:30764 details
hsa-miR-124-3p RAD51AP1 RAD51 associated protein 1 HGNC:16956 details
hsa-miR-124-3p CTSH cathepsin H HGNC:2535 details
hsa-miR-124-3p GRB2 growth factor receptor bound protein 2 HGNC:4566 details
hsa-miR-124-3p ADCY9 adenylate cyclase 9 HGNC:240 details
hsa-miR-124-3p SNX17 sorting nexin 17 HGNC:14979 details
hsa-miR-124-3p MSRB3 methionine sulfoxide reductase B3 HGNC:27375 details
hsa-miR-124-3p details
hsa-miR-124-3p RNF141 ring finger protein 141 HGNC:21159 details
hsa-miR-124-3p LYSMD3 LysM domain containing 3 HGNC:26969 details
hsa-miR-124-3p UNC5D unc-5 netrin receptor D HGNC:18634 details
hsa-miR-124-3p KLF6 Kruppel like factor 6 HGNC:2235 details
hsa-miR-124-3p BRWD1 bromodomain and WD repeat domain containing 1 HGNC:12760 details
hsa-miR-124-3p DCAF16 DDB1 and CUL4 associated factor 16 HGNC:25987 details
hsa-miR-124-3p PI4K2B phosphatidylinositol 4-kinase type 2 beta HGNC:18215 details
hsa-miR-124-3p GATA6 GATA binding protein 6 HGNC:4174 details
hsa-miR-124-3p KLF4 Kruppel like factor 4 HGNC:6348 details
hsa-miR-124-3p SERTAD2 SERTA domain containing 2 HGNC:30784 details
hsa-miR-124-3p RAB27A RAB27A, member RAS oncogene family HGNC:9766 details
hsa-miR-124-3p NFATC1 nuclear factor of activated T cells 1 HGNC:7775 details
hsa-miR-124-3p CD55 CD55 molecule (Cromer blood group) HGNC:2665 details
hsa-miR-124-3p ATAD3A ATPase family AAA domain containing 3A HGNC:25567 details
hsa-miR-124-3p PLOD1 procollagen-lysine,2-oxoglutarate 5-dioxygenase 1 HGNC:9081 details
hsa-miR-124-3p RFC3 replication factor C subunit 3 HGNC:9971 details
hsa-miR-124-3p PPAN peter pan homolog HGNC:9227 details
hsa-miR-124-3p KRT17P2 keratin 17 pseudogene 2 HGNC:6429 details
hsa-miR-124-3p HELLS helicase, lymphoid specific HGNC:4861 details
hsa-miR-124-3p DVL2 dishevelled segment polarity protein 2 HGNC:3086 details
hsa-miR-124-3p LAS1L LAS1 like ribosome biogenesis factor HGNC:25726 details
hsa-miR-124-3p NGDN neuroguidin HGNC:20271 details
hsa-miR-124-3p PIAS1 protein inhibitor of activated STAT 1 HGNC:2752 details
hsa-miR-124-3p JUP junction plakoglobin HGNC:6207 details
hsa-miR-124-3p GNB4 G protein subunit beta 4 HGNC:20731 details
hsa-miR-124-3p TRIM25 tripartite motif containing 25 HGNC:12932 details
hsa-miR-124-3p RCC2 regulator of chromosome condensation 2 HGNC:30297 details
hsa-miR-124-3p details
hsa-miR-124-3p ENAH ENAH actin regulator HGNC:18271 details
hsa-miR-124-3p DIS3 DIS3 homolog, exosome endoribonuclease and 3'-5' exoribonuclease HGNC:20604 details
hsa-miR-124-3p NFIC nuclear factor I C HGNC:7786 details
hsa-miR-124-3p LDLR low density lipoprotein receptor HGNC:6547 details
hsa-miR-124-3p PDAP1 PDGFA associated protein 1 HGNC:14634 details
hsa-miR-124-3p CCDC102B coiled-coil domain containing 102B HGNC:26295 details
hsa-miR-124-3p TSEN54 tRNA splicing endonuclease subunit 54 HGNC:27561 details
hsa-miR-124-3p ZNF483 zinc finger protein 483 HGNC:23384 details
hsa-miR-124-3p ADARB1 adenosine deaminase RNA specific B1 HGNC:226 details
hsa-miR-124-3p DHRS3 dehydrogenase/reductase 3 HGNC:17693 details
hsa-miR-124-3p SYNGR2 synaptogyrin 2 HGNC:11499 details
hsa-miR-124-3p SLC1A3 solute carrier family 1 member 3 HGNC:10941 details
hsa-miR-124-3p TMEM156 transmembrane protein 156 HGNC:26260 details
hsa-miR-124-3p GTF3C6 general transcription factor IIIC subunit 6 HGNC:20872 details
hsa-miR-124-3p CKS2 CDC28 protein kinase regulatory subunit 2 HGNC:2000 details
hsa-miR-124-3p AFAP1L1 actin filament associated protein 1 like 1 HGNC:26714 details
hsa-miR-124-3p ID3 inhibitor of DNA binding 3, HLH protein HGNC:5362 details
hsa-miR-124-3p EDN1 endothelin 1 HGNC:3176 details
hsa-miR-124-3p G3BP1 G3BP stress granule assembly factor 1 HGNC:30292 details
hsa-miR-124-3p IGFBP1 insulin like growth factor binding protein 1 HGNC:5469 details
hsa-miR-124-3p CLIC3 chloride intracellular channel 3 HGNC:2064 details
hsa-miR-124-3p E2F4 E2F transcription factor 4 HGNC:3118 details
hsa-miR-124-3p LRRC58 leucine rich repeat containing 58 HGNC:26968 details
hsa-miR-124-3p SPHK1 sphingosine kinase 1 HGNC:11240 details
hsa-miR-124-3p OCA2 OCA2 melanosomal transmembrane protein HGNC:8101 details
hsa-miR-124-3p MAPK1IP1L mitogen-activated protein kinase 1 interacting protein 1 like HGNC:19840 details
hsa-miR-124-3p SDCCAG8 SHH signaling and ciliogenesis regulator SDCCAG8 HGNC:10671 details
hsa-miR-124-3p details
hsa-miR-124-3p PRKCB protein kinase C beta HGNC:9395 details
hsa-miR-124-3p COL17A1 collagen type XVII alpha 1 chain HGNC:2194 details
hsa-miR-124-3p HOXC4 homeobox C4 HGNC:5126 details
hsa-miR-124-3p ATOH8 atonal bHLH transcription factor 8 HGNC:24126 details
hsa-miR-124-3p SULT1E1 sulfotransferase family 1E member 1 HGNC:11377 details
hsa-miR-124-3p RILPL2 Rab interacting lysosomal protein like 2 HGNC:28787 details
hsa-miR-124-3p TMEM44 transmembrane protein 44 HGNC:25120 details
hsa-miR-124-3p RPS15 ribosomal protein S15 HGNC:10388 details
hsa-miR-124-3p RPS6KA4 ribosomal protein S6 kinase A4 HGNC:10433 details
hsa-miR-124-3p NSMAF neutral sphingomyelinase activation associated factor HGNC:8017 details
hsa-miR-124-3p PTH2R parathyroid hormone 2 receptor HGNC:9609 details
hsa-miR-124-3p NUB1 negative regulator of ubiquitin like proteins 1 HGNC:17623 details
hsa-miR-124-3p ROM1 retinal outer segment membrane protein 1 HGNC:10254 details
hsa-miR-124-3p ACADL acyl-CoA dehydrogenase long chain HGNC:88 details
hsa-miR-124-3p NASP nuclear autoantigenic sperm protein HGNC:7644 details
hsa-miR-124-3p RFWD3 ring finger and WD repeat domain 3 HGNC:25539 details
hsa-miR-124-3p details
hsa-miR-124-3p HMGN4 high mobility group nucleosomal binding domain 4 HGNC:4989 details
hsa-miR-124-3p TSN translin HGNC:12379 details
hsa-miR-124-3p SNX12 sorting nexin 12 HGNC:14976 details
hsa-miR-124-3p POLA1 DNA polymerase alpha 1, catalytic subunit HGNC:9173 details
hsa-miR-124-3p B3GNT2 UDP-GlcNAc:betaGal beta-1,3-N-acetylglucosaminyltransferase 2 HGNC:15629 details
hsa-miR-124-3p MALL mal, T cell differentiation protein like HGNC:6818 details
hsa-miR-124-3p MOBP myelin associated oligodendrocyte basic protein HGNC:7189 details
hsa-miR-124-3p KLHL24 kelch like family member 24 HGNC:25947 details
hsa-miR-124-3p FGFR1 fibroblast growth factor receptor 1 HGNC:3688 details
hsa-miR-124-3p TMEM128 transmembrane protein 128 HGNC:28201 details
hsa-miR-124-3p RIPK4 receptor interacting serine/threonine kinase 4 HGNC:496 details
hsa-miR-124-3p BVES blood vessel epicardial substance HGNC:1152 details
hsa-miR-124-3p HEATR5A HEAT repeat containing 5A HGNC:20276 details
hsa-miR-124-3p details
hsa-miR-124-3p CMTM7 CKLF like MARVEL transmembrane domain containing 7 HGNC:19178 details
hsa-miR-124-3p EMD emerin HGNC:3331 details
hsa-miR-124-3p PTPRB protein tyrosine phosphatase receptor type B HGNC:9665 details
hsa-miR-124-3p GPM6B glycoprotein M6B HGNC:4461 details
hsa-miR-124-3p RASSF1 Ras association domain family member 1 HGNC:9882 details
hsa-miR-124-3p TUB TUB bipartite transcription factor HGNC:12406 details
hsa-miR-124-3p PALLD palladin, cytoskeletal associated protein HGNC:17068 details
hsa-miR-124-3p details
hsa-miR-124-3p SIX4 SIX homeobox 4 HGNC:10890 details
hsa-miR-124-3p ZFP36L2 ZFP36 ring finger protein like 2 HGNC:1108 details
hsa-miR-124-3p INA internexin neuronal intermediate filament protein alpha HGNC:6057 details
hsa-miR-124-3p DNM3 dynamin 3 HGNC:29125 details
hsa-miR-124-3p NOL8 nucleolar protein 8 HGNC:23387 details
hsa-miR-124-3p EHD2 EH domain containing 2 HGNC:3243 details
hsa-miR-124-3p AURKB aurora kinase B HGNC:11390 details
hsa-miR-124-3p SRSF3 serine and arginine rich splicing factor 3 HGNC:10785 details
hsa-miR-124-3p NOSIP nitric oxide synthase interacting protein HGNC:17946 details
hsa-miR-124-3p PDLIM7 PDZ and LIM domain 7 HGNC:22958 details
hsa-miR-124-3p SPIN1 spindlin 1 HGNC:11243 details
hsa-miR-124-3p PPIF peptidylprolyl isomerase F HGNC:9259 details
hsa-miR-124-3p FRAS1 Fraser extracellular matrix complex subunit 1 HGNC:19185 details
hsa-miR-124-3p PAPSS2 3'-phosphoadenosine 5'-phosphosulfate synthase 2 HGNC:8604 details
hsa-miR-124-3p FLOT2 flotillin 2 HGNC:3758 details
hsa-miR-124-3p MVD mevalonate diphosphate decarboxylase HGNC:7529 details
hsa-miR-124-3p LIN28A lin-28 homolog A HGNC:15986 details
hsa-miR-124-3p TSPAN15 tetraspanin 15 HGNC:23298 details
hsa-miR-124-3p TUBA3D tubulin alpha 3d HGNC:24071 details
hsa-miR-124-3p PLEKHA1 pleckstrin homology domain containing A1 HGNC:14335 details
hsa-miR-124-3p LIN7A lin-7 homolog A, crumbs cell polarity complex component HGNC:17787 details
hsa-miR-124-3p FAM177A1 family with sequence similarity 177 member A1 HGNC:19829 details
hsa-miR-124-3p AKAP4 A-kinase anchoring protein 4 HGNC:374 details
hsa-miR-124-3p ARFIP1 ADP ribosylation factor interacting protein 1 HGNC:21496 details
hsa-miR-124-3p GTPBP8 GTP binding protein 8 (putative) HGNC:25007 details
hsa-miR-124-3p AGTR2 angiotensin II receptor type 2 HGNC:338 details
hsa-miR-124-3p NCAPH2 non-SMC condensin II complex subunit H2 HGNC:25071 details
hsa-miR-124-3p DRG2 developmentally regulated GTP binding protein 2 HGNC:3030 details
hsa-miR-124-3p SLC13A2 solute carrier family 13 member 2 HGNC:10917 details
hsa-miR-124-3p MFAP5 microfibril associated protein 5 HGNC:29673 details
hsa-miR-124-3p CALR calreticulin HGNC:1455 details
hsa-miR-124-3p details
hsa-miR-124-3p POFUT1 protein O-fucosyltransferase 1 HGNC:14988 details
hsa-miR-124-3p details
hsa-miR-124-3p details
hsa-miR-124-3p TNFRSF12A TNF receptor superfamily member 12A HGNC:18152 details
hsa-miR-124-3p details
hsa-miR-124-3p IKBKE inhibitor of nuclear factor kappa B kinase subunit epsilon HGNC:14552 details
hsa-miR-124-3p LMNB1 lamin B1 HGNC:6637 details
hsa-miR-124-3p CSPG4 chondroitin sulfate proteoglycan 4 HGNC:2466 details
hsa-miR-124-3p KIAA0930 KIAA0930 HGNC:1314 details
hsa-miR-124-3p ANXA6 annexin A6 HGNC:544 details
hsa-miR-124-3p VKORC1 vitamin K epoxide reductase complex subunit 1 HGNC:23663 details
hsa-miR-124-3p DISP1 dispatched RND transporter family member 1 HGNC:19711 details
hsa-miR-124-3p SYNC syncoilin, intermediate filament protein HGNC:28897 details
hsa-miR-124-3p DEPDC1 DEP domain containing 1 HGNC:22949 details
hsa-miR-124-3p details
hsa-miR-124-3p CDC42EP3 CDC42 effector protein 3 HGNC:16943 details
hsa-miR-124-3p SEC22C SEC22 homolog C, vesicle trafficking protein HGNC:16828 details
hsa-miR-124-3p details
hsa-miR-124-3p C14orf178 chromosome 14 open reading frame 178 HGNC:26385 details
hsa-miR-124-3p SDC4 syndecan 4 HGNC:10661 details
hsa-miR-124-3p ZNF440 zinc finger protein 440 HGNC:20874 details
hsa-miR-124-3p MYPN myopalladin HGNC:23246 details
hsa-miR-124-3p TPP1 tripeptidyl peptidase 1 HGNC:2073 details
hsa-miR-124-3p ATP8B2 ATPase phospholipid transporting 8B2 HGNC:13534 details
hsa-miR-124-3p SLC31A2 solute carrier family 31 member 2 HGNC:11017 details
hsa-miR-124-3p GFPT2 glutamine-fructose-6-phosphate transaminase 2 HGNC:4242 details
hsa-miR-124-3p IGFBP3 insulin like growth factor binding protein 3 HGNC:5472 details
hsa-miR-124-3p TMEM45A transmembrane protein 45A HGNC:25480 details
hsa-miR-124-3p CDCP1 CUB domain containing protein 1 HGNC:24357 details
hsa-miR-124-3p PUS3 pseudouridine synthase 3 HGNC:25461 details
hsa-miR-124-3p MAP3K8 mitogen-activated protein kinase kinase kinase 8 HGNC:6860 details
hsa-miR-124-3p TPST2 tyrosylprotein sulfotransferase 2 HGNC:12021 details
hsa-miR-124-3p details
hsa-miR-124-3p NFIA nuclear factor I A HGNC:7784 details
hsa-miR-124-3p SLC1A4 solute carrier family 1 member 4 HGNC:10942 details
hsa-miR-124-3p PPP1R3B protein phosphatase 1 regulatory subunit 3B HGNC:14942 details
hsa-miR-124-3p ESYT2 extended synaptotagmin 2 HGNC:22211 details
hsa-miR-124-3p ANXA11 annexin A11 HGNC:535 details
hsa-miR-124-3p details
hsa-miR-124-3p details
hsa-miR-124-3p BEND3 BEN domain containing 3 HGNC:23040 details
hsa-miR-124-3p MBNL1 muscleblind like splicing regulator 1 HGNC:6923 details
hsa-miR-124-3p CUX2 cut like homeobox 2 HGNC:19347 details
hsa-miR-124-3p MCAM melanoma cell adhesion molecule HGNC:6934 details
hsa-miR-124-3p EIF2S2 eukaryotic translation initiation factor 2 subunit beta HGNC:3266 details
hsa-miR-124-3p SNRPB small nuclear ribonucleoprotein polypeptides B and B1 HGNC:11153 details
hsa-miR-124-3p CDC27 cell division cycle 27 HGNC:1728 details
hsa-miR-124-3p PGM5 phosphoglucomutase 5 HGNC:8908 details
hsa-miR-124-3p NOL10 nucleolar protein 10 HGNC:25862 details
hsa-miR-124-3p NOC3L NOC3 like DNA replication regulator HGNC:24034 details
hsa-miR-124-3p WTAP WT1 associated protein HGNC:16846 details
hsa-miR-124-3p EIF3M eukaryotic translation initiation factor 3 subunit M HGNC:24460 details
hsa-miR-124-3p MED20 mediator complex subunit 20 HGNC:16840 details
hsa-miR-124-3p AURKA aurora kinase A HGNC:11393 details
hsa-miR-124-3p GNAI2 G protein subunit alpha i2 HGNC:4385 details
hsa-miR-124-3p NMNAT1 nicotinamide nucleotide adenylyltransferase 1 HGNC:17877 details
hsa-miR-124-3p LMNA lamin A/C HGNC:6636 details
hsa-miR-124-3p KATNA1 katanin catalytic subunit A1 HGNC:6216 details
hsa-miR-124-3p ACAT2 acetyl-CoA acetyltransferase 2 HGNC:94 details
hsa-miR-124-3p RBPMS RNA binding protein, mRNA processing factor HGNC:19097 details
hsa-miR-124-3p GBP1 guanylate binding protein 1 HGNC:4182 details
hsa-miR-124-3p TAF1A TATA-box binding protein associated factor, RNA polymerase I subunit A HGNC:11532 details
hsa-miR-124-3p PYCARD PYD and CARD domain containing HGNC:16608 details
hsa-miR-124-3p details
hsa-miR-124-3p PSG3 pregnancy specific beta-1-glycoprotein 3 HGNC:9520 details
hsa-miR-124-3p TMEFF2 transmembrane protein with EGF like and two follistatin like domains 2 HGNC:11867 details
hsa-miR-124-3p DENND2D DENN domain containing 2D HGNC:26192 details
hsa-miR-124-3p PTGES prostaglandin E synthase HGNC:9599 details
hsa-miR-124-3p SAMD10 sterile alpha motif domain containing 10 HGNC:16129 details
hsa-miR-124-3p ANO1 anoctamin 1 HGNC:21625 details
hsa-miR-124-3p TEAD1 TEA domain transcription factor 1 HGNC:11714 details
hsa-miR-124-3p PDGFC platelet derived growth factor C HGNC:8801 details
hsa-miR-124-3p TMEM121 transmembrane protein 121 HGNC:20511 details
hsa-miR-124-3p FNDC4 fibronectin type III domain containing 4 HGNC:20239 details
hsa-miR-124-3p ANKRD36B ankyrin repeat domain 36B HGNC:29333 details
hsa-miR-124-3p PLEKHB1 pleckstrin homology domain containing B1 HGNC:19079 details
hsa-miR-124-3p SLC25A30 solute carrier family 25 member 30 HGNC:27371 details
hsa-miR-124-3p HES1 hes family bHLH transcription factor 1 HGNC:5192 details
hsa-miR-124-3p LOXL1 lysyl oxidase like 1 HGNC:6665 details
hsa-miR-124-3p TPRA1 transmembrane protein adipocyte associated 1 HGNC:30413 details
hsa-miR-124-3p IPCEF1 interaction protein for cytohesin exchange factors 1 HGNC:21204 details
hsa-miR-124-3p CLN5 CLN5 intracellular trafficking protein HGNC:2076 details
hsa-miR-124-3p AMIGO2 adhesion molecule with Ig like domain 2 HGNC:24073 details
hsa-miR-124-3p details
hsa-miR-124-3p ICAM5 intercellular adhesion molecule 5 HGNC:5348 details
hsa-miR-124-3p ATP8B3 ATPase phospholipid transporting 8B3 HGNC:13535 details
hsa-miR-124-3p GSTK1 glutathione S-transferase kappa 1 HGNC:16906 details
hsa-miR-124-3p PLA2G7 phospholipase A2 group VII HGNC:9040 details
hsa-miR-124-3p DDX19A DEAD-box helicase 19A HGNC:25628 details
hsa-miR-124-3p CPOX coproporphyrinogen oxidase HGNC:2321 details
hsa-miR-124-3p DPH5 diphthamide biosynthesis 5 HGNC:24270 details
hsa-miR-124-3p NEDD4 NEDD4 E3 ubiquitin protein ligase HGNC:7727 details
hsa-miR-124-3p LAMP2 lysosomal associated membrane protein 2 HGNC:6501 details
hsa-miR-124-3p MEPE matrix extracellular phosphoglycoprotein HGNC:13361 details
hsa-miR-124-3p RAB3IL1 RAB3A interacting protein like 1 HGNC:9780 details
hsa-miR-124-3p CAST calpastatin HGNC:1515 details
hsa-miR-124-3p ZNF451 zinc finger protein 451 HGNC:21091 details
hsa-miR-124-3p AKT3 AKT serine/threonine kinase 3 HGNC:393 details
hsa-miR-124-3p ANGPTL7 angiopoietin like 7 HGNC:24078 details
hsa-miR-124-3p UNC5B unc-5 netrin receptor B HGNC:12568 details
hsa-miR-124-3p FAXDC2 fatty acid hydroxylase domain containing 2 HGNC:1334 details
hsa-miR-124-3p KIF26A kinesin family member 26A HGNC:20226 details
hsa-miR-124-3p GK5 glycerol kinase 5 HGNC:28635 details
hsa-miR-124-3p BMPR1A bone morphogenetic protein receptor type 1A HGNC:1076 details
hsa-miR-124-3p ARMC1 armadillo repeat containing 1 HGNC:17684 details
hsa-miR-124-3p MDK midkine HGNC:6972 details
hsa-miR-124-3p POLR3G RNA polymerase III subunit G HGNC:30075 details
hsa-miR-124-3p PLSCR4 phospholipid scramblase 4 HGNC:16497 details
hsa-miR-124-3p SLC44A1 solute carrier family 44 member 1 HGNC:18798 details
hsa-miR-124-3p CNN3 calponin 3 HGNC:2157 details
hsa-miR-124-3p PTPRZ1 protein tyrosine phosphatase receptor type Z1 HGNC:9685 details
hsa-miR-124-3p TWSG1 twisted gastrulation BMP signaling modulator 1 HGNC:12429 details
hsa-miR-124-3p ASCC2 activating signal cointegrator 1 complex subunit 2 HGNC:24103 details
hsa-miR-124-3p SHE Src homology 2 domain containing E HGNC:27004 details
hsa-miR-124-3p IL11 interleukin 11 HGNC:5966 details
hsa-miR-124-3p TCTA T cell leukemia translocation altered HGNC:11692 details
hsa-miR-124-3p YBX1 Y-box binding protein 1 HGNC:8014 details
hsa-miR-124-3p ANAPC5 anaphase promoting complex subunit 5 HGNC:15713 details
hsa-miR-124-3p ILF2 interleukin enhancer binding factor 2 HGNC:6037 details
hsa-miR-124-3p BTG3 BTG anti-proliferation factor 3 HGNC:1132 details
hsa-miR-124-3p details
hsa-miR-124-3p TFB2M transcription factor B2, mitochondrial HGNC:18559 details
hsa-miR-124-3p BCCIP BRCA2 and CDKN1A interacting protein HGNC:978 details
hsa-miR-124-3p SCAF11 SR-related CTD associated factor 11 HGNC:10784 details
hsa-miR-124-3p CKAP4 cytoskeleton associated protein 4 HGNC:16991 details
hsa-miR-124-3p G3BP2 G3BP stress granule assembly factor 2 HGNC:30291 details
hsa-miR-124-3p NFIB nuclear factor I B HGNC:7785 details
hsa-miR-124-3p details
hsa-miR-124-3p PTPRJ protein tyrosine phosphatase receptor type J HGNC:9673 details
hsa-miR-124-3p ASCC3 activating signal cointegrator 1 complex subunit 3 HGNC:18697 details
hsa-miR-124-3p DNAJC25 DnaJ heat shock protein family (Hsp40) member C25 HGNC:34187 details
hsa-miR-124-3p TNFRSF25 TNF receptor superfamily member 25 HGNC:11910 details
hsa-miR-124-3p FLG filaggrin HGNC:3748 details
hsa-miR-124-3p STC2 stanniocalcin 2 HGNC:11374 details
hsa-miR-124-3p PSG9 pregnancy specific beta-1-glycoprotein 9 HGNC:9526 details
hsa-miR-124-3p details
hsa-miR-124-3p KRT33A keratin 33A HGNC:6450 details
hsa-miR-124-3p ADAMTS1 ADAM metallopeptidase with thrombospondin type 1 motif 1 HGNC:217 details
hsa-miR-124-3p FHDC1 FH2 domain containing 1 HGNC:29363 details
hsa-miR-124-3p SS18L2 SS18 like 2 HGNC:15593 details
hsa-miR-124-3p GAS6 growth arrest specific 6 HGNC:4168 details
hsa-miR-124-3p NUP50 nucleoporin 50 HGNC:8065 details
hsa-miR-124-3p DRD4 dopamine receptor D4 HGNC:3025 details
hsa-miR-124-3p AIF1L allograft inflammatory factor 1 like HGNC:28904 details
hsa-miR-124-3p USP49 ubiquitin specific peptidase 49 HGNC:20078 details
hsa-miR-124-3p TMEM54 transmembrane protein 54 HGNC:24143 details
hsa-miR-124-3p KCNC4 potassium voltage-gated channel subfamily C member 4 HGNC:6236 details
hsa-miR-124-3p KDSR 3-ketodihydrosphingosine reductase HGNC:4021 details
hsa-miR-124-3p KCNK1 potassium two pore domain channel subfamily K member 1 HGNC:6272 details
hsa-miR-124-3p TRIM4 tripartite motif containing 4 HGNC:16275 details
hsa-miR-124-3p MALSU1 mitochondrial assembly of ribosomal large subunit 1 HGNC:21721 details
hsa-miR-124-3p FAM171A1 family with sequence similarity 171 member A1 HGNC:23522 details
hsa-miR-124-3p NEU4 neuraminidase 4 HGNC:21328 details
hsa-miR-124-3p FGF5 fibroblast growth factor 5 HGNC:3683 details
hsa-miR-124-3p SLC16A6 solute carrier family 16 member 6 HGNC:10927 details
hsa-miR-124-3p HFM1 helicase for meiosis 1 HGNC:20193 details
hsa-miR-124-3p MAD2L2 mitotic arrest deficient 2 like 2 HGNC:6764 details
hsa-miR-124-3p HKDC1 hexokinase domain containing 1 HGNC:23302 details
hsa-miR-124-3p CCDC71 coiled-coil domain containing 71 HGNC:25760 details
hsa-miR-124-3p C6orf89 chromosome 6 open reading frame 89 HGNC:21114 details
hsa-miR-124-3p SLC2A4RG SLC2A4 regulator HGNC:15930 details
hsa-miR-124-3p PHF21B PHD finger protein 21B HGNC:25161 details
hsa-miR-124-3p EOGT EGF domain specific O-linked N-acetylglucosamine transferase HGNC:28526 details
hsa-miR-124-3p FRMD3 FERM domain containing 3 HGNC:24125 details
hsa-miR-124-3p ROR1 receptor tyrosine kinase like orphan receptor 1 HGNC:10256 details
hsa-miR-124-3p STX18 syntaxin 18 HGNC:15942 details
hsa-miR-124-3p FAM76A family with sequence similarity 76 member A HGNC:28530 details
hsa-miR-124-3p DZIP1 DAZ interacting zinc finger protein 1 HGNC:20908 details
hsa-miR-124-3p PTP4A1 protein tyrosine phosphatase 4A1 HGNC:9634 details
hsa-miR-124-3p ABCC3 ATP binding cassette subfamily C member 3 HGNC:54 details
hsa-miR-124-3p details
hsa-miR-124-3p FXR1 FMR1 autosomal homolog 1 HGNC:4023 details
hsa-miR-124-3p NKAP NFKB activating protein HGNC:29873 details
hsa-miR-124-3p BTC betacellulin HGNC:1121 details
hsa-miR-124-3p FMOD fibromodulin HGNC:3774 details
hsa-miR-124-3p NRG1 neuregulin 1 HGNC:7997 details
hsa-miR-124-3p BCL6 BCL6 transcription repressor HGNC:1001 details
hsa-miR-124-3p details
hsa-miR-124-3p SHPK sedoheptulokinase HGNC:1492 details
hsa-miR-124-3p details
hsa-miR-124-3p TOMM34 translocase of outer mitochondrial membrane 34 HGNC:15746 details
hsa-miR-124-3p IQCE IQ motif containing E HGNC:29171 details
hsa-miR-124-3p SLC26A2 solute carrier family 26 member 2 HGNC:10994 details
hsa-miR-124-3p FAM199X family with sequence similarity 199, X-linked HGNC:25195 details
hsa-miR-124-3p THAP2 THAP domain containing 2 HGNC:20854 details
hsa-miR-124-3p SERTAD4 SERTA domain containing 4 HGNC:25236 details
hsa-miR-124-3p RYR3 ryanodine receptor 3 HGNC:10485 details
hsa-miR-124-3p PIK3C2A phosphatidylinositol-4-phosphate 3-kinase catalytic subunit type 2 alpha HGNC:8971 details
hsa-miR-124-3p TCOF1 treacle ribosome biogenesis factor 1 HGNC:11654 details
hsa-miR-124-3p CHRAC1 chromatin accessibility complex subunit 1 HGNC:13544 details
hsa-miR-124-3p NPM3 nucleophosmin/nucleoplasmin 3 HGNC:7931 details
hsa-miR-124-3p CD2BP2 CD2 cytoplasmic tail binding protein 2 HGNC:1656 details
hsa-miR-124-3p TOPBP1 DNA topoisomerase II binding protein 1 HGNC:17008 details
hsa-miR-124-3p TTLL3 tubulin tyrosine ligase like 3 HGNC:24483 details
hsa-miR-124-3p SYNE1 spectrin repeat containing nuclear envelope protein 1 HGNC:17089 details
hsa-miR-124-3p DSG2 desmoglein 2 HGNC:3049 details
hsa-miR-124-3p RBPJ recombination signal binding protein for immunoglobulin kappa J region HGNC:5724 details
hsa-miR-124-3p TLR3 toll like receptor 3 HGNC:11849 details
hsa-miR-124-3p details
hsa-miR-124-3p RAET1E retinoic acid early transcript 1E HGNC:16793 details
hsa-miR-124-3p HMOX1 heme oxygenase 1 HGNC:5013 details
hsa-miR-124-3p KAT2A lysine acetyltransferase 2A HGNC:4201 details
hsa-miR-124-3p SECTM1 secreted and transmembrane 1 HGNC:10707 details
hsa-miR-124-3p details
hsa-miR-124-3p C8orf33 chromosome 8 open reading frame 33 HGNC:26104 details
hsa-miR-124-3p MAPK11 mitogen-activated protein kinase 11 HGNC:6873 details
hsa-miR-124-3p TIMP3 TIMP metallopeptidase inhibitor 3 HGNC:11822 details
hsa-miR-124-3p RIBC2 RIB43A domain with coiled-coils 2 HGNC:13241 details
hsa-miR-124-3p PRB2 proline rich protein BstNI subfamily 2 HGNC:9338 details
hsa-miR-124-3p HSD17B2 hydroxysteroid 17-beta dehydrogenase 2 HGNC:5211 details
hsa-miR-124-3p TUBE1 tubulin epsilon 1 HGNC:20775 details
hsa-miR-124-3p MAN2A1 mannosidase alpha class 2A member 1 HGNC:6824 details
hsa-miR-124-3p PTGS2 prostaglandin-endoperoxide synthase 2 HGNC:9605 details
hsa-miR-124-3p LOXL4 lysyl oxidase like 4 HGNC:17171 details
hsa-miR-124-3p POP5 POP5 homolog, ribonuclease P/MRP subunit HGNC:17689 details
hsa-miR-124-3p SSNA1 SS nuclear autoantigen 1 HGNC:11321 details
hsa-miR-124-3p ID1 inhibitor of DNA binding 1, HLH protein HGNC:5360 details
hsa-miR-124-3p BDNF brain derived neurotrophic factor HGNC:1033 details
hsa-miR-124-3p MYH7B myosin heavy chain 7B HGNC:15906 details
hsa-miR-124-3p RHBDL2 rhomboid like 2 HGNC:16083 details
hsa-miR-124-3p YKT6 YKT6 v-SNARE homolog HGNC:16959 details
hsa-miR-124-3p PLA2G4A phospholipase A2 group IVA HGNC:9035 details
hsa-miR-124-3p FBXL18 F-box and leucine rich repeat protein 18 HGNC:21874 details
hsa-miR-124-3p NT5C1B 5'-nucleotidase, cytosolic IB HGNC:17818 details
hsa-miR-124-3p TBX2 T-box transcription factor 2 HGNC:11597 details
hsa-miR-124-3p MBD6 methyl-CpG binding domain protein 6 HGNC:20445 details
hsa-miR-124-3p SLC38A2 solute carrier family 38 member 2 HGNC:13448 details
hsa-miR-124-3p CSGALNACT1 chondroitin sulfate N-acetylgalactosaminyltransferase 1 HGNC:24290 details
hsa-miR-124-3p CD86 CD86 molecule HGNC:1705 details
hsa-miR-124-3p HAUS6 HAUS augmin like complex subunit 6 HGNC:25948 details
hsa-miR-124-3p LDLRAD4 low density lipoprotein receptor class A domain containing 4 HGNC:1224 details
hsa-miR-124-3p TSPAN6 tetraspanin 6 HGNC:11858 details
hsa-miR-124-3p COL4A4 collagen type IV alpha 4 chain HGNC:2206 details
hsa-miR-124-3p CNKSR3 CNKSR family member 3 HGNC:23034 details
hsa-miR-124-3p SLC25A36 solute carrier family 25 member 36 HGNC:25554 details
hsa-miR-124-3p TGOLN2 trans-golgi network protein 2 HGNC:15450 details
hsa-miR-124-3p CMTM4 CKLF like MARVEL transmembrane domain containing 4 HGNC:19175 details
hsa-miR-124-3p RAB11FIP5 RAB11 family interacting protein 5 HGNC:24845 details
hsa-miR-124-3p LRRC8C leucine rich repeat containing 8 VRAC subunit C HGNC:25075 details
hsa-miR-124-3p ACADVL acyl-CoA dehydrogenase very long chain HGNC:92 details
hsa-miR-124-3p BCAP29 B cell receptor associated protein 29 HGNC:24131 details
hsa-miR-124-3p FRMD6 FERM domain containing 6 HGNC:19839 details
hsa-miR-124-3p NXN nucleoredoxin HGNC:18008 details
hsa-miR-124-3p PTPN11 protein tyrosine phosphatase non-receptor type 11 HGNC:9644 details
hsa-miR-124-3p FBXO17 F-box protein 17 HGNC:18754 details
hsa-miR-124-3p SNTA1 syntrophin alpha 1 HGNC:11167 details
hsa-miR-124-3p ZMPSTE24 zinc metallopeptidase STE24 HGNC:12877 details
hsa-miR-124-3p SLC9A9 solute carrier family 9 member A9 HGNC:20653 details
hsa-miR-124-3p SMAD5 SMAD family member 5 HGNC:6771 details
hsa-miR-124-3p NRP1 neuropilin 1 HGNC:8004 details
hsa-miR-124-3p SNX16 sorting nexin 16 HGNC:14980 details
hsa-miR-124-3p AK3 adenylate kinase 3 HGNC:17376 details
hsa-miR-124-3p ANKS6 ankyrin repeat and sterile alpha motif domain containing 6 HGNC:26724 details
hsa-miR-124-3p RRP15 ribosomal RNA processing 15 homolog HGNC:24255 details
hsa-miR-124-3p WASF2 WASP family member 2 HGNC:12733 details
hsa-miR-124-3p DENND6A DENN domain containing 6A HGNC:26635 details
hsa-miR-124-3p RBM24 RNA binding motif protein 24 HGNC:21539 details
hsa-miR-124-3p RNFT1 ring finger protein, transmembrane 1 HGNC:30206 details
hsa-miR-124-3p COL1A1 collagen type I alpha 1 chain HGNC:2197 details
hsa-miR-124-3p MOGS mannosyl-oligosaccharide glucosidase HGNC:24862 details
hsa-miR-124-3p KANK2 KN motif and ankyrin repeat domains 2 HGNC:29300 details
hsa-miR-124-3p SNRPF small nuclear ribonucleoprotein polypeptide F HGNC:11162 details
hsa-miR-124-3p PARN poly(A)-specific ribonuclease HGNC:8609 details
hsa-miR-124-3p TIMM13 translocase of inner mitochondrial membrane 13 HGNC:11816 details
hsa-miR-124-3p MUC1 mucin 1, cell surface associated HGNC:7508 details
hsa-miR-124-3p PRPH peripherin HGNC:9461 details
hsa-miR-124-3p CDKN2AIP CDKN2A interacting protein HGNC:24325 details
hsa-miR-124-3p PHC2 polyhomeotic homolog 2 HGNC:3183 details
hsa-miR-124-3p DCUN1D5 defective in cullin neddylation 1 domain containing 5 HGNC:28409 details
hsa-miR-124-3p NEK9 NIMA related kinase 9 HGNC:18591 details
hsa-miR-124-3p ANAPC7 anaphase promoting complex subunit 7 HGNC:17380 details
hsa-miR-124-3p details
hsa-miR-124-3p SGSM3 small G protein signaling modulator 3 HGNC:25228 details
hsa-miR-124-3p SPATA9 spermatogenesis associated 9 HGNC:22988 details
hsa-miR-124-3p details
hsa-miR-124-3p MFSD10 major facilitator superfamily domain containing 10 HGNC:16894 details
hsa-miR-124-3p IFI44L interferon induced protein 44 like HGNC:17817 details
hsa-miR-124-3p COL6A2 collagen type VI alpha 2 chain HGNC:2212 details
hsa-miR-124-3p PRKD1 protein kinase D1 HGNC:9407 details
hsa-miR-124-3p E2F5 E2F transcription factor 5 HGNC:3119 details
hsa-miR-124-3p PRKAG1 protein kinase AMP-activated non-catalytic subunit gamma 1 HGNC:9385 details
hsa-miR-124-3p SLC39A11 solute carrier family 39 member 11 HGNC:14463 details
hsa-miR-124-3p MTCH1 mitochondrial carrier 1 HGNC:17586 details
hsa-miR-124-3p HOXA3 homeobox A3 HGNC:5104 details
hsa-miR-124-3p CHST6 carbohydrate sulfotransferase 6 HGNC:6938 details
hsa-miR-124-3p RAB32 RAB32, member RAS oncogene family HGNC:9772 details
hsa-miR-124-3p ZNF549 zinc finger protein 549 HGNC:26632 details
hsa-miR-124-3p ANKRD42 ankyrin repeat domain 42 HGNC:26752 details
hsa-miR-124-3p DOK7 docking protein 7 HGNC:26594 details
hsa-miR-124-3p TGM1 transglutaminase 1 HGNC:11777 details
hsa-miR-124-3p MMP26 matrix metallopeptidase 26 HGNC:14249 details
hsa-miR-124-3p CABLES1 Cdk5 and Abl enzyme substrate 1 HGNC:25097 details
hsa-miR-124-3p SHC3 SHC adaptor protein 3 HGNC:18181 details
hsa-miR-124-3p FAM83D family with sequence similarity 83 member D HGNC:16122 details
hsa-miR-124-3p PTP4A2 protein tyrosine phosphatase 4A2 HGNC:9635 details
hsa-miR-124-3p ETNPPL ethanolamine-phosphate phospho-lyase HGNC:14404 details
hsa-miR-124-3p MAPKAPK3 MAPK activated protein kinase 3 HGNC:6888 details
hsa-miR-124-3p CPM carboxypeptidase M HGNC:2311 details
hsa-miR-124-3p PEMT phosphatidylethanolamine N-methyltransferase HGNC:8830 details
hsa-miR-124-3p SKIL SKI like proto-oncogene HGNC:10897 details
hsa-miR-124-3p DAPK1 death associated protein kinase 1 HGNC:2674 details
hsa-miR-124-3p MXD4 MAX dimerization protein 4 HGNC:13906 details
hsa-miR-124-3p DBNL drebrin like HGNC:2696 details
hsa-miR-124-3p ABHD4 abhydrolase domain containing 4, N-acyl phospholipase B HGNC:20154 details
hsa-miR-124-3p GALNT3 polypeptide N-acetylgalactosaminyltransferase 3 HGNC:4125 details
hsa-miR-124-3p TMED10 transmembrane p24 trafficking protein 10 HGNC:16998 details
hsa-miR-124-3p ANKS1B ankyrin repeat and sterile alpha motif domain containing 1B HGNC:24600 details
hsa-miR-124-3p details
hsa-miR-124-3p HSPB7 heat shock protein family B (small) member 7 HGNC:5249 details
hsa-miR-124-3p SLC25A39 solute carrier family 25 member 39 HGNC:24279 details
hsa-miR-124-3p SNX7 sorting nexin 7 HGNC:14971 details
hsa-miR-124-3p SLC29A1 solute carrier family 29 member 1 (Augustine blood group) HGNC:11003 details
hsa-miR-124-3p MKLN1 muskelin 1 HGNC:7109 details
hsa-miR-124-3p ATRIP ATR interacting protein HGNC:33499 details
hsa-miR-124-3p MVB12A multivesicular body subunit 12A HGNC:25153 details
hsa-miR-124-3p IMPACT impact RWD domain protein HGNC:20387 details
hsa-miR-124-3p FAM133A family with sequence similarity 133 member A HGNC:26748 details
hsa-miR-124-3p NR4A3 nuclear receptor subfamily 4 group A member 3 HGNC:7982 details
hsa-miR-124-3p CYP2U1 cytochrome P450 family 2 subfamily U member 1 HGNC:20582 details
hsa-miR-124-3p DHRS1 dehydrogenase/reductase 1 HGNC:16445 details
hsa-miR-124-3p MSRA methionine sulfoxide reductase A HGNC:7377 details
hsa-miR-124-3p POC1B POC1 centriolar protein B HGNC:30836 details
hsa-miR-124-3p UMPS uridine monophosphate synthetase HGNC:12563 details
hsa-miR-124-3p GRM1 glutamate metabotropic receptor 1 HGNC:4593 details
hsa-miR-124-3p GIT2 GIT ArfGAP 2 HGNC:4273 details
hsa-miR-124-3p TP53INP1 tumor protein p53 inducible nuclear protein 1 HGNC:18022 details
hsa-miR-124-3p EGR2 early growth response 2 HGNC:3239 details
hsa-miR-124-3p KRI1 KRI1 homolog HGNC:25769 details
hsa-miR-124-3p MISP mitotic spindle positioning HGNC:27000 details
hsa-miR-124-3p ALDOB aldolase, fructose-bisphosphate B HGNC:417 details
hsa-miR-124-3p RHOV ras homolog family member V HGNC:18313 details
hsa-miR-124-3p IFI16 interferon gamma inducible protein 16 HGNC:5395 details
hsa-miR-124-3p RAVER1 ribonucleoprotein, PTB binding 1 HGNC:30296 details
hsa-miR-124-3p DCTN3 dynactin subunit 3 HGNC:2713 details
hsa-miR-124-3p QKI QKI, KH domain containing RNA binding HGNC:21100 details
hsa-miR-124-3p MTPN myotrophin HGNC:15667 details
hsa-miR-124-3p DDIT4 DNA damage inducible transcript 4 HGNC:24944 details
hsa-miR-124-3p TGFB1I1 transforming growth factor beta 1 induced transcript 1 HGNC:11767 details
hsa-miR-124-3p details
hsa-miR-124-3p ZNF655 zinc finger protein 655 HGNC:30899 details
hsa-miR-124-3p C1orf122 chromosome 1 open reading frame 122 HGNC:24789 details
hsa-miR-124-3p NTF4 neurotrophin 4 HGNC:8024 details
hsa-miR-124-3p CCDC142 coiled-coil domain containing 142 HGNC:25889 details
hsa-miR-124-3p DCC DCC netrin 1 receptor HGNC:2701 details
hsa-miR-124-3p ZNF395 zinc finger protein 395 HGNC:18737 details
hsa-miR-124-3p EVI2A ecotropic viral integration site 2A HGNC:3499 details
hsa-miR-124-3p QSER1 glutamine and serine rich 1 HGNC:26154 details
hsa-miR-124-3p PDSS1 decaprenyl diphosphate synthase subunit 1 HGNC:17759 details
hsa-miR-124-3p NSUN7 NOP2/Sun RNA methyltransferase family member 7 HGNC:25857 details
hsa-miR-124-3p details
hsa-miR-124-3p PGGT1B protein geranylgeranyltransferase type I subunit beta HGNC:8895 details
hsa-miR-124-3p RSAD1 radical S-adenosyl methionine domain containing 1 HGNC:25634 details
hsa-miR-124-3p BABAM1 BRISC and BRCA1 A complex member 1 HGNC:25008 details
hsa-miR-124-3p ABCG8 ATP binding cassette subfamily G member 8 HGNC:13887 details
hsa-miR-124-3p COL8A2 collagen type VIII alpha 2 chain HGNC:2216 details
hsa-miR-124-3p TSR2 TSR2 ribosome maturation factor HGNC:25455 details
hsa-miR-124-3p TRIM65 tripartite motif containing 65 HGNC:27316 details
hsa-miR-124-3p CTHRC1 collagen triple helix repeat containing 1 HGNC:18831 details
hsa-miR-124-3p details
hsa-miR-124-3p OASL 2'-5'-oligoadenylate synthetase like HGNC:8090 details
hsa-miR-124-3p NID1 nidogen 1 HGNC:7821 details
hsa-miR-124-3p USP5 ubiquitin specific peptidase 5 HGNC:12628 details
hsa-miR-124-3p IFIT3 interferon induced protein with tetratricopeptide repeats 3 HGNC:5411 details
hsa-miR-124-3p ITPRIP inositol 1,4,5-trisphosphate receptor interacting protein HGNC:29370 details
hsa-miR-124-3p VIT vitrin HGNC:12697 details
hsa-miR-124-3p TUBB2B tubulin beta 2B class IIb HGNC:30829 details
hsa-miR-124-3p IGFBP4 insulin like growth factor binding protein 4 HGNC:5473 details
hsa-miR-124-3p C1orf198 chromosome 1 open reading frame 198 HGNC:25900 details
hsa-miR-124-3p CDV3 CDV3 homolog HGNC:26928 details
hsa-miR-124-3p details
hsa-miR-124-3p FECH ferrochelatase HGNC:3647 details
hsa-miR-124-3p VAMP8 vesicle associated membrane protein 8 HGNC:12647 details
hsa-miR-124-3p FNDC3B fibronectin type III domain containing 3B HGNC:24670 details
hsa-miR-124-3p KCNS3 potassium voltage-gated channel modifier subfamily S member 3 HGNC:6302 details
hsa-miR-124-3p MAP3K7CL MAP3K7 C-terminal like HGNC:16457 details
hsa-miR-124-3p FMNL2 formin like 2 HGNC:18267 details
hsa-miR-124-3p FAM89A family with sequence similarity 89 member A HGNC:25057 details
hsa-miR-124-3p ICMT isoprenylcysteine carboxyl methyltransferase HGNC:5350 details
hsa-miR-124-3p GPC1 glypican 1 HGNC:4449 details
hsa-miR-124-3p PRDM13 PR/SET domain 13 HGNC:13998 details
hsa-miR-124-3p PNP purine nucleoside phosphorylase HGNC:7892 details
hsa-miR-124-3p ACOT11 acyl-CoA thioesterase 11 HGNC:18156 details
hsa-miR-124-3p SLC35F3 solute carrier family 35 member F3 HGNC:23616 details
hsa-miR-124-3p RPP25L ribonuclease P/MRP subunit p25 like HGNC:19909 details
hsa-miR-124-3p RHBDF1 rhomboid 5 homolog 1 HGNC:20561 details
hsa-miR-124-3p SOX9 SRY-box transcription factor 9 HGNC:11204 details
hsa-miR-124-3p TXLNA taxilin alpha HGNC:30685 details
hsa-miR-124-3p details
hsa-miR-124-3p NUFIP2 nuclear FMR1 interacting protein 2 HGNC:17634 details
hsa-miR-124-3p TMED1 transmembrane p24 trafficking protein 1 HGNC:17291 details
hsa-miR-124-3p GGA2 golgi associated, gamma adaptin ear containing, ARF binding protein 2 HGNC:16064 details
hsa-miR-124-3p PPARA peroxisome proliferator activated receptor alpha HGNC:9232 details
hsa-miR-124-3p TPD52L2 TPD52 like 2 HGNC:12007 details
hsa-miR-124-3p ANAPC4 anaphase promoting complex subunit 4 HGNC:19990 details
hsa-miR-124-3p IGFBP7 insulin like growth factor binding protein 7 HGNC:5476 details
hsa-miR-124-3p CCT3 chaperonin containing TCP1 subunit 3 HGNC:1616 details
hsa-miR-124-3p NONO non-POU domain containing octamer binding HGNC:7871 details
hsa-miR-124-3p THOC6 THO complex 6 HGNC:28369 details
hsa-miR-124-3p CTNNB1 catenin beta 1 HGNC:2514 details
hsa-miR-124-3p CLTA clathrin light chain A HGNC:2090 details
hsa-miR-124-3p TFAP4 transcription factor AP-4 HGNC:11745 details
hsa-miR-124-3p ACTR3 actin related protein 3 HGNC:170 details
hsa-miR-124-3p CHMP2B charged multivesicular body protein 2B HGNC:24537 details
hsa-miR-124-3p EIF4E eukaryotic translation initiation factor 4E HGNC:3287 details
hsa-miR-124-3p BLOC1S6 biogenesis of lysosomal organelles complex 1 subunit 6 HGNC:8549 details
hsa-miR-124-3p PTBP3 polypyrimidine tract binding protein 3 HGNC:10253 details
hsa-miR-124-3p RPL23 ribosomal protein L23 HGNC:10316 details
hsa-miR-124-3p BCL6B BCL6B transcription repressor HGNC:1002 details
hsa-miR-124-3p S100A2 S100 calcium binding protein A2 HGNC:10492 details
hsa-miR-124-3p LINC00174 long intergenic non-protein coding RNA 174 HGNC:27788 details
hsa-miR-124-3p DNAH5 dynein axonemal heavy chain 5 HGNC:2950 details
hsa-miR-124-3p CARD14 caspase recruitment domain family member 14 HGNC:16446 details
hsa-miR-124-3p ANO6 anoctamin 6 HGNC:25240 details
hsa-miR-124-3p GREM1 gremlin 1, DAN family BMP antagonist HGNC:2001 details
hsa-miR-124-3p TRPV3 transient receptor potential cation channel subfamily V member 3 HGNC:18084 details
hsa-miR-124-3p NPR1 natriuretic peptide receptor 1 HGNC:7943 details
hsa-miR-124-3p ANGPTL4 angiopoietin like 4 HGNC:16039 details
hsa-miR-124-3p HTRA3 HtrA serine peptidase 3 HGNC:30406 details
hsa-miR-124-3p WRAP53 WD repeat containing antisense to TP53 HGNC:25522 details
hsa-miR-124-3p NTHL1 nth like DNA glycosylase 1 HGNC:8028 details
hsa-miR-124-3p DPYD dihydropyrimidine dehydrogenase HGNC:3012 details
hsa-miR-124-3p GABBR2 gamma-aminobutyric acid type B receptor subunit 2 HGNC:4507 details
hsa-miR-124-3p DNAJC25-GNG10 DNAJC25-GNG10 readthrough HGNC:37501 details
hsa-miR-124-3p IL27RA interleukin 27 receptor subunit alpha HGNC:17290 details
hsa-miR-124-3p GNRHR gonadotropin releasing hormone receptor HGNC:4421 details
hsa-miR-124-3p TTC8 tetratricopeptide repeat domain 8 HGNC:20087 details
hsa-miR-124-3p STK38L serine/threonine kinase 38 like HGNC:17848 details
hsa-miR-124-3p TUBB4A tubulin beta 4A class IVa HGNC:20774 details
hsa-miR-124-3p IFIT2 interferon induced protein with tetratricopeptide repeats 2 HGNC:5409 details
hsa-miR-124-3p ARRDC1 arrestin domain containing 1 HGNC:28633 details
hsa-miR-124-3p NRF1 nuclear respiratory factor 1 HGNC:7996 details
hsa-miR-124-3p EIF2AK2 eukaryotic translation initiation factor 2 alpha kinase 2 HGNC:9437 details
hsa-miR-124-3p NID2 nidogen 2 HGNC:13389 details
hsa-miR-124-3p details
hsa-miR-124-3p ADAMTSL5 ADAMTS like 5 HGNC:27912 details
hsa-miR-124-3p SCN3A sodium voltage-gated channel alpha subunit 3 HGNC:10590 details
hsa-miR-124-3p NDE1 nudE neurodevelopment protein 1 HGNC:17619 details
hsa-miR-124-3p BEX1 brain expressed X-linked 1 HGNC:1036 details
hsa-miR-124-3p GDA guanine deaminase HGNC:4212 details
hsa-miR-124-3p PDE3B phosphodiesterase 3B HGNC:8779 details
hsa-miR-124-3p RECK reversion inducing cysteine rich protein with kazal motifs HGNC:11345 details
hsa-miR-124-3p CTNS cystinosin, lysosomal cystine transporter HGNC:2518 details
hsa-miR-124-3p MKX mohawk homeobox HGNC:23729 details
hsa-miR-124-3p SGMS1 sphingomyelin synthase 1 HGNC:29799 details
hsa-miR-124-3p AKT2 AKT serine/threonine kinase 2 HGNC:392 details
hsa-miR-124-3p LAPTM4A lysosomal protein transmembrane 4 alpha HGNC:6924 details
hsa-miR-124-3p SLC7A1 solute carrier family 7 member 1 HGNC:11057 details
hsa-miR-124-3p ZNF548 zinc finger protein 548 HGNC:26561 details
hsa-miR-124-3p NLRX1 NLR family member X1 HGNC:29890 details
hsa-miR-124-3p ACP6 acid phosphatase 6, lysophosphatidic HGNC:29609 details
hsa-miR-124-3p SDF2L1 stromal cell derived factor 2 like 1 HGNC:10676 details
hsa-miR-124-3p DACT1 dishevelled binding antagonist of beta catenin 1 HGNC:17748 details
hsa-miR-124-3p POGLUT1 protein O-glucosyltransferase 1 HGNC:22954 details
hsa-miR-124-3p AMMECR1 AMMECR nuclear protein 1 HGNC:467 details
hsa-miR-124-3p VPS4B vacuolar protein sorting 4 homolog B HGNC:10895 details
hsa-miR-124-3p TRIP12 thyroid hormone receptor interactor 12 HGNC:12306 details
hsa-miR-124-3p TMEM184B transmembrane protein 184B HGNC:1310 details
hsa-miR-124-3p details
hsa-miR-124-3p KIF16B kinesin family member 16B HGNC:15869 details
hsa-miR-124-3p ITSN2 intersectin 2 HGNC:6184 details
hsa-miR-124-3p details
hsa-miR-124-3p CCDC68 coiled-coil domain containing 68 HGNC:24350 details
hsa-miR-124-3p AKT1S1 AKT1 substrate 1 HGNC:28426 details
hsa-miR-124-3p PHF6 PHD finger protein 6 HGNC:18145 details
hsa-miR-124-3p MBD3 methyl-CpG binding domain protein 3 HGNC:6918 details
hsa-miR-124-3p STX10 syntaxin 10 HGNC:11428 details
hsa-miR-124-3p FLII FLII actin remodeling protein HGNC:3750 details
hsa-miR-124-3p CSRP1 cysteine and glycine rich protein 1 HGNC:2469 details
hsa-miR-124-3p GOLGA7 golgin A7 HGNC:24876 details
hsa-miR-124-3p DPF2 double PHD fingers 2 HGNC:9964 details
hsa-miR-124-3p details
hsa-miR-124-3p RHOC ras homolog family member C HGNC:669 details
hsa-miR-124-3p ABCF2 ATP binding cassette subfamily F member 2 HGNC:71 details
hsa-miR-124-3p DKC1 dyskerin pseudouridine synthase 1 HGNC:2890 details
hsa-miR-124-3p CCDC86 coiled-coil domain containing 86 HGNC:28359 details
hsa-miR-124-3p LARP1 La ribonucleoprotein 1, translational regulator HGNC:29531 details
hsa-miR-124-3p HADHA hydroxyacyl-CoA dehydrogenase trifunctional multienzyme complex subunit alpha HGNC:4801 details
hsa-miR-124-3p EFHD2 EF-hand domain family member D2 HGNC:28670 details
hsa-miR-124-3p ANXA5 annexin A5 HGNC:543 details
hsa-miR-124-3p SPOCD1 SPOC domain containing 1 HGNC:26338 details
hsa-miR-124-3p GPX7 glutathione peroxidase 7 HGNC:4559 details
hsa-miR-124-3p EPDR1 ependymin related 1 HGNC:17572 details
hsa-miR-124-3p HADHB hydroxyacyl-CoA dehydrogenase trifunctional multienzyme complex subunit beta HGNC:4803 details
hsa-miR-124-3p KIAA1217 KIAA1217 HGNC:25428 details
hsa-miR-124-3p CNNM2 cyclin and CBS domain divalent metal cation transport mediator 2 HGNC:103 details
hsa-miR-124-3p ACTR5 actin related protein 5 HGNC:14671 details
hsa-miR-124-3p GCSAML germinal center associated signaling and motility like HGNC:29583 details
hsa-miR-124-3p PLSCR3 phospholipid scramblase 3 HGNC:16495 details
hsa-miR-124-3p SLC38A5 solute carrier family 38 member 5 HGNC:18070 details
hsa-miR-124-3p DSCAML1 DS cell adhesion molecule like 1 HGNC:14656 details
hsa-miR-124-3p CCM2L CCM2 like scaffold protein HGNC:16153 details
hsa-miR-124-3p BARX1 BARX homeobox 1 HGNC:955 details
hsa-miR-124-3p THPO thrombopoietin HGNC:11795 details
hsa-miR-124-3p ATG4A autophagy related 4A cysteine peptidase HGNC:16489 details
hsa-miR-124-3p SLC35A2 solute carrier family 35 member A2 HGNC:11022 details
hsa-miR-124-3p MTMR6 myotubularin related protein 6 HGNC:7453 details
hsa-miR-124-3p VASN vasorin HGNC:18517 details
hsa-miR-124-3p F3 coagulation factor III, tissue factor HGNC:3541 details
hsa-miR-124-3p AAMDC adipogenesis associated Mth938 domain containing HGNC:30205 details
hsa-miR-124-3p NUPR1 nuclear protein 1, transcriptional regulator HGNC:29990 details
hsa-miR-124-3p LRRC42 leucine rich repeat containing 42 HGNC:28792 details
hsa-miR-124-3p MTUS2 microtubule associated scaffold protein 2 HGNC:20595 details
hsa-miR-124-3p RFFL ring finger and FYVE like domain containing E3 ubiquitin protein ligase HGNC:24821 details
hsa-miR-124-3p ROBO3 roundabout guidance receptor 3 HGNC:13433 details
hsa-miR-124-3p CCNA1 cyclin A1 HGNC:1577 details
hsa-miR-124-3p C4BPB complement component 4 binding protein beta HGNC:1328 details
hsa-miR-124-3p FAR1 fatty acyl-CoA reductase 1 HGNC:26222 details
hsa-miR-124-3p CBR3 carbonyl reductase 3 HGNC:1549 details
hsa-miR-124-3p TRPC6 transient receptor potential cation channel subfamily C member 6 HGNC:12338 details
hsa-miR-124-3p RASSF2 Ras association domain family member 2 HGNC:9883 details
hsa-miR-124-3p details
hsa-miR-124-3p PREB prolactin regulatory element binding HGNC:9356 details
hsa-miR-124-3p SMPDL3A sphingomyelin phosphodiesterase acid like 3A HGNC:17389 details
hsa-miR-124-3p FGFBP1 fibroblast growth factor binding protein 1 HGNC:19695 details
hsa-miR-124-3p LRRC15 leucine rich repeat containing 15 HGNC:20818 details
hsa-miR-124-3p CCDC121 coiled-coil domain containing 121 HGNC:25833 details
hsa-miR-124-3p TMEM104 transmembrane protein 104 HGNC:25984 details
hsa-miR-124-3p HRH1 histamine receptor H1 HGNC:5182 details
hsa-miR-124-3p LIMD1 LIM domain containing 1 HGNC:6612 details
hsa-miR-124-3p LRRFIP2 LRR binding FLII interacting protein 2 HGNC:6703 details
hsa-miR-124-3p RAB31 RAB31, member RAS oncogene family HGNC:9771 details
hsa-miR-124-3p PLEKHG4 pleckstrin homology and RhoGEF domain containing G4 HGNC:24501 details
hsa-miR-124-3p PARP9 poly(ADP-ribose) polymerase family member 9 HGNC:24118 details
hsa-miR-124-3p GCH1 GTP cyclohydrolase 1 HGNC:4193 details
hsa-miR-124-3p SPTY2D1 SPT2 chromatin protein domain containing 1 HGNC:26818 details
hsa-miR-124-3p GXYLT1 glucoside xylosyltransferase 1 HGNC:27482 details
hsa-miR-124-3p ZBTB6 zinc finger and BTB domain containing 6 HGNC:16764 details
hsa-miR-124-3p FSTL1 follistatin like 1 HGNC:3972 details
hsa-miR-124-3p RPIA ribose 5-phosphate isomerase A HGNC:10297 details
hsa-miR-124-3p LPP LIM domain containing preferred translocation partner in lipoma HGNC:6679 details
hsa-miR-124-3p SHMT2 serine hydroxymethyltransferase 2 HGNC:10852 details
hsa-miR-124-3p TUBA1A tubulin alpha 1a HGNC:20766 details
hsa-miR-124-3p PES1 pescadillo ribosomal biogenesis factor 1 HGNC:8848 details
hsa-miR-124-3p ALDH3B2 aldehyde dehydrogenase 3 family member B2 HGNC:411 details
hsa-miR-124-3p MCM7 minichromosome maintenance complex component 7 HGNC:6950 details
hsa-miR-124-3p POLR2J RNA polymerase II subunit J HGNC:9197 details
hsa-miR-124-3p details
hsa-miR-124-3p CAPRIN1 cell cycle associated protein 1 HGNC:6743 details
hsa-miR-124-3p CNP 2',3'-cyclic nucleotide 3' phosphodiesterase HGNC:2158 details
hsa-miR-124-3p PACSIN3 protein kinase C and casein kinase substrate in neurons 3 HGNC:8572 details
hsa-miR-124-3p ADD3 adducin 3 HGNC:245 details
hsa-miR-124-3p FOXRED2 FAD dependent oxidoreductase domain containing 2 HGNC:26264 details
hsa-miR-124-3p RRAS2 RAS related 2 HGNC:17271 details
hsa-miR-124-3p MSN moesin HGNC:7373 details
hsa-miR-124-3p DDX3X DEAD-box helicase 3 X-linked HGNC:2745 details
hsa-miR-124-3p ADIPOR2 adiponectin receptor 2 HGNC:24041 details
hsa-miR-124-3p TP63 tumor protein p63 HGNC:15979 details
hsa-miR-124-3p details
hsa-miR-124-3p SH2D1B SH2 domain containing 1B HGNC:30416 details
hsa-miR-124-3p ELP2 elongator acetyltransferase complex subunit 2 HGNC:18248 details
hsa-miR-124-3p P4HA3 prolyl 4-hydroxylase subunit alpha 3 HGNC:30135 details
hsa-miR-124-3p CLMP CXADR like membrane protein HGNC:24039 details
hsa-miR-124-3p RASIP1 Ras interacting protein 1 HGNC:24716 details
hsa-miR-124-3p GOLT1B golgi transport 1B HGNC:20175 details
hsa-miR-124-3p IVD isovaleryl-CoA dehydrogenase HGNC:6186 details
hsa-miR-124-3p details
hsa-miR-124-3p ANKS3 ankyrin repeat and sterile alpha motif domain containing 3 HGNC:29422 details
hsa-miR-124-3p CSTF3 cleavage stimulation factor subunit 3 HGNC:2485 details
hsa-miR-124-3p EIF4EBP1 eukaryotic translation initiation factor 4E binding protein 1 HGNC:3288 details
hsa-miR-124-3p MRPS11 mitochondrial ribosomal protein S11 HGNC:14050 details
hsa-miR-124-3p ID4 inhibitor of DNA binding 4, HLH protein HGNC:5363 details
hsa-miR-124-3p CXXC1 CXXC finger protein 1 HGNC:24343 details
hsa-miR-124-3p XBP1 X-box binding protein 1 HGNC:12801 details
hsa-miR-124-3p NTMT1 N-terminal Xaa-Pro-Lys N-methyltransferase 1 HGNC:23373 details
hsa-miR-124-3p SNAI1 snail family transcriptional repressor 1 HGNC:11128 details
hsa-miR-124-3p RHOA ras homolog family member A HGNC:667 details
hsa-miR-124-3p NCF2 neutrophil cytosolic factor 2 HGNC:7661 details
hsa-miR-124-3p CHODL chondrolectin HGNC:17807 details
hsa-miR-124-3p CDO1 cysteine dioxygenase type 1 HGNC:1795 details
hsa-miR-124-3p WNT5B Wnt family member 5B HGNC:16265 details
hsa-miR-124-3p TMEM179B transmembrane protein 179B HGNC:33744 details
hsa-miR-124-3p USP47 ubiquitin specific peptidase 47 HGNC:20076 details
hsa-miR-124-3p LCA5L lebercilin LCA5 like HGNC:1255 details
hsa-miR-124-3p CRB1 crumbs cell polarity complex component 1 HGNC:2343 details
hsa-miR-124-3p CD2AP CD2 associated protein HGNC:14258 details
hsa-miR-124-3p details
hsa-miR-124-3p MAP3K4 mitogen-activated protein kinase kinase kinase 4 HGNC:6856 details
hsa-miR-124-3p details
hsa-miR-124-3p details
hsa-miR-124-3p LRIG1 leucine rich repeats and immunoglobulin like domains 1 HGNC:17360 details
hsa-miR-124-3p CENPQ centromere protein Q HGNC:21347 details
hsa-miR-124-3p RUNX2 RUNX family transcription factor 2 HGNC:10472 details
hsa-miR-124-3p details
hsa-miR-124-3p QSOX1 quiescin sulfhydryl oxidase 1 HGNC:9756 details
hsa-miR-124-3p RAB38 RAB38, member RAS oncogene family HGNC:9776 details
hsa-miR-124-3p AHRR aryl-hydrocarbon receptor repressor HGNC:346 details
hsa-miR-124-3p details
hsa-miR-124-3p H6PD hexose-6-phosphate dehydrogenase/glucose 1-dehydrogenase HGNC:4795 details
hsa-miR-124-3p PARP14 poly(ADP-ribose) polymerase family member 14 HGNC:29232 details
hsa-miR-124-3p RAB2A RAB2A, member RAS oncogene family HGNC:9763 details
hsa-miR-124-3p KIF13A kinesin family member 13A HGNC:14566 details
hsa-miR-124-3p CACUL1 CDK2 associated cullin domain 1 HGNC:23727 details
hsa-miR-124-3p PRPS1 phosphoribosyl pyrophosphate synthetase 1 HGNC:9462 details
hsa-miR-124-3p ERF ETS2 repressor factor HGNC:3444 details
hsa-miR-124-3p CTDSPL CTD small phosphatase like HGNC:16890 details
hsa-miR-124-3p MLLT3 MLLT3 super elongation complex subunit HGNC:7136 details
hsa-miR-124-3p PSKH1 protein serine kinase H1 HGNC:9529 details
hsa-miR-124-3p SLITRK4 SLIT and NTRK like family member 4 HGNC:23502 details
hsa-miR-124-3p EVI5 ecotropic viral integration site 5 HGNC:3501 details
hsa-miR-124-3p SLC30A7 solute carrier family 30 member 7 HGNC:19306 details
hsa-miR-124-3p TBX22 T-box transcription factor 22 HGNC:11600 details
hsa-miR-124-3p KCNK2 potassium two pore domain channel subfamily K member 2 HGNC:6277 details
hsa-miR-124-3p WIPF1 WAS/WASL interacting protein family member 1 HGNC:12736 details
hsa-miR-124-3p HIPK3 homeodomain interacting protein kinase 3 HGNC:4915 details
hsa-miR-124-3p BMP6 bone morphogenetic protein 6 HGNC:1073 details
hsa-miR-124-3p STT3A STT3 oligosaccharyltransferase complex catalytic subunit A HGNC:6172 details
hsa-miR-124-3p SNX9 sorting nexin 9 HGNC:14973 details
hsa-miR-124-3p RPRD1B regulation of nuclear pre-mRNA domain containing 1B HGNC:16209 details
hsa-miR-124-3p GLIPR2 GLI pathogenesis related 2 HGNC:18007 details
hsa-miR-124-3p GAR1 GAR1 ribonucleoprotein HGNC:14264 details
hsa-miR-124-3p POLR2L RNA polymerase II, I and III subunit L HGNC:9199 details
hsa-miR-124-3p PABPC4 poly(A) binding protein cytoplasmic 4 HGNC:8557 details
hsa-miR-124-3p SERPINH1 serpin family H member 1 HGNC:1546 details
hsa-miR-124-3p KDM2A lysine demethylase 2A HGNC:13606 details
hsa-miR-124-3p HNRNPCL1 heterogeneous nuclear ribonucleoprotein C like 1 HGNC:29295 details
hsa-miR-124-3p ALDH18A1 aldehyde dehydrogenase 18 family member A1 HGNC:9722