miRNA Card

miRNA General Information
miRNA ID hsa-miR-1277-5p
Description Homo sapiens miR-1277 stem-loop
Comment None
Experiment
Sequence AAAUAUAUAUAUAUAUGUACGUAU
miRNA Expression in different cancers

    by mir_boxplot.py

circRNA-miRNA-gene regulatory network

Note about Netwrok:
This is a network diagram with miRNA (purple circle) as the center.
We used three tools(PITA, miRanda, targetScan) to predict the binding sites of circrna (green circle) and miRNA. Accordingly, for this miRNA that binds to circrna, we have three confidence levels, namely confident 1, confident 2 and confident 3. Confidence value indicates how many tools can deduce these results. For each confidence, we use different kinds of dashed lines.

Target circRNA with confidence

Confidence 3 (3 of 3 tools predicted)

CircID miRNA PITA miRanda targetScan

Confidence 2 (2 of 3 tools predicted)

CircID miRNA PITA miRanda targetScan
chr17:47118464|47118622 hsa-miR-1277-5p 1 1 0

Confidence 1 (1 of 3 tools predicted)

CircID miRNA PITA miRanda targetScan
chr1:220650639|220652005 hsa-miR-1277-5p 0 0 1
chr6:33203638|33203756 hsa-miR-1277-5p 0 0 1
chr12:89349216|89349321 hsa-miR-1277-5p 0 0 1
chr12:12975430|12987202 hsa-miR-1277-5p 0 0 1
chr12:6938667|6938786 hsa-miR-1277-5p 0 0 1
chr5:81239196|81239315 hsa-miR-1277-5p 0 0 1
chrX:154349388|154349726 hsa-miR-1277-5p 0 0 1
chr1:201461484|201461678 hsa-miR-1277-5p 0 0 1
chr18:57615908|57620606 hsa-miR-1277-5p 0 0 1
chr14:61278985|61279115 hsa-miR-1277-5p 0 0 1
chr15:25072725|25072863 hsa-miR-1277-5p 0 0 1
chr1:35187203|35188083 hsa-miR-1277-5p 0 0 1
chr4:185614831|185615092 hsa-miR-1277-5p 0 0 1
chr6:33203614|33203789 hsa-miR-1277-5p 0 0 1
chr7:142864418|142864585 hsa-miR-1277-5p 0 0 1
chr17:42571549|42571689 hsa-miR-1277-5p 0 0 1
chr19:282136|282257 hsa-miR-1277-5p 0 0 1
chr5:128138824|128138898 hsa-miR-1277-5p 0 0 1
chr12:6938589|6938708 hsa-miR-1277-5p 0 0 1
chr1:18877236|18877545 hsa-miR-1277-5p 0 0 1
chr2:241584618|241601913 hsa-miR-1277-5p 0 0 1
chr13:113324492|113324634 hsa-miR-1277-5p 0 0 1
chr16:46813422|46813510 hsa-miR-1277-5p 0 0 1
chr9:128322515|128322666 hsa-miR-1277-5p 0 0 1
chrX:48707690|48707803 hsa-miR-1277-5p 0 0 1
chr10:113141184|113146097 hsa-miR-1277-5p 0 0 1
chr14:61278993|61279115 hsa-miR-1277-5p 0 0 1
chr16:15037004|15037284 hsa-miR-1277-5p 0 0 1
chr12:91146030|91146194 hsa-miR-1277-5p 0 0 1
chr5:177306601|177306812 hsa-miR-1277-5p 0 0 1
chr3:50185686|50185978 hsa-miR-1277-5p 0 0 1
chrX:150766919|150767023 hsa-miR-1277-5p 0 0 1
chr4:6674715|6674821 hsa-miR-1277-5p 0 0 1
chr14:61278993|61279117 hsa-miR-1277-5p 0 0 1
chr17:42571580|42571698 hsa-miR-1277-5p 0 0 1
chr9:128309346|128309489 hsa-miR-1277-5p 0 0 1
chr2:241721206|241721430 hsa-miR-1277-5p 0 0 1
chr3:128070006|128070118 hsa-miR-1277-5p 0 0 1
chr4:75049590|75049692 hsa-miR-1277-5p 0 0 1
chr8:38413683|38413792 hsa-miR-1277-5p 0 0 1
chr19:49831940|49832019 hsa-miR-1277-5p 0 0 1
chrX:41210509|41214709 hsa-miR-1277-5p 0 0 1
chr14:37591476|37591610 hsa-miR-1277-5p 0 0 1
chr19:18784913|18785027 hsa-miR-1277-5p 0 0 1
chr1:161119819|161120135 hsa-miR-1277-5p 0 0 1
chr6:99401052|99401173 hsa-miR-1277-5p 0 0 1
chr2:188997165|188998718 hsa-miR-1277-5p 0 0 1
chr9:113162955|113163217 hsa-miR-1277-5p 0 0 1
chr9:37438306|37438460 hsa-miR-1277-5p 0 0 1
chr4:55478815|55479664 hsa-miR-1277-5p 0 0 1
chr7:99968189|99968335 hsa-miR-1277-5p 0 0 1
chr1:206723900|206724024 hsa-miR-1277-5p 0 0 1
chr5:66170051|66170154 hsa-miR-1277-5p 0 0 1
chr1:35188002|35188083 hsa-miR-1277-5p 0 0 1
chr1:178458236|178458423 hsa-miR-1277-5p 0 0 1
chr7:137878247|137878349 hsa-miR-1277-5p 0 0 1
chr1:155612062|155612289 hsa-miR-1277-5p 0 0 1
chr1:35187230|35188083 hsa-miR-1277-5p 0 0 1
chr3:44359243|44359364 hsa-miR-1277-5p 0 0 1
chrX:154349362|154349549 hsa-miR-1277-5p 0 0 1
chr6:33203677|33203789 hsa-miR-1277-5p 0 0 1
chr11:88356035|88356156 hsa-miR-1277-5p 0 0 1
chr2:177231090|177231223 hsa-miR-1277-5p 0 0 1
chr11:1470280|1470363 hsa-miR-1277-5p 0 0 1
chr12:3282587|3282787 hsa-miR-1277-5p 0 0 1
chr5:179343780|179343976 hsa-miR-1277-5p 0 0 1
chr4:99062420|99062600 hsa-miR-1277-5p 0 0 1
chr3:129315125|129315296 hsa-miR-1277-5p 0 0 1
chr1:168696023|168696156 hsa-miR-1277-5p 0 0 1
chr2:27085995|27086100 hsa-miR-1277-5p 0 0 1
chr6:33203620|33203756 hsa-miR-1277-5p 0 0 1
chr14:61278989|61279117 hsa-miR-1277-5p 0 0 1
chr19:10310372|10310568 hsa-miR-1277-5p 0 0 1
chrX:3026465|3027342 hsa-miR-1277-5p 0 0 1
chr1:1051280|1051503 hsa-miR-1277-5p 0 0 1
chr20:47976946|47977127 hsa-miR-1277-5p 0 0 1
chr6:33203677|33203860 hsa-miR-1277-5p 0 0 1
chr20:62313366|62313745 hsa-miR-1277-5p 0 0 1
chr12:12975370|12987180 hsa-miR-1277-5p 0 0 1
chr3:50185676|50185967 hsa-miR-1277-5p 0 0 1
chr7:4996680|4996835 hsa-miR-1277-5p 0 0 1
chr10:56359687|56359830 hsa-miR-1277-5p 0 0 1
chr12:26377073|26377183 hsa-miR-1277-5p 0 0 1
chr2:231456646|231457020 hsa-miR-1277-5p 0 0 1
chrX:80673752|80673964 hsa-miR-1277-5p 0 0 1
chr3:129315116|129315272 hsa-miR-1277-5p 0 0 1
chr2:238847692|238847819 hsa-miR-1277-5p 0 0 1
chr5:181059989|181060138 hsa-miR-1277-5p 0 0 1
chr11:9203903|9204032 hsa-miR-1277-5p 0 0 1
chr13:45518979|45519094 hsa-miR-1277-5p 0 0 1
chr14:67761378|67761473 hsa-miR-1277-5p 0 0 1
chr1:150574700|150574895 hsa-miR-1277-5p 0 0 1
chr1:156699958|156700047 hsa-miR-1277-5p 0 0 1
chr3:128069939|128070118 hsa-miR-1277-5p 0 0 1
chr10:130342813|130343020 hsa-miR-1277-5p 0 0 1
chr16:15037002|15037139 hsa-miR-1277-5p 0 0 1
chr22:50283878|50284177 hsa-miR-1277-5p 0 0 1
chr18:48860691|48860856 hsa-miR-1277-5p 0 0 1
chr10:5768295|5768354 hsa-miR-1277-5p 0 0 1
chr8:38413553|38413792 hsa-miR-1277-5p 0 0 1
chr2:23958301|23984831 hsa-miR-1277-5p 0 0 1
chr3:52435583|52435770 hsa-miR-1277-5p 0 0 1
chr6:99401052|99401194 hsa-miR-1277-5p 0 0 1
chr11:76796848|76796981 hsa-miR-1277-5p 0 0 1
chr4:140640331|140640461 hsa-miR-1277-5p 0 0 1
chr7:30598796|30598897 hsa-miR-1277-5p 0 0 1
chr7:158931689|158931825 hsa-miR-1277-5p 0 0 1
chr17:80210696|80211009 hsa-miR-1277-5p 0 0 1
chr5:81239196|81239338 hsa-miR-1277-5p 0 0 1
chr14:103732699|103733030 hsa-miR-1277-5p 0 0 1
chrX:48707680|48707803 hsa-miR-1277-5p 0 0 1
chr10:100987978|100988229 hsa-miR-1277-5p 0 0 1
chr11:1470280|1470426 hsa-miR-1277-5p 0 0 1
chrX:154349362|154349565 hsa-miR-1277-5p 0 0 1
chr12:6938603|6938786 hsa-miR-1277-5p 0 0 1
chr15:43524310|43524421 hsa-miR-1277-5p 0 0 1
chr6:33203588|33203792 hsa-miR-1277-5p 0 0 1
chr15:63638450|63638776 hsa-miR-1277-5p 0 0 1
chr17:72648922|72649228 hsa-miR-1277-5p 0 0 1
chr1:25900191|25900449 hsa-miR-1277-5p 0 0 1
chr8:23571862|23572025 hsa-miR-1277-5p 0 0 1
chr8:133238213|133238382 hsa-miR-1277-5p 0 0 1
chr3:127706533|127706683 hsa-miR-1277-5p 0 0 1
chr17:80467602|80467801 hsa-miR-1277-5p 0 0 1
chr11:67440147|67440359 hsa-miR-1277-5p 0 0 1
chr1:150574694|150574895 hsa-miR-1277-5p 0 0 1
chr19:4446538|4446714 hsa-miR-1277-5p 0 0 1
chr1:31525297|31525514 hsa-miR-1277-5p 0 0 1
chr1:205715522|205715598 hsa-miR-1277-5p 0 0 1
chr16:15036896|15037092 hsa-miR-1277-5p 0 0 1
chr6:156973271|156973343 hsa-miR-1277-5p 0 0 1
chr2:223019700|223019827 hsa-miR-1277-5p 0 0 1
chrX:154348969|154349440 hsa-miR-1277-5p 0 0 1
chr11:67291379|67291705 hsa-miR-1277-5p 0 0 1
chr12:120469514|120469670 hsa-miR-1277-5p 0 0 1
chr17:64502926|64503022 hsa-miR-1277-5p 0 0 1
chr11:9426167|9426343 hsa-miR-1277-5p 0 0 1
chr15:22945819|22946045 hsa-miR-1277-5p 0 0 1
chr19:21399754|21399905 hsa-miR-1277-5p 0 0 1
chr10:132660761|132660883 hsa-miR-1277-5p 0 0 1
chr12:56311242|56311387 hsa-miR-1277-5p 0 0 1
chr1:35852472|35852645 hsa-miR-1277-5p 0 0 1
chr1:44636099|44636331 hsa-miR-1277-5p 0 0 1
chr3:49809124|49809203 hsa-miR-1277-5p 0 0 1
chr16:48275568|48275657 hsa-miR-1277-5p 0 0 1
chr16:1651841|1651989 hsa-miR-1277-5p 0 0 1
chr16:2757781|2757893 hsa-miR-1277-5p 0 0 1
chr17:63404693|63404822 hsa-miR-1277-5p 0 0 1
chr5:1253507|1253766 hsa-miR-1277-5p 0 0 1
chr10:99527152|99527275 hsa-miR-1277-5p 0 0 1
chr21:44311308|44311489 hsa-miR-1277-5p 0 0 1
chr9:99973670|99973873 hsa-miR-1277-5p 0 0 1
chr8:102960540|102960659 hsa-miR-1277-5p 0 0 1
chr12:11650095|11650234 hsa-miR-1277-5p 0 0 1
chr4:118278794|118279015 hsa-miR-1277-5p 0 0 1
chr11:511407|511561 hsa-miR-1277-5p 0 0 1
chr17:42571619|42571789 hsa-miR-1277-5p 0 0 1
chr6:89554096|89554231 hsa-miR-1277-5p 0 0 1
chr9:87730993|87731132 hsa-miR-1277-5p 0 0 1
chr16:58432|58519 hsa-miR-1277-5p 0 0 1
chr16:1984944|1985149 hsa-miR-1277-5p 0 0 1
chr19:10310372|10310543 hsa-miR-1277-5p 0 0 1
chr1:155197518|155197901 hsa-miR-1277-5p 0 0 1
chr12:89349216|89349412 hsa-miR-1277-5p 0 0 1
chr1:101240651|101240747 hsa-miR-1277-5p 0 0 1
chr11:66495394|66495727 hsa-miR-1277-5p 0 0 1
chr4:20589644|20595722 hsa-miR-1277-5p 0 0 1
chr6:33203588|33203804 hsa-miR-1277-5p 0 0 1
chr1:44636151|44636250 hsa-miR-1277-5p 0 0 1
chr2:85716663|85716793 hsa-miR-1277-5p 0 0 1
chr5:141181459|141181593 hsa-miR-1277-5p 0 0 1
chr6:4954340|4954528 hsa-miR-1277-5p 0 0 1
chr16:1651660|1651968 hsa-miR-1277-5p 0 0 1
chr3:50185676|50185978 hsa-miR-1277-5p 0 0 1
chr1:168695963|168696180 hsa-miR-1277-5p 0 0 1
chrX:41346603|41346979 hsa-miR-1277-5p 0 0 1
chr17:42571549|42571698 hsa-miR-1277-5p 0 0 1
chr19:50310221|50310363 hsa-miR-1277-5p 0 0 1
chr6:33203614|33203777 hsa-miR-1277-5p 0 0 1
chr15:81588335|81588500 hsa-miR-1277-5p 0 0 1
chr19:44818744|44818862 hsa-miR-1277-5p 0 0 1
chrX:15639562|15639756 hsa-miR-1277-5p 0 0 1
chr3:49022153|49022388 hsa-miR-1277-5p 0 0 1
chr4:7778262|7778479 hsa-miR-1277-5p 0 0 1
chr4:154570612|154570758 hsa-miR-1277-5p 0 0 1
chr10:49525809|49525926 hsa-miR-1277-5p 0 0 1
chr1:111351386|111351458 hsa-miR-1277-5p 0 0 1
chr1:155205172|155205302 hsa-miR-1277-5p 0 0 1
chr9:35757619|35757730 hsa-miR-1277-5p 0 0 1
chr3:185508323|185508443 hsa-miR-1277-5p 0 0 1
chr4:75529974|75530099 hsa-miR-1277-5p 0 0 1
chr1:37560588|37560745 hsa-miR-1277-5p 0 0 1
chr19:18169546|18169658 hsa-miR-1277-5p 0 0 1
chr2:230225880|230237173 hsa-miR-1277-5p 0 0 1
chr11:66871346|66871480 hsa-miR-1277-5p 0 0 1
chr1:46196779|46197002 hsa-miR-1277-5p 0 0 1
chr1:62210210|62210355 hsa-miR-1277-5p 0 0 1
chr1:155197518|155197622 hsa-miR-1277-5p 0 0 1
chr16:31141808|31141919 hsa-miR-1277-5p 0 0 1
chr7:6163595|6163725 hsa-miR-1277-5p 0 0 1
chr11:1470280|1470388 hsa-miR-1277-5p 0 0 1
chr11:59181891|59182093 hsa-miR-1277-5p 0 0 1
chr2:241853129|241853239 hsa-miR-1277-5p 0 0 1
chr19:50310213|50310371 hsa-miR-1277-5p 0 0 1
chr19:39413015|39413378 hsa-miR-1277-5p 0 0 1
chr1:155853276|155853806 hsa-miR-1277-5p 0 0 1
chr2:197007806|197009031 hsa-miR-1277-5p 0 0 1
chr2:241601896|241603079 hsa-miR-1277-5p 0 0 1
chr2:23958301|23977075 hsa-miR-1277-5p 0 0 1
chr10:1080011|1080476 hsa-miR-1277-5p 0 0 1
chr14:73147795|73148106 hsa-miR-1277-5p 0 0 1
chr18:58165788|58252054 hsa-miR-1277-5p 0 0 1
chr1:150574694|150574889 hsa-miR-1277-5p 0 0 1
chr4:7778355|7778506 hsa-miR-1277-5p 0 0 1
chr1:205715462|205715598 hsa-miR-1277-5p 0 0 1
chrX:66033539|66033696 hsa-miR-1277-5p 0 0 1
chr15:99132692|99132860 hsa-miR-1277-5p 0 0 1
chr19:47320552|47320707 hsa-miR-1277-5p 0 0 1
chr3:129315125|129315272 hsa-miR-1277-5p 0 0 1
chr9:128822326|128822453 hsa-miR-1277-5p 0 0 1
chr12:56311262|56311357 hsa-miR-1277-5p 0 0 1
chr15:72250146|72250300 hsa-miR-1277-5p 0 0 1
chr1:45567316|45567503 hsa-miR-1277-5p 0 0 1
chr16:30479091|30479461 hsa-miR-1277-5p 0 0 1
chr2:160099881|160100037 hsa-miR-1277-5p 0 0 1
chr21:39921315|39921531 hsa-miR-1277-5p 0 0 1
chr1:182586215|182586364 hsa-miR-1277-5p 0 0 1
chr3:195774120|195774235 hsa-miR-1277-5p 0 0 1
chr1:150574694|150574892 hsa-miR-1277-5p 0 0 1
chr9:37438319|37438460 hsa-miR-1277-5p 0 0 1
chr16:70372689|70372861 hsa-miR-1277-5p 0 0 1
chr1:156199888|156200063 hsa-miR-1277-5p 0 0 1
chr1:168695938|168696180 hsa-miR-1277-5p 0 0 1
chr17:1646255|1646524 hsa-miR-1277-5p 0 0 1
chr20:17616732|17616830 hsa-miR-1277-5p 0 0 1
chr22:39228122|39228291 hsa-miR-1277-5p 0 0 1
chr12:56101826|56101970 hsa-miR-1277-5p 0 0 1
chr3:49022066|49022388 hsa-miR-1277-5p 0 0 1
chr19:1622138|1622350 hsa-miR-1277-5p 0 0 1
chr19:18444038|18444273 hsa-miR-1277-5p 0 0 1
chr12:89349080|89349305 hsa-miR-1277-5p 0 0 1
chr16:74451944|74452054 hsa-miR-1277-5p 0 0 1
chr2:20240318|20240486 hsa-miR-1277-5p 0 0 1
chr6:33203611|33203777 hsa-miR-1277-5p 0 0 1
chr19:6441323|6441548 hsa-miR-1277-5p 0 0 1
chr1:35188002|35188080 hsa-miR-1277-5p 0 0 1
chr12:57796183|57796349 hsa-miR-1277-5p 0 0 1
chr17:42571592|42571698 hsa-miR-1277-5p 0 0 1
chr5:80079099|80079241 hsa-miR-1277-5p 0 0 1
chr15:68208164|68208269 hsa-miR-1277-5p 0 0 1
chr2:218403020|218403218 hsa-miR-1277-5p 0 0 1
chr1:111351267|111351458 hsa-miR-1277-5p 0 0 1
chr20:63929391|63929497 hsa-miR-1277-5p 0 0 1
chr20:34438531|34438631 hsa-miR-1277-5p 0 0 1
chr17:81665340|81665502 hsa-miR-1277-5p 0 0 1
chr20:41421886|41422066 hsa-miR-1277-5p 0 0 1
chr19:18169377|18169577 hsa-miR-1277-5p 0 0 1
chr20:63929340|63929494 hsa-miR-1277-5p 0 0 1
chr2:127846766|127846933 hsa-miR-1277-5p 0 0 1
chr20:62799568|62799656 hsa-miR-1277-5p 0 0 1
chr11:6401374|6401690 hsa-miR-1277-5p 0 0 1
chr3:182820273|182820338 hsa-miR-1277-5p 0 0 1
chr3:195808561|195808677 hsa-miR-1277-5p 0 0 1
chr7:75986189|75986426 hsa-miR-1277-5p 0 0 1
chr16:15037050|15037225 hsa-miR-1277-5p 0 0 1
chr8:23256479|23256593 hsa-miR-1277-5p 0 0 1
chr19:36014821|36014975 hsa-miR-1277-5p 0 0 1
chr1:153658805|153659184 hsa-miR-1277-5p 0 0 1
chr17:4144589|4144692 hsa-miR-1277-5p 0 0 1
chr11:71928011|71928132 hsa-miR-1277-5p 0 0 1
chr17:42571549|42571712 hsa-miR-1277-5p 0 0 1
chr14:21394299|21394468 hsa-miR-1277-5p 0 0 1
chr14:104886275|104886400 hsa-miR-1277-5p 0 0 1
chr22:44813483|44813658 hsa-miR-1277-5p 0 0 1
chr12:89349216|89349334 hsa-miR-1277-5p 0 0 1
chr2:241601844|241601987 hsa-miR-1277-5p 0 0 1
chr17:72723055|72723197 hsa-miR-1277-5p 0 0 1
chr19:50310128|50310353 hsa-miR-1277-5p 0 0 1
chr12:56311223|56311357 hsa-miR-1277-5p 0 0 1
chr15:29718957|29719111 hsa-miR-1277-5p 0 0 1
chr20:63929334|63929494 hsa-miR-1277-5p 0 0 1
chr19:14398103|14401563 hsa-miR-1277-5p 0 0 1
chr13:27622923|27623071 hsa-miR-1277-5p 0 0 1
chr19:8402225|8402590 hsa-miR-1277-5p 0 0 1
chr22:24416121|24416313 hsa-miR-1277-5p 0 0 1
chr1:178458236|178458465 hsa-miR-1277-5p 0 0 1
chr12:89349216|89349337 hsa-miR-1277-5p 0 0 1
chr14:61278987|61279185 hsa-miR-1277-5p 0 0 1
chrX:110675536|110675688 hsa-miR-1277-5p 0 0 1
chr1:59578788|59578929 hsa-miR-1277-5p 0 0 1
chr19:34409201|34409341 hsa-miR-1277-5p 0 0 1
chr14:103732699|103733060 hsa-miR-1277-5p 0 0 1
chr11:248790|249057 hsa-miR-1277-5p 0 0 1
chr19:50310221|50310371 hsa-miR-1277-5p 0 0 1
chr14:103341783|103341897 hsa-miR-1277-5p 0 0 1
chr10:128080343|128080487 hsa-miR-1277-5p 0 0 1
chr12:12906017|12906132 hsa-miR-1277-5p 0 0 1
chr1:182858551|182858810 hsa-miR-1277-5p 0 0 1
chr19:4792693|4792859 hsa-miR-1277-5p 0 0 1
chrX:1386503|1386600 hsa-miR-1277-5p 0 0 1
chr1:109415796|109416023 hsa-miR-1277-5p 0 0 1
chr6:33203614|33203816 hsa-miR-1277-5p 0 0 1
chr18:9517200|9517296 hsa-miR-1277-5p 0 0 1
chr3:126008246|126008408 hsa-miR-1277-5p 0 0 1
chr12:1788046|1788309 hsa-miR-1277-5p 0 0 1
chr16:15037036|15037123 hsa-miR-1277-5p 0 0 1
chr1:46196777|46196993 hsa-miR-1277-5p 0 0 1
chr19:10310372|10310570 hsa-miR-1277-5p 0 0 1
chr9:99973746|99973880 hsa-miR-1277-5p 0 0 1
chr22:17108327|17108458 hsa-miR-1277-5p 0 0 1
chrX:154349362|154349540 hsa-miR-1277-5p 0 0 1
chr7:44061236|44061445 hsa-miR-1277-5p 0 0 1
chr12:121779106|121779276 hsa-miR-1277-5p 0 0 1
chr11:66640946|66641050 hsa-miR-1277-5p 0 0 1
chr12:56137883|56138258 hsa-miR-1277-5p 0 0 1
chrX:147943292|147943546 hsa-miR-1277-5p 0 0 1
chr16:2239774|2239893 hsa-miR-1277-5p 0 0 1
chr17:745014|745132 hsa-miR-1277-5p 0 0 1
chr3:52807775|52807909 hsa-miR-1277-5p 0 0 1
chr3:128069811|128070118 hsa-miR-1277-5p 0 0 1
chr3:52807766|52807909 hsa-miR-1277-5p 0 0 1
chr6:117566854|117567032 hsa-miR-1277-5p 0 0 1
chr19:7973741|7973851 hsa-miR-1277-5p 0 0 1
chrX:1386474|1386600 hsa-miR-1277-5p 0 0 1
chr1:244846877|244847006 hsa-miR-1277-5p 0 0 1
chr6:32127164|32127514 hsa-miR-1277-5p 0 0 1
chr12:71125996|71126200 hsa-miR-1277-5p 0 0 1
chr11:103056152|103056250 hsa-miR-1277-5p 0 0 1
chr5:157760433|157760575 hsa-miR-1277-5p 0 0 1
chr5:80079114|80079241 hsa-miR-1277-5p 0 0 1
chr11:1470280|1470437 hsa-miR-1277-5p 0 0 1
chr6:33203617|33203756 hsa-miR-1277-5p 0 0 1
chr19:50310158|50310371 hsa-miR-1277-5p 0 0 1
chr4:118278775|118278990 hsa-miR-1277-5p 0 0 1
chr17:7461385|7461599 hsa-miR-1277-5p 0 0 1
chr8:86558461|86558592 hsa-miR-1277-5p 0 0 1
chr1:35187230|35188090 hsa-miR-1277-5p 0 0 1
chr14:32157067|32157288 hsa-miR-1277-5p 0 0 1
chr8:144104382|144104522 hsa-miR-1277-5p 0 0 1
chr14:61278985|61279229 hsa-miR-1277-5p 0 0 1
chr3:128069994|128070118 hsa-miR-1277-5p 0 0 1
chr1:150574694|150574885 hsa-miR-1277-5p 0 0 1
chr11:1470280|1470365 hsa-miR-1277-5p 0 0 1
chr19:50310139|50310371 hsa-miR-1277-5p 0 0 1
chr11:76796801|76797068 hsa-miR-1277-5p 0 0 1
chr1:35188002|35188090 hsa-miR-1277-5p 0 0 1
chr14:103341779|103341897 hsa-miR-1277-5p 0 0 1
chrX:1386375|1386555 hsa-miR-1277-5p 0 0 1
chr9:35757572|35757664 hsa-miR-1277-5p 0 0 1
chr19:6441466|6441647 hsa-miR-1277-5p 0 0 1
chr19:4046292|4046421 hsa-miR-1277-5p 0 0 1
chr3:128070041|128070131 hsa-miR-1277-5p 0 0 1
chr7:2525492|2525667 hsa-miR-1277-5p 0 0 1
chr3:155853542|155853677 hsa-miR-1277-5p 0 0 1
chr6:99401052|99401200 hsa-miR-1277-5p 0 0 1
chr7:22484007|22484166 hsa-miR-1277-5p 0 0 1
chr7:4266210|4266319 hsa-miR-1277-5p 0 0 1
chr11:67440147|67440370 hsa-miR-1277-5p 0 0 1
chr10:91863032|91863246 hsa-miR-1277-5p 0 0 1
chr13:113324492|113324739 hsa-miR-1277-5p 0 0 1
chr20:23080654|23080786 hsa-miR-1277-5p 0 0 1
chr1:111351339|111351458 hsa-miR-1277-5p 0 0 1
chr5:181059987|181060138 hsa-miR-1277-5p 0 0 1
chr6:43670862|43671033 hsa-miR-1277-5p 0 0 1
chr6:85609208|85609318 hsa-miR-1277-5p 0 0 1
chr1:1051274|1051494 hsa-miR-1277-5p 0 0 1
chr11:120112302|120112467 hsa-miR-1277-5p 0 0 1
chr7:91263933|91264144 hsa-miR-1277-5p 0 0 1
chr3:128070041|128070169 hsa-miR-1277-5p 0 0 1
chr17:7461362|7461567 hsa-miR-1277-5p 0 0 1
chr14:39177457|39177687 hsa-miR-1277-5p 0 0 1
chr7:130398489|130398719 hsa-miR-1277-5p 0 0 1
chr3:49903008|49903278 hsa-miR-1277-5p 0 0 1
chr2:197503209|197503310 hsa-miR-1277-5p 0 0 1
chr10:5002235|5002366 hsa-miR-1277-5p 0 0 1
chr14:37591380|37591610 hsa-miR-1277-5p 0 0 1
chr2:84423607|84423772 hsa-miR-1277-5p 0 0 1
chr2:43222593|43222820 hsa-miR-1277-5p 0 0 1
chr1:23323579|23323713 hsa-miR-1277-5p 0 0 1
chr9:113162978|113163150 hsa-miR-1277-5p 0 0 1
chr6:99401040|99401161 hsa-miR-1277-5p 0 0 1
chr1:205715462|205715723 hsa-miR-1277-5p 0 0 1
chr12:6938576|6938786 hsa-miR-1277-5p 0 0 1
chr2:43222542|43222658 hsa-miR-1277-5p 0 0 1
chr12:48044637|48044766 hsa-miR-1277-5p 0 0 1
chr2:173212562|173212728 hsa-miR-1277-5p 0 0 1
chr1:168695984|168696173 hsa-miR-1277-5p 0 0 1
chr17:28610536|28610790 hsa-miR-1277-5p 0 0 1
chr8:141188691|141188817 hsa-miR-1277-5p 0 0 1
chr4:77034997|77035176 hsa-miR-1277-5p 0 0 1
chr19:6710990|6711152 hsa-miR-1277-5p 0 0 1
chr2:120348173|120348303 hsa-miR-1277-5p 0 0 1
chr8:141194070|141194179 hsa-miR-1277-5p 0 0 1
chr17:44078500|44078857 hsa-miR-1277-5p 0 0 1
chr16:66934618|66934740 hsa-miR-1277-5p 0 0 1
chr19:49461918|49462020 hsa-miR-1277-5p 0 0 1
chr6:158195814|158196010 hsa-miR-1277-5p 0 0 1
chr8:97276317|97276538 hsa-miR-1277-5p 0 0 1
chr14:21412964|21414372 hsa-miR-1277-5p 0 0 1
chr8:23571871|23572047 hsa-miR-1277-5p 0 0 1
chr19:40374523|40374597 hsa-miR-1277-5p 0 0 1
chr1:1044240|1044439 hsa-miR-1277-5p 0 0 1
chr6:169222300|169222431 hsa-miR-1277-5p 0 0 1
chr19:44818616|44818862 hsa-miR-1277-5p 0 0 1
chr9:113162976|113163217 hsa-miR-1277-5p 0 0 1
chr22:17108327|17108499 hsa-miR-1277-5p 0 0 1
chr20:23080654|23080790 hsa-miR-1277-5p 0 0 1
chr3:50185676|50185958 hsa-miR-1277-5p 0 0 1
chr20:17616738|17616834 hsa-miR-1277-5p 0 0 1
chr3:196499202|196499365 hsa-miR-1277-5p 0 0 1
chr3:44359197|44359364 hsa-miR-1277-5p 0 0 1
chr20:10637885|10637967 hsa-miR-1277-5p 0 0 1
chr2:96286818|96287077 hsa-miR-1277-5p 0 0 1
chr6:33203611|33203816 hsa-miR-1277-5p 0 0 1
chr19:10173090|10173905 hsa-miR-1277-5p 0 0 1
chr17:39993866|39994061 hsa-miR-1277-5p 0 0 1
chr5:62402187|62402389 hsa-miR-1277-5p 0 0 1
chr11:67440147|67440433 hsa-miR-1277-5p 0 0 1
chr12:113321091|113321264 hsa-miR-1277-5p 0 0 1
chr2:218275009|218275244 hsa-miR-1277-5p 0 0 1
chr2:202475362|202475609 hsa-miR-1277-5p 0 1 0
chr12:108645478|108645672 hsa-miR-1277-5p 0 1 0
chr15:99712750|99712936 hsa-miR-1277-5p 0 1 0
chr3:27376615|27376751 hsa-miR-1277-5p 0 1 0
chr5:97166886|97166991 hsa-miR-1277-5p 0 1 0
chr12:29501548|29501665 hsa-miR-1277-5p 0 1 0
chr19:53875281|53875390 hsa-miR-1277-5p 0 1 0
chr17:6644357|6644461 hsa-miR-1277-5p 0 1 0
chr8:22689231|22689399 hsa-miR-1277-5p 0 1 0
chr19:16355492|16355644 hsa-miR-1277-5p 0 1 0
chr14:59368837|59369057 hsa-miR-1277-5p 0 1 0
chr2:152649588|152649725 hsa-miR-1277-5p 0 1 0
chr8:30678329|30678474 hsa-miR-1277-5p 0 1 0
chr13:52693031|52693174 hsa-miR-1277-5p 0 1 0
chr3:160502008|160502099 hsa-miR-1277-5p 0 1 0
chr3:149286746|149286819 hsa-miR-1277-5p 0 1 0
chr3:160502008|160502117 hsa-miR-1277-5p 0 1 0
chr5:150399895|150400083 hsa-miR-1277-5p 0 1 0
chr5:40829641~40829754 hsa-miR-1277-5p 0 1 0
chr1:217591240~217591337 hsa-miR-1277-5p 0 1 0
chr2:188995753~188996458 hsa-miR-1277-5p 0 1 0
chr3:140575786~140575974 hsa-miR-1277-5p 0 1 0
chr12:12476699~12476908 hsa-miR-1277-5p 0 1 0
chr1:154351006~154351195 hsa-miR-1277-5p 0 1 0
chr6:131948399~131948697 hsa-miR-1277-5p 0 1 0
chr6:35027421|35027612 hsa-miR-1277-5p 0 1 0
chr1:155736281|155736405 hsa-miR-1277-5p 0 1 0
chr10:104158890|104159054 hsa-miR-1277-5p 0 1 0
chr3:63998322|63998458 hsa-miR-1277-5p 0 1 0
chr1:156220508|156220744 hsa-miR-1277-5p 0 1 0
chr22:46940255|46940379 hsa-miR-1277-5p 0 1 0
chr7:143385260|143385385 hsa-miR-1277-5p 0 1 0
chr1:154351059|154351195 hsa-miR-1277-5p 0 1 0
chr3:186148948|186149063 hsa-miR-1277-5p 0 1 0
chr14:72970551|72970659 hsa-miR-1277-5p 0 1 0
chr1:207768023|207768208 hsa-miR-1277-5p 0 1 0
chr5:67168969|67169136 hsa-miR-1277-5p 0 1 0
chr19:34354656|34354877 hsa-miR-1277-5p 0 1 0
chr14:35082526|35082648 hsa-miR-1277-5p 0 1 0
chr2:100275714|100276023 hsa-miR-1277-5p 0 1 0
chr15:99712718|99712936 hsa-miR-1277-5p 0 1 0
chrX:74196392|74196508 hsa-miR-1277-5p 0 1 0
chr2:188996150|188996471 hsa-miR-1277-5p 0 1 0
chr2:188996125|188996461 hsa-miR-1277-5p 0 1 0
chr19:53875254|53875390 hsa-miR-1277-5p 0 1 0
chr15:99712723|99712936 hsa-miR-1277-5p 0 1 0
chr5:150400007|150400075 hsa-miR-1277-5p -5 1 0
chr2:26953845|26953944 hsa-miR-1277-5p -7 1 0
chr1:77944241|77944367 hsa-miR-1277-5p -12 1 0
chr1:160214538|160214647 hsa-miR-1277-5p 0 1 0
chr15:99712723|99712934 hsa-miR-1277-5p 0 1 0
chr11:77125611|77125743 hsa-miR-1277-5p 0 1 0
chr7:95295787|95295942 hsa-miR-1277-5p 0 1 0
chr2:188996125|188996463 hsa-miR-1277-5p 0 1 0
chr12:120764226|120764355 hsa-miR-1277-5p 0 1 0
chr2:189578090|189578221 hsa-miR-1277-5p 0 1 0
chr5:124637609|124637790 hsa-miR-1277-5p 0 1 0
chr16:77200156|77200326 hsa-miR-1277-5p 0 1 0
chr18:32130028|32130185 hsa-miR-1277-5p 0 1 0
chr17:28723893|28724017 hsa-miR-1277-5p 0 1 0
chr11:57700365|57700506 hsa-miR-1277-5p 0 1 0
chr16:522196|522347 hsa-miR-1277-5p 0 1 0
chr14:35082497|35082650 hsa-miR-1277-5p 0 1 0
chr1:58781424|58781597 hsa-miR-1277-5p 0 1 0
chr5:154814346|154814577 hsa-miR-1277-5p 0 1 0
chr16:522230|522340 hsa-miR-1277-5p 0 1 0
chr9:123103940|123104064 hsa-miR-1277-5p 0 1 0
chr11:62516586|62516809 hsa-miR-1277-5p 0 1 0
chr19:53875286|53875530 hsa-miR-1277-5p 0 1 0
chr8:30678329|30678446 hsa-miR-1277-5p 0 1 0
chr20:2690668|2690751 hsa-miR-1277-5p 0 1 0
chr5:76834014|76834265 hsa-miR-1277-5p 0 1 0
chr5:150400007|150400212 hsa-miR-1277-5p 0 1 0
chr7:55189063|55189200 hsa-miR-1277-5p 0 1 0
Target genes
miRNA Gene Gene Description HGNC ID details
hsa-miR-1277-5p SOX5 SRY-box transcription factor 5 HGNC:11201 details
hsa-miR-1277-5p AKR1D1 aldo-keto reductase family 1 member D1 HGNC:388 details
hsa-miR-1277-5p COCH cochlin HGNC:2180 details
hsa-miR-1277-5p MAPK8 mitogen-activated protein kinase 8 HGNC:6881 details
hsa-miR-1277-5p BACE2 beta-secretase 2 HGNC:934 details
hsa-miR-1277-5p TRPV2 transient receptor potential cation channel subfamily V member 2 HGNC:18082 details
hsa-miR-1277-5p TNKS tankyrase HGNC:11941 details
hsa-miR-1277-5p CSRP1 cysteine and glycine rich protein 1 HGNC:2469 details
hsa-miR-1277-5p HMX3 H6 family homeobox 3 HGNC:5019 details
hsa-miR-1277-5p LIN28B lin-28 homolog B HGNC:32207 details
hsa-miR-1277-5p ANP32B acidic nuclear phosphoprotein 32 family member B HGNC:16677 details
hsa-miR-1277-5p ECE1 endothelin converting enzyme 1 HGNC:3146 details
hsa-miR-1277-5p TMEM251 transmembrane protein 251 HGNC:20218 details
hsa-miR-1277-5p POLR1B RNA polymerase I subunit B HGNC:20454 details
hsa-miR-1277-5p TRPS1 transcriptional repressor GATA binding 1 HGNC:12340 details
hsa-miR-1277-5p KLHL23 kelch like family member 23 HGNC:27506 details
hsa-miR-1277-5p TBX18 T-box transcription factor 18 HGNC:11595 details
hsa-miR-1277-5p GM2A GM2 ganglioside activator HGNC:4367 details
hsa-miR-1277-5p ATAD5 ATPase family AAA domain containing 5 HGNC:25752 details
hsa-miR-1277-5p UBXN2A UBX domain protein 2A HGNC:27265 details
hsa-miR-1277-5p ZSCAN21 zinc finger and SCAN domain containing 21 HGNC:13104 details
hsa-miR-1277-5p FER FER tyrosine kinase HGNC:3655 details
hsa-miR-1277-5p DGKH diacylglycerol kinase eta HGNC:2854 details
hsa-miR-1277-5p ERI1 exoribonuclease 1 HGNC:23994 details
hsa-miR-1277-5p FOXN2 forkhead box N2 HGNC:5281 details
hsa-miR-1277-5p CADM2 cell adhesion molecule 2 HGNC:29849 details
hsa-miR-1277-5p SLC16A6 solute carrier family 16 member 6 HGNC:10927 details
hsa-miR-1277-5p GUF1 GTP binding elongation factor GUF1 HGNC:25799 details
hsa-miR-1277-5p POLI DNA polymerase iota HGNC:9182 details
hsa-miR-1277-5p NDUFB6 NADH:ubiquinone oxidoreductase subunit B6 HGNC:7701 details
hsa-miR-1277-5p details
hsa-miR-1277-5p CCL16 C-C motif chemokine ligand 16 HGNC:10614 details
hsa-miR-1277-5p WEE1 WEE1 G2 checkpoint kinase HGNC:12761 details
hsa-miR-1277-5p TBL1XR1 TBL1X receptor 1 HGNC:29529 details
hsa-miR-1277-5p TAF13 TATA-box binding protein associated factor 13 HGNC:11546 details
hsa-miR-1277-5p SNTB1 syntrophin beta 1 HGNC:11168 details
hsa-miR-1277-5p SLC38A1 solute carrier family 38 member 1 HGNC:13447 details
hsa-miR-1277-5p PTPRJ protein tyrosine phosphatase receptor type J HGNC:9673 details
hsa-miR-1277-5p PTP4A1 protein tyrosine phosphatase 4A1 HGNC:9634 details
hsa-miR-1277-5p NUS1 NUS1 dehydrodolichyl diphosphate synthase subunit HGNC:21042 details
hsa-miR-1277-5p NPEPPS aminopeptidase puromycin sensitive HGNC:7900 details
hsa-miR-1277-5p MSANTD3 Myb/SANT DNA binding domain containing 3 HGNC:23370 details
hsa-miR-1277-5p JMY junction mediating and regulatory protein, p53 cofactor HGNC:28916 details
hsa-miR-1277-5p INSIG2 insulin induced gene 2 HGNC:20452 details
hsa-miR-1277-5p ELL2 elongation factor for RNA polymerase II 2 HGNC:17064 details
hsa-miR-1277-5p BTF3L4 basic transcription factor 3 like 4 HGNC:30547 details
hsa-miR-1277-5p BBX BBX high mobility group box domain containing HGNC:14422 details
hsa-miR-1277-5p ARL5B ADP ribosylation factor like GTPase 5B HGNC:23052 details
hsa-miR-1277-5p SLC30A1 solute carrier family 30 member 1 HGNC:11012 details
hsa-miR-1277-5p GCK glucokinase HGNC:4195 details
hsa-miR-1277-5p DOCK9 dedicator of cytokinesis 9 HGNC:14132 details
hsa-miR-1277-5p DTX3L deltex E3 ubiquitin ligase 3L HGNC:30323 details
hsa-miR-1277-5p SNRPB2 small nuclear ribonucleoprotein polypeptide B2 HGNC:11155 details
hsa-miR-1277-5p KCNK1 potassium two pore domain channel subfamily K member 1 HGNC:6272 details
hsa-miR-1277-5p SMARCAD1 SWI/SNF-related, matrix-associated actin-dependent regulator of chromatin, subfamily a, containing DEAD/H box 1 HGNC:18398 details
hsa-miR-1277-5p PSMD7 proteasome 26S subunit, non-ATPase 7 HGNC:9565 details
hsa-miR-1277-5p PLEKHF2 pleckstrin homology and FYVE domain containing 2 HGNC:20757 details
hsa-miR-1277-5p KCNJ6 potassium inwardly rectifying channel subfamily J member 6 HGNC:6267 details
hsa-miR-1277-5p XRCC3 X-ray repair cross complementing 3 HGNC:12830 details
hsa-miR-1277-5p TET2 tet methylcytosine dioxygenase 2 HGNC:25941 details
hsa-miR-1277-5p ASB11 ankyrin repeat and SOCS box containing 11 HGNC:17186 details
hsa-miR-1277-5p details
hsa-miR-1277-5p USP51 ubiquitin specific peptidase 51 HGNC:23086 details
hsa-miR-1277-5p BTBD19 BTB domain containing 19 HGNC:27145 details
hsa-miR-1277-5p CTLA4 cytotoxic T-lymphocyte associated protein 4 HGNC:2505 details
hsa-miR-1277-5p GPATCH11 G-patch domain containing 11 HGNC:26768 details
hsa-miR-1277-5p CARF calcium responsive transcription factor HGNC:14435 details
hsa-miR-1277-5p NCAM2 neural cell adhesion molecule 2 HGNC:7657 details
hsa-miR-1277-5p CSMD1 CUB and Sushi multiple domains 1 HGNC:14026 details
hsa-miR-1277-5p ELF2 E74 like ETS transcription factor 2 HGNC:3317 details
hsa-miR-1277-5p ABHD18 abhydrolase domain containing 18 HGNC:26111 details
hsa-miR-1277-5p CEP104 centrosomal protein 104 HGNC:24866 details
hsa-miR-1277-5p RAB3B RAB3B, member RAS oncogene family HGNC:9778 details
hsa-miR-1277-5p CALHM5 calcium homeostasis modulator family member 5 HGNC:21568 details
hsa-miR-1277-5p ADAMTS4 ADAM metallopeptidase with thrombospondin type 1 motif 4 HGNC:220 details
hsa-miR-1277-5p ZNF318 zinc finger protein 318 HGNC:13578 details
hsa-miR-1277-5p COPS8 COP9 signalosome subunit 8 HGNC:24335 details
hsa-miR-1277-5p VCAM1 vascular cell adhesion molecule 1 HGNC:12663 details
hsa-miR-1277-5p SLC24A2 solute carrier family 24 member 2 HGNC:10976 details
hsa-miR-1277-5p MIPOL1 mirror-image polydactyly 1 HGNC:21460 details
hsa-miR-1277-5p BVES blood vessel epicardial substance HGNC:1152 details
hsa-miR-1277-5p UGT2B4 UDP glucuronosyltransferase family 2 member B4 HGNC:12553 details
hsa-miR-1277-5p ADH1B alcohol dehydrogenase 1B (class I), beta polypeptide HGNC:250 details
hsa-miR-1277-5p MMADHC metabolism of cobalamin associated D HGNC:25221 details
hsa-miR-1277-5p CYGB cytoglobin HGNC:16505 details
hsa-miR-1277-5p PLEKHA6 pleckstrin homology domain containing A6 HGNC:17053 details
hsa-miR-1277-5p DGKG diacylglycerol kinase gamma HGNC:2853 details
hsa-miR-1277-5p GSK3B glycogen synthase kinase 3 beta HGNC:4617 details
hsa-miR-1277-5p CLEC2D C-type lectin domain family 2 member D HGNC:14351 details
hsa-miR-1277-5p HOXD10 homeobox D10 HGNC:5133 details
hsa-miR-1277-5p VAMP4 vesicle associated membrane protein 4 HGNC:12645 details
hsa-miR-1277-5p IMPG2 interphotoreceptor matrix proteoglycan 2 HGNC:18362 details
hsa-miR-1277-5p CA12 carbonic anhydrase 12 HGNC:1371 details
hsa-miR-1277-5p ZBED3 zinc finger BED-type containing 3 HGNC:20711 details
hsa-miR-1277-5p WDR76 WD repeat domain 76 HGNC:25773 details
hsa-miR-1277-5p USP6NL USP6 N-terminal like HGNC:16858 details
hsa-miR-1277-5p RPS27A ribosomal protein S27a HGNC:10417 details
hsa-miR-1277-5p TBPL1 TATA-box binding protein like 1 HGNC:11589 details
hsa-miR-1277-5p SPATA2 spermatogenesis associated 2 HGNC:14681 details
hsa-miR-1277-5p SNX16 sorting nexin 16 HGNC:14980 details
hsa-miR-1277-5p SENP1 SUMO specific peptidase 1 HGNC:17927 details
hsa-miR-1277-5p SEC23IP SEC23 interacting protein HGNC:17018 details
hsa-miR-1277-5p PUM1 pumilio RNA binding family member 1 HGNC:14957 details
hsa-miR-1277-5p PPP4R2 protein phosphatase 4 regulatory subunit 2 HGNC:18296 details
hsa-miR-1277-5p PLEKHA3 pleckstrin homology domain containing A3 HGNC:14338 details
hsa-miR-1277-5p PIK3R1 phosphoinositide-3-kinase regulatory subunit 1 HGNC:8979 details
hsa-miR-1277-5p PCMTD1 protein-L-isoaspartate (D-aspartate) O-methyltransferase domain containing 1 HGNC:30483 details
hsa-miR-1277-5p NUFIP2 nuclear FMR1 interacting protein 2 HGNC:17634 details
hsa-miR-1277-5p NRF1 nuclear respiratory factor 1 HGNC:7996 details
hsa-miR-1277-5p NAA25 N-alpha-acetyltransferase 25, NatB auxiliary subunit HGNC:25783 details
hsa-miR-1277-5p MON1B MON1 homolog B, secretory trafficking associated HGNC:25020 details
hsa-miR-1277-5p details
hsa-miR-1277-5p LPAR3 lysophosphatidic acid receptor 3 HGNC:14298 details
hsa-miR-1277-5p LMTK2 lemur tyrosine kinase 2 HGNC:17880 details
hsa-miR-1277-5p KCNJ3 potassium inwardly rectifying channel subfamily J member 3 HGNC:6264 details
hsa-miR-1277-5p HIC2 HIC ZBTB transcriptional repressor 2 HGNC:18595 details
hsa-miR-1277-5p G3BP2 G3BP stress granule assembly factor 2 HGNC:30291 details
hsa-miR-1277-5p EMC7 ER membrane protein complex subunit 7 HGNC:24301 details
hsa-miR-1277-5p E2F8 E2F transcription factor 8 HGNC:24727 details
hsa-miR-1277-5p CSRNP3 cysteine and serine rich nuclear protein 3 HGNC:30729 details
hsa-miR-1277-5p CREBZF CREB/ATF bZIP transcription factor HGNC:24905 details
hsa-miR-1277-5p CD55 CD55 molecule (Cromer blood group) HGNC:2665 details
hsa-miR-1277-5p BTG3 BTG anti-proliferation factor 3 HGNC:1132 details
hsa-miR-1277-5p BACH2 BTB domain and CNC homolog 2 HGNC:14078 details
hsa-miR-1277-5p AMER1 APC membrane recruitment protein 1 HGNC:26837 details
hsa-miR-1277-5p PTP4A2 protein tyrosine phosphatase 4A2 HGNC:9635 details
hsa-miR-1277-5p CD226 CD226 molecule HGNC:16961 details
hsa-miR-1277-5p ADCYAP1 adenylate cyclase activating polypeptide 1 HGNC:241 details
hsa-miR-1277-5p CCDC38 coiled-coil domain containing 38 HGNC:26843 details
hsa-miR-1277-5p ITPRIPL1 ITPRIP like 1 HGNC:29371 details
hsa-miR-1277-5p MYBL1 MYB proto-oncogene like 1 HGNC:7547 details
hsa-miR-1277-5p ZNF608 zinc finger protein 608 HGNC:29238 details
hsa-miR-1277-5p SHOX2 short stature homeobox 2 HGNC:10854 details
hsa-miR-1277-5p RPP14 ribonuclease P/MRP subunit p14 HGNC:30327 details
hsa-miR-1277-5p ZNF516 zinc finger protein 516 HGNC:28990 details
hsa-miR-1277-5p CREB1 cAMP responsive element binding protein 1 HGNC:2345 details
hsa-miR-1277-5p HOXC4 homeobox C4 HGNC:5126 details
hsa-miR-1277-5p EIF2B1 eukaryotic translation initiation factor 2B subunit alpha HGNC:3257 details
hsa-miR-1277-5p RPL23A ribosomal protein L23a HGNC:10317 details
hsa-miR-1277-5p TBX20 T-box transcription factor 20 HGNC:11598 details
hsa-miR-1277-5p ENTHD1 ENTH domain containing 1 HGNC:26352 details
hsa-miR-1277-5p NRIP1 nuclear receptor interacting protein 1 HGNC:8001 details
hsa-miR-1277-5p ETV6 ETS variant transcription factor 6 HGNC:3495 details
hsa-miR-1277-5p CDKL1 cyclin dependent kinase like 1 HGNC:1781 details
hsa-miR-1277-5p NTRK3 neurotrophic receptor tyrosine kinase 3 HGNC:8033 details
hsa-miR-1277-5p TMCO1 transmembrane and coiled-coil domains 1 HGNC:18188 details
hsa-miR-1277-5p MLLT3 MLLT3 super elongation complex subunit HGNC:7136 details
hsa-miR-1277-5p DCLRE1C DNA cross-link repair 1C HGNC:17642 details
hsa-miR-1277-5p TNFRSF9 TNF receptor superfamily member 9 HGNC:11924 details
hsa-miR-1277-5p CUL2 cullin 2 HGNC:2552 details
hsa-miR-1277-5p details
hsa-miR-1277-5p AKAP2 A-kinase anchoring protein 2 HGNC:372 details
hsa-miR-1277-5p RABGAP1 RAB GTPase activating protein 1 HGNC:17155 details
hsa-miR-1277-5p SLC25A27 solute carrier family 25 member 27 HGNC:21065 details
hsa-miR-1277-5p EFHC1 EF-hand domain containing 1 HGNC:16406 details
hsa-miR-1277-5p HS2ST1 heparan sulfate 2-O-sulfotransferase 1 HGNC:5193 details
hsa-miR-1277-5p TSPAN2 tetraspanin 2 HGNC:20659 details
hsa-miR-1277-5p PYHIN1 pyrin and HIN domain family member 1 HGNC:28894 details
hsa-miR-1277-5p OTX1 orthodenticle homeobox 1 HGNC:8521 details
hsa-miR-1277-5p SUCNR1 succinate receptor 1 HGNC:4542 details
hsa-miR-1277-5p SRP72 signal recognition particle 72 HGNC:11303 details
hsa-miR-1277-5p POU2F2 POU class 2 homeobox 2 HGNC:9213 details
hsa-miR-1277-5p TRIM2 tripartite motif containing 2 HGNC:15974 details
hsa-miR-1277-5p LARP1 La ribonucleoprotein 1, translational regulator HGNC:29531 details
hsa-miR-1277-5p RSBN1L round spermatid basic protein 1 like HGNC:24765 details
hsa-miR-1277-5p SPSB1 splA/ryanodine receptor domain and SOCS box containing 1 HGNC:30628 details
hsa-miR-1277-5p RAPH1 Ras association (RalGDS/AF-6) and pleckstrin homology domains 1 HGNC:14436 details
hsa-miR-1277-5p USF3 upstream transcription factor family member 3 HGNC:30494 details
hsa-miR-1277-5p SULT1B1 sulfotransferase family 1B member 1 HGNC:17845 details
hsa-miR-1277-5p GTPBP2 GTP binding protein 2 HGNC:4670 details
hsa-miR-1277-5p TACR3 tachykinin receptor 3 HGNC:11528 details
hsa-miR-1277-5p CASD1 CAS1 domain containing 1 HGNC:16014 details
hsa-miR-1277-5p F2RL1 F2R like trypsin receptor 1 HGNC:3538 details
hsa-miR-1277-5p details
hsa-miR-1277-5p ITGA1 integrin subunit alpha 1 HGNC:6134 details
hsa-miR-1277-5p KANSL1L KAT8 regulatory NSL complex subunit 1 like HGNC:26310 details
hsa-miR-1277-5p CRIM1 cysteine rich transmembrane BMP regulator 1 HGNC:2359 details
hsa-miR-1277-5p GTF2H1 general transcription factor IIH subunit 1 HGNC:4655 details
hsa-miR-1277-5p ARID3A AT-rich interaction domain 3A HGNC:3031 details
hsa-miR-1277-5p LRP6 LDL receptor related protein 6 HGNC:6698 details
hsa-miR-1277-5p COL8A1 collagen type VIII alpha 1 chain HGNC:2215 details
hsa-miR-1277-5p C2orf49 chromosome 2 open reading frame 49 HGNC:28772 details
hsa-miR-1277-5p STARD8 StAR related lipid transfer domain containing 8 HGNC:19161 details
hsa-miR-1277-5p CYP4F11 cytochrome P450 family 4 subfamily F member 11 HGNC:13265 details
hsa-miR-1277-5p TNFSF9 TNF superfamily member 9 HGNC:11939 details
hsa-miR-1277-5p details
hsa-miR-1277-5p DDX55 DEAD-box helicase 55 HGNC:20085 details
hsa-miR-1277-5p ZXDA zinc finger X-linked duplicated A HGNC:13198 details
hsa-miR-1277-5p ZIC5 Zic family member 5 HGNC:20322 details
hsa-miR-1277-5p ZFHX3 zinc finger homeobox 3 HGNC:777 details
hsa-miR-1277-5p ZDHHC5 zinc finger DHHC-type palmitoyltransferase 5 HGNC:18472 details
hsa-miR-1277-5p YWHAZ tyrosine 3-monooxygenase/tryptophan 5-monooxygenase activation protein zeta HGNC:12855 details
hsa-miR-1277-5p UNG uracil DNA glycosylase HGNC:12572 details
hsa-miR-1277-5p TPPP tubulin polymerization promoting protein HGNC:24164 details
hsa-miR-1277-5p STRN striatin HGNC:11424 details
hsa-miR-1277-5p SPPL2A signal peptide peptidase like 2A HGNC:30227 details
hsa-miR-1277-5p SP1 Sp1 transcription factor HGNC:11205 details
hsa-miR-1277-5p SENP3 SUMO specific peptidase 3 HGNC:17862 details
hsa-miR-1277-5p RTN4RL1 reticulon 4 receptor like 1 HGNC:21329 details
hsa-miR-1277-5p RCAN2 regulator of calcineurin 2 HGNC:3041 details
hsa-miR-1277-5p RAB5B RAB5B, member RAS oncogene family HGNC:9784 details
hsa-miR-1277-5p PURG purine rich element binding protein G HGNC:17930 details
hsa-miR-1277-5p PRRX1 paired related homeobox 1 HGNC:9142 details
hsa-miR-1277-5p PROX1 prospero homeobox 1 HGNC:9459 details
hsa-miR-1277-5p PCBP2 poly(rC) binding protein 2 HGNC:8648 details
hsa-miR-1277-5p PAQR3 progestin and adipoQ receptor family member 3 HGNC:30130 details
hsa-miR-1277-5p details
hsa-miR-1277-5p NPTN neuroplastin HGNC:17867 details
hsa-miR-1277-5p NFIB nuclear factor I B HGNC:7785 details
hsa-miR-1277-5p NDST1 N-deacetylase and N-sulfotransferase 1 HGNC:7680 details
hsa-miR-1277-5p NABP1 nucleic acid binding protein 1 HGNC:26232 details
hsa-miR-1277-5p MBNL3 muscleblind like splicing regulator 3 HGNC:20564 details
hsa-miR-1277-5p MARCKS myristoylated alanine rich protein kinase C substrate HGNC:6759 details
hsa-miR-1277-5p MAP3K12 mitogen-activated protein kinase kinase kinase 12 HGNC:6851 details
hsa-miR-1277-5p details
hsa-miR-1277-5p KPNA4 karyopherin subunit alpha 4 HGNC:6397 details
hsa-miR-1277-5p KIAA1522 KIAA1522 HGNC:29301 details
hsa-miR-1277-5p KHSRP KH-type splicing regulatory protein HGNC:6316 details
hsa-miR-1277-5p ITPRIPL2 ITPRIP like 2 HGNC:27257 details
hsa-miR-1277-5p IL6ST interleukin 6 cytokine family signal transducer HGNC:6021 details
hsa-miR-1277-5p IKZF4 IKAROS family zinc finger 4 HGNC:13179 details
hsa-miR-1277-5p HSPA13 heat shock protein family A (Hsp70) member 13 HGNC:11375 details
hsa-miR-1277-5p HSP90AA1 heat shock protein 90 alpha family class A member 1 HGNC:5253 details
hsa-miR-1277-5p HMGXB4 HMG-box containing 4 HGNC:5003 details
hsa-miR-1277-5p HMGB2 high mobility group box 2 HGNC:5000 details
hsa-miR-1277-5p details
hsa-miR-1277-5p FKBP14 FKBP prolyl isomerase 14 HGNC:18625 details
hsa-miR-1277-5p EVI5 ecotropic viral integration site 5 HGNC:3501 details
hsa-miR-1277-5p DUSP7 dual specificity phosphatase 7 HGNC:3073 details
hsa-miR-1277-5p DTX4 deltex E3 ubiquitin ligase 4 HGNC:29151 details
hsa-miR-1277-5p DDX6 DEAD-box helicase 6 HGNC:2747 details
hsa-miR-1277-5p CFL2 cofilin 2 HGNC:1875 details
hsa-miR-1277-5p BMP2K BMP2 inducible kinase HGNC:18041 details
hsa-miR-1277-5p ARHGEF33 Rho guanine nucleotide exchange factor 33 HGNC:37252 details
hsa-miR-1277-5p ADCY9 adenylate cyclase 9 HGNC:240 details
hsa-miR-1277-5p ABI2 abl interactor 2 HGNC:24011 details
hsa-miR-1277-5p ZNF134 zinc finger protein 134 HGNC:12918 details
hsa-miR-1277-5p TRPM6 transient receptor potential cation channel subfamily M member 6 HGNC:17995 details
hsa-miR-1277-5p MGAT4C MGAT4 family member C HGNC:30871 details
hsa-miR-1277-5p LRRC63 leucine rich repeat containing 63 HGNC:34296 details
hsa-miR-1277-5p EPOR erythropoietin receptor HGNC:3416 details
hsa-miR-1277-5p details
hsa-miR-1277-5p details
hsa-miR-1277-5p CRADD CASP2 and RIPK1 domain containing adaptor with death domain HGNC:2340 details
hsa-miR-1277-5p PHEX phosphate regulating endopeptidase homolog X-linked HGNC:8918 details
hsa-miR-1277-5p ACER3 alkaline ceramidase 3 HGNC:16066 details
hsa-miR-1277-5p TSNARE1 t-SNARE domain containing 1 HGNC:26437 details
hsa-miR-1277-5p GPR141 G protein-coupled receptor 141 HGNC:19997 details
hsa-miR-1277-5p SLC35E3 solute carrier family 35 member E3 HGNC:20864 details
hsa-miR-1277-5p ARHGAP21 Rho GTPase activating protein 21 HGNC:23725 details
hsa-miR-1277-5p WDR72 WD repeat domain 72 HGNC:26790 details
hsa-miR-1277-5p PRKCD protein kinase C delta HGNC:9399 details
hsa-miR-1277-5p CCT4 chaperonin containing TCP1 subunit 4 HGNC:1617 details
hsa-miR-1277-5p KRT222 keratin 222 HGNC:28695 details
hsa-miR-1277-5p WDR17 WD repeat domain 17 HGNC:16661 details
hsa-miR-1277-5p MYBPC1 myosin binding protein C1 HGNC:7549 details
hsa-miR-1277-5p NLGN4X neuroligin 4 X-linked HGNC:14287 details
hsa-miR-1277-5p FOCAD focadhesin HGNC:23377 details
hsa-miR-1277-5p AJAP1 adherens junctions associated protein 1 HGNC:30801 details
hsa-miR-1277-5p NAA40 N-alpha-acetyltransferase 40, NatD catalytic subunit HGNC:25845 details
hsa-miR-1277-5p PLXDC2 plexin domain containing 2 HGNC:21013 details
hsa-miR-1277-5p FAM182B family with sequence similarity 182 member B HGNC:34503 details
hsa-miR-1277-5p TRMO tRNA methyltransferase O HGNC:30967 details
hsa-miR-1277-5p AR androgen receptor HGNC:644 details
hsa-miR-1277-5p RARS2 arginyl-tRNA synthetase 2, mitochondrial HGNC:21406 details
hsa-miR-1277-5p GLRX2 glutaredoxin 2 HGNC:16065 details
hsa-miR-1277-5p ZNF675 zinc finger protein 675 HGNC:30768 details
hsa-miR-1277-5p PIK3CG phosphatidylinositol-4,5-bisphosphate 3-kinase catalytic subunit gamma HGNC:8978 details
hsa-miR-1277-5p POT1 protection of telomeres 1 HGNC:17284 details
hsa-miR-1277-5p SLC35F6 solute carrier family 35 member F6 HGNC:26055 details
hsa-miR-1277-5p ZC3H6 zinc finger CCCH-type containing 6 HGNC:24762 details
hsa-miR-1277-5p ZNF678 zinc finger protein 678 HGNC:28652 details
hsa-miR-1277-5p VHLL VHL like HGNC:30666 details
hsa-miR-1277-5p ZNF347 zinc finger protein 347 HGNC:16447 details
hsa-miR-1277-5p NLRP9 NLR family pyrin domain containing 9 HGNC:22941 details
hsa-miR-1277-5p GRID1 glutamate ionotropic receptor delta type subunit 1 HGNC:4575 details
hsa-miR-1277-5p KCNK12 potassium two pore domain channel subfamily K member 12 HGNC:6274 details
hsa-miR-1277-5p ABCF1 ATP binding cassette subfamily F member 1 HGNC:70 details
hsa-miR-1277-5p VENTX VENT homeobox HGNC:13639 details
hsa-miR-1277-5p C10orf67 chromosome 10 open reading frame 67 HGNC:28716 details
hsa-miR-1277-5p PPIP5K2 diphosphoinositol pentakisphosphate kinase 2 HGNC:29035 details
hsa-miR-1277-5p CHAF1B chromatin assembly factor 1 subunit B HGNC:1911 details
hsa-miR-1277-5p RPS7 ribosomal protein S7 HGNC:10440 details
hsa-miR-1277-5p XKR6 XK related 6 HGNC:27806 details
hsa-miR-1277-5p details
hsa-miR-1277-5p SCIN scinderin HGNC:21695 details
hsa-miR-1277-5p FRRS1 ferric chelate reductase 1 HGNC:27622 details
hsa-miR-1277-5p DEPTOR DEP domain containing MTOR interacting protein HGNC:22953 details
hsa-miR-1277-5p CAPN5 calpain 5 HGNC:1482 details
hsa-miR-1277-5p NONO non-POU domain containing octamer binding HGNC:7871 details
hsa-miR-1277-5p SLC2A12 solute carrier family 2 member 12 HGNC:18067 details
hsa-miR-1277-5p CLVS2 clavesin 2 HGNC:23046 details
hsa-miR-1277-5p TNIP1 TNFAIP3 interacting protein 1 HGNC:16903 details
hsa-miR-1277-5p IFNAR1 interferon alpha and beta receptor subunit 1 HGNC:5432 details
hsa-miR-1277-5p AKAP8 A-kinase anchoring protein 8 HGNC:378 details
hsa-miR-1277-5p L2HGDH L-2-hydroxyglutarate dehydrogenase HGNC:20499 details
hsa-miR-1277-5p AGPS alkylglycerone phosphate synthase HGNC:327 details
hsa-miR-1277-5p PPP1R1A protein phosphatase 1 regulatory inhibitor subunit 1A HGNC:9286 details
hsa-miR-1277-5p CD180 CD180 molecule HGNC:6726 details
hsa-miR-1277-5p STN1 STN1 subunit of CST complex HGNC:26200 details
hsa-miR-1277-5p SEMA3F semaphorin 3F HGNC:10728 details
hsa-miR-1277-5p ZNF609 zinc finger protein 609 HGNC:29003 details
hsa-miR-1277-5p ZNF512B zinc finger protein 512B HGNC:29212 details
hsa-miR-1277-5p ZMYM2 zinc finger MYM-type containing 2 HGNC:12989 details
hsa-miR-1277-5p ZER1 zyg-11 related cell cycle regulator HGNC:30960 details
hsa-miR-1277-5p ZBTB20 zinc finger and BTB domain containing 20 HGNC:13503 details
hsa-miR-1277-5p ZBTB16 zinc finger and BTB domain containing 16 HGNC:12930 details
hsa-miR-1277-5p YAF2 YY1 associated factor 2 HGNC:17363 details
hsa-miR-1277-5p XRN1 5'-3' exoribonuclease 1 HGNC:30654 details
hsa-miR-1277-5p WNT5A Wnt family member 5A HGNC:12784 details
hsa-miR-1277-5p WASL WASP like actin nucleation promoting factor HGNC:12735 details
hsa-miR-1277-5p VEGFA vascular endothelial growth factor A HGNC:12680 details
hsa-miR-1277-5p TRIM23 tripartite motif containing 23 HGNC:660 details
hsa-miR-1277-5p TRIM13 tripartite motif containing 13 HGNC:9976 details
hsa-miR-1277-5p THSD7A thrombospondin type 1 domain containing 7A HGNC:22207 details
hsa-miR-1277-5p SYPL1 synaptophysin like 1 HGNC:11507 details
hsa-miR-1277-5p SYP synaptophysin HGNC:11506 details
hsa-miR-1277-5p SLC30A4 solute carrier family 30 member 4 HGNC:11015 details
hsa-miR-1277-5p SIPA1L3 signal induced proliferation associated 1 like 3 HGNC:23801 details
hsa-miR-1277-5p RUNX1T1 RUNX1 partner transcriptional co-repressor 1 HGNC:1535 details
hsa-miR-1277-5p RC3H1 ring finger and CCCH-type domains 1 HGNC:29434 details
hsa-miR-1277-5p RBBP9 RB binding protein 9, serine hydrolase HGNC:9892 details
hsa-miR-1277-5p PRKD3 protein kinase D3 HGNC:9408 details
hsa-miR-1277-5p PPARGC1A PPARG coactivator 1 alpha HGNC:9237 details
hsa-miR-1277-5p PLRG1 pleiotropic regulator 1 HGNC:9089 details
hsa-miR-1277-5p PITPNC1 phosphatidylinositol transfer protein cytoplasmic 1 HGNC:21045 details
hsa-miR-1277-5p PIAS1 protein inhibitor of activated STAT 1 HGNC:2752 details
hsa-miR-1277-5p PHIP pleckstrin homology domain interacting protein HGNC:15673 details
hsa-miR-1277-5p PHF8 PHD finger protein 8 HGNC:20672 details
hsa-miR-1277-5p PHACTR2 phosphatase and actin regulator 2 HGNC:20956 details
hsa-miR-1277-5p PEX5L peroxisomal biogenesis factor 5 like HGNC:30024 details
hsa-miR-1277-5p PER1 period circadian regulator 1 HGNC:8845 details
hsa-miR-1277-5p PDCD10 programmed cell death 10 HGNC:8761 details
hsa-miR-1277-5p PCGF2 polycomb group ring finger 2 HGNC:12929 details
hsa-miR-1277-5p PAPSS2 3'-phosphoadenosine 5'-phosphosulfate synthase 2 HGNC:8604 details
hsa-miR-1277-5p OCIAD2 OCIA domain containing 2 HGNC:28685 details
hsa-miR-1277-5p NLK nemo like kinase HGNC:29858 details
hsa-miR-1277-5p NFIC nuclear factor I C HGNC:7786 details
hsa-miR-1277-5p MYADM myeloid associated differentiation marker HGNC:7544 details
hsa-miR-1277-5p MMP16 matrix metallopeptidase 16 HGNC:7162 details
hsa-miR-1277-5p MBTD1 mbt domain containing 1 HGNC:19866 details
hsa-miR-1277-5p MAN1A2 mannosidase alpha class 1A member 2 HGNC:6822 details
hsa-miR-1277-5p LRP8 LDL receptor related protein 8 HGNC:6700 details
hsa-miR-1277-5p LDLR low density lipoprotein receptor HGNC:6547 details
hsa-miR-1277-5p KLHL9 kelch like family member 9 HGNC:18732 details
hsa-miR-1277-5p KLF7 Kruppel like factor 7 HGNC:6350 details
hsa-miR-1277-5p NEXMIF neurite extension and migration factor HGNC:29433 details
hsa-miR-1277-5p KCNN3 potassium calcium-activated channel subfamily N member 3 HGNC:6292 details
hsa-miR-1277-5p KAT6A lysine acetyltransferase 6A HGNC:13013 details
hsa-miR-1277-5p IGF1 insulin like growth factor 1 HGNC:5464 details
hsa-miR-1277-5p HOXA11 homeobox A11 HGNC:5101 details
hsa-miR-1277-5p GSR glutathione-disulfide reductase HGNC:4623 details
hsa-miR-1277-5p GRIN2B glutamate ionotropic receptor NMDA type subunit 2B HGNC:4586 details
hsa-miR-1277-5p GRIK3 glutamate ionotropic receptor kainate type subunit 3 HGNC:4581 details
hsa-miR-1277-5p GRAMD1B GRAM domain containing 1B HGNC:29214 details
hsa-miR-1277-5p FZD5 frizzled class receptor 5 HGNC:4043 details
hsa-miR-1277-5p FBXO9 F-box protein 9 HGNC:13588 details
hsa-miR-1277-5p FBXO48 F-box protein 48 HGNC:33857 details
hsa-miR-1277-5p details
hsa-miR-1277-5p EPHA5 EPH receptor A5 HGNC:3389 details
hsa-miR-1277-5p DOCK4 dedicator of cytokinesis 4 HGNC:19192 details
hsa-miR-1277-5p DNAJB14 DnaJ heat shock protein family (Hsp40) member B14 HGNC:25881 details
hsa-miR-1277-5p DDI2 DNA damage inducible 1 homolog 2 HGNC:24578 details
hsa-miR-1277-5p DCUN1D3 defective in cullin neddylation 1 domain containing 3 HGNC:28734 details
hsa-miR-1277-5p CNOT6L CCR4-NOT transcription complex subunit 6 like HGNC:18042 details
hsa-miR-1277-5p CHRM3 cholinergic receptor muscarinic 3 HGNC:1952 details
hsa-miR-1277-5p CDCA4 cell division cycle associated 4 HGNC:14625 details
hsa-miR-1277-5p C1orf50 chromosome 1 open reading frame 50 HGNC:28795 details
hsa-miR-1277-5p BRI3BP BRI3 binding protein HGNC:14251 details
hsa-miR-1277-5p BMP2 bone morphogenetic protein 2 HGNC:1069 details
hsa-miR-1277-5p ARSJ arylsulfatase family member J HGNC:26286 details
hsa-miR-1277-5p APOOL apolipoprotein O like HGNC:24009 details
hsa-miR-1277-5p ANKRD44 ankyrin repeat domain 44 HGNC:25259 details
hsa-miR-1277-5p AMD1 adenosylmethionine decarboxylase 1 HGNC:457 details
hsa-miR-1277-5p ABHD13 abhydrolase domain containing 13 HGNC:20293 details
hsa-miR-1277-5p C19orf12 chromosome 19 open reading frame 12 HGNC:25443 details
hsa-miR-1277-5p ZNF878 zinc finger protein 878 HGNC:37246 details
hsa-miR-1277-5p ABCC4 ATP binding cassette subfamily C member 4 HGNC:55 details
hsa-miR-1277-5p GULP1 GULP PTB domain containing engulfment adaptor 1 HGNC:18649 details
hsa-miR-1277-5p MEAF6 MYST/Esa1 associated factor 6 HGNC:25674 details
hsa-miR-1277-5p CERCAM cerebral endothelial cell adhesion molecule HGNC:23723 details
hsa-miR-1277-5p ACBD7 acyl-CoA binding domain containing 7 HGNC:17715 details
hsa-miR-1277-5p ZFP42 ZFP42 zinc finger protein HGNC:30949 details
hsa-miR-1277-5p SHISA2 shisa family member 2 HGNC:20366 details
hsa-miR-1277-5p ZBED2 zinc finger BED-type containing 2 HGNC:20710 details
hsa-miR-1277-5p TGIF1 TGFB induced factor homeobox 1 HGNC:11776 details
hsa-miR-1277-5p SNTB2 syntrophin beta 2 HGNC:11169 details
hsa-miR-1277-5p SLC7A11 solute carrier family 7 member 11 HGNC:11059 details
hsa-miR-1277-5p SAR1B secretion associated Ras related GTPase 1B HGNC:10535 details
hsa-miR-1277-5p RFX7 regulatory factor X7 HGNC:25777 details
hsa-miR-1277-5p GTF2A1 general transcription factor IIA subunit 1 HGNC:4646 details
hsa-miR-1277-5p FBXO47 F-box protein 47 HGNC:31969 details
hsa-miR-1277-5p details
hsa-miR-1277-5p CREBRF CREB3 regulatory factor HGNC:24050 details
hsa-miR-1277-5p CPEB2 cytoplasmic polyadenylation element binding protein 2 HGNC:21745 details
hsa-miR-1277-5p BMPR1A bone morphogenetic protein receptor type 1A HGNC:1076 details
hsa-miR-1277-5p NLRP8 NLR family pyrin domain containing 8 HGNC:22940 details
hsa-miR-1277-5p SAMD12 sterile alpha motif domain containing 12 HGNC:31750 details
hsa-miR-1277-5p TTC39B tetratricopeptide repeat domain 39B HGNC:23704 details
hsa-miR-1277-5p CDON cell adhesion associated, oncogene regulated HGNC:17104 details
hsa-miR-1277-5p PPP2R5E protein phosphatase 2 regulatory subunit B'epsilon HGNC:9313 details
hsa-miR-1277-5p ROCK2 Rho associated coiled-coil containing protein kinase 2 HGNC:10252 details
hsa-miR-1277-5p SERTM1 serine rich and transmembrane domain containing 1 HGNC:33792 details
hsa-miR-1277-5p IRS1 insulin receptor substrate 1 HGNC:6125 details
hsa-miR-1277-5p ZBTB18 zinc finger and BTB domain containing 18 HGNC:13030 details
hsa-miR-1277-5p RORA RAR related orphan receptor A HGNC:10258 details
hsa-miR-1277-5p NR6A1 nuclear receptor subfamily 6 group A member 1 HGNC:7985 details
hsa-miR-1277-5p HSBP1 heat shock factor binding protein 1 HGNC:5203 details
hsa-miR-1277-5p BCORL1 BCL6 corepressor like 1 HGNC:25657 details
hsa-miR-1277-5p ZNF556 zinc finger protein 556 HGNC:25669 details
hsa-miR-1277-5p ZFP36L1 ZFP36 ring finger protein like 1 HGNC:1107 details
hsa-miR-1277-5p PLEKHM3 pleckstrin homology domain containing M3 HGNC:34006 details
hsa-miR-1277-5p FAM135A family with sequence similarity 135 member A HGNC:21084 details
hsa-miR-1277-5p XKR9 XK related 9 HGNC:20937 details
hsa-miR-1277-5p OSBP2 oxysterol binding protein 2 HGNC:8504 details
hsa-miR-1277-5p PPIL1 peptidylprolyl isomerase like 1 HGNC:9260 details
hsa-miR-1277-5p TAGLN2 transgelin 2 HGNC:11554 details
hsa-miR-1277-5p TRIM4 tripartite motif containing 4 HGNC:16275 details
hsa-miR-1277-5p SPPL3 signal peptide peptidase like 3 HGNC:30424 details
hsa-miR-1277-5p SGPP2 sphingosine-1-phosphate phosphatase 2 HGNC:19953 details
hsa-miR-1277-5p C15orf40 chromosome 15 open reading frame 40 HGNC:28443 details
hsa-miR-1277-5p ANXA5 annexin A5 HGNC:543 details
hsa-miR-1277-5p ZNF551 zinc finger protein 551 HGNC:25108 details
hsa-miR-1277-5p SSPN sarcospan HGNC:11322 details
hsa-miR-1277-5p NDFIP2 Nedd4 family interacting protein 2 HGNC:18537 details
hsa-miR-1277-5p ZNF264 zinc finger protein 264 HGNC:13057 details
hsa-miR-1277-5p UHMK1 U2AF homology motif kinase 1 HGNC:19683 details
hsa-miR-1277-5p TNPO1 transportin 1 HGNC:6401 details
hsa-miR-1277-5p SYF2 SYF2 pre-mRNA splicing factor HGNC:19824 details
hsa-miR-1277-5p STOX2 storkhead box 2 HGNC:25450 details
hsa-miR-1277-5p SERTAD2 SERTA domain containing 2 HGNC:30784 details
hsa-miR-1277-5p PRR14L proline rich 14 like HGNC:28738 details
hsa-miR-1277-5p PPP1R15B protein phosphatase 1 regulatory subunit 15B HGNC:14951 details
hsa-miR-1277-5p NUMB NUMB endocytic adaptor protein HGNC:8060 details
hsa-miR-1277-5p LHFPL2 LHFPL tetraspan subfamily member 2 HGNC:6588 details
hsa-miR-1277-5p GOLGA7 golgin A7 HGNC:24876 details
hsa-miR-1277-5p FKBP1A FKBP prolyl isomerase 1A HGNC:3711 details
hsa-miR-1277-5p ENPP5 ectonucleotide pyrophosphatase/phosphodiesterase family member 5 HGNC:13717 details
hsa-miR-1277-5p DAPK1 death associated protein kinase 1 HGNC:2674 details
hsa-miR-1277-5p CCND2 cyclin D2 HGNC:1583 details
hsa-miR-1277-5p CANX calnexin HGNC:1473 details
hsa-miR-1277-5p C18orf25 chromosome 18 open reading frame 25 HGNC:28172 details
hsa-miR-1277-5p ATXN3 ataxin 3 HGNC:7106 details
hsa-miR-1277-5p ASH1L ASH1 like histone lysine methyltransferase HGNC:19088 details
hsa-miR-1277-5p ARL8A ADP ribosylation factor like GTPase 8A HGNC:25192 details
hsa-miR-1277-5p AKAP11 A-kinase anchoring protein 11 HGNC:369 details
hsa-miR-1277-5p ACBD5 acyl-CoA binding domain containing 5 HGNC:23338 details
hsa-miR-1277-5p PELP1 proline, glutamate and leucine rich protein 1 HGNC:30134 details
hsa-miR-1277-5p RBM23 RNA binding motif protein 23 HGNC:20155 details
hsa-miR-1277-5p NUP37 nucleoporin 37 HGNC:29929 details
hsa-miR-1277-5p RHCG Rh family C glycoprotein HGNC:18140 details
hsa-miR-1277-5p FAR2 fatty acyl-CoA reductase 2 HGNC:25531 details
hsa-miR-1277-5p ARL13B ADP ribosylation factor like GTPase 13B HGNC:25419 details
hsa-miR-1277-5p FAM120AOS family with sequence similarity 120A opposite strand HGNC:23389 details
hsa-miR-1277-5p GNL3 G protein nucleolar 3 HGNC:29931 details
hsa-miR-1277-5p APOL6 apolipoprotein L6 HGNC:14870 details
hsa-miR-1277-5p SMAD9 SMAD family member 9 HGNC:6774 details
hsa-miR-1277-5p TBX4 T-box transcription factor 4 HGNC:11603 details
hsa-miR-1277-5p PLCXD1 phosphatidylinositol specific phospholipase C X domain containing 1 HGNC:23148 details
hsa-miR-1277-5p MYZAP myocardial zonula adherens protein HGNC:43444 details
hsa-miR-1277-5p TP53RK TP53 regulating kinase HGNC:16197 details
hsa-miR-1277-5p OPN5 opsin 5 HGNC:19992 details
hsa-miR-1277-5p BRCC3 BRCA1/BRCA2-containing complex subunit 3 HGNC:24185 details
hsa-miR-1277-5p WARS2 tryptophanyl tRNA synthetase 2, mitochondrial HGNC:12730 details
hsa-miR-1277-5p DDX52 DExD-box helicase 52 HGNC:20038 details
hsa-miR-1277-5p ATP7A ATPase copper transporting alpha HGNC:869 details
hsa-miR-1277-5p EPM2AIP1 EPM2A interacting protein 1 HGNC:19735 details
hsa-miR-1277-5p GIMAP7 GTPase, IMAP family member 7 HGNC:22404 details
hsa-miR-1277-5p RASSF6 Ras association domain family member 6 HGNC:20796 details
hsa-miR-1277-5p C4orf33 chromosome 4 open reading frame 33 HGNC:27025 details
hsa-miR-1277-5p EPHA1 EPH receptor A1 HGNC:3385 details
hsa-miR-1277-5p RAB11FIP3 RAB11 family interacting protein 3 HGNC:17224 details
hsa-miR-1277-5p SART3 spliceosome associated factor 3, U4/U6 recycling protein HGNC:16860 details
hsa-miR-1277-5p ZNF562 zinc finger protein 562 HGNC:25950 details
hsa-miR-1277-5p ZNF275 zinc finger protein 275 HGNC:13069 details
hsa-miR-1277-5p ZHX3 zinc fingers and homeoboxes 3 HGNC:15935 details
hsa-miR-1277-5p ZFP36L2 ZFP36 ring finger protein like 2 HGNC:1108 details
hsa-miR-1277-5p VGLL2 vestigial like family member 2 HGNC:20232 details
hsa-miR-1277-5p TSPAN14 tetraspanin 14 HGNC:23303 details
hsa-miR-1277-5p TRIB1 tribbles pseudokinase 1 HGNC:16891 details
hsa-miR-1277-5p TRAF5 TNF receptor associated factor 5 HGNC:12035 details
hsa-miR-1277-5p TIMM10 translocase of inner mitochondrial membrane 10 HGNC:11814 details
hsa-miR-1277-5p RPL37 ribosomal protein L37 HGNC:10347 details
hsa-miR-1277-5p RGMB repulsive guidance molecule BMP co-receptor b HGNC:26896 details
hsa-miR-1277-5p RAP1A RAP1A, member of RAS oncogene family HGNC:9855 details
hsa-miR-1277-5p QKI QKI, KH domain containing RNA binding HGNC:21100 details
hsa-miR-1277-5p PPP2R5C protein phosphatase 2 regulatory subunit B'gamma HGNC:9311 details
hsa-miR-1277-5p details
hsa-miR-1277-5p RTL6 retrotransposon Gag like 6 HGNC:13343 details
hsa-miR-1277-5p KLF6 Kruppel like factor 6 HGNC:2235 details
hsa-miR-1277-5p HOXA9 homeobox A9 HGNC:5109 details
hsa-miR-1277-5p HOOK1 hook microtubule tethering protein 1 HGNC:19884 details
hsa-miR-1277-5p HIGD1A HIG1 hypoxia inducible domain family member 1A HGNC:29527 details
hsa-miR-1277-5p GNB1 G protein subunit beta 1 HGNC:4396 details
hsa-miR-1277-5p FUBP1 far upstream element binding protein 1 HGNC:4004 details
hsa-miR-1277-5p FREM2 FRAS1 related extracellular matrix 2 HGNC:25396 details
hsa-miR-1277-5p FOXP1 forkhead box P1 HGNC:3823 details
hsa-miR-1277-5p FBXL18 F-box and leucine rich repeat protein 18 HGNC:21874 details
hsa-miR-1277-5p FAM177A1 family with sequence similarity 177 member A1 HGNC:19829 details
hsa-miR-1277-5p ERC1 ELKS/RAB6-interacting/CAST family member 1 HGNC:17072 details
hsa-miR-1277-5p DUSP8 dual specificity phosphatase 8 HGNC:3074 details
hsa-miR-1277-5p DDX17 DEAD-box helicase 17 HGNC:2740 details
hsa-miR-1277-5p DDHD2 DDHD domain containing 2 HGNC:29106 details
hsa-miR-1277-5p CNKSR3 CNKSR family member 3 HGNC:23034 details
hsa-miR-1277-5p CDK1 cyclin dependent kinase 1 HGNC:1722 details
hsa-miR-1277-5p CALML4 calmodulin like 4 HGNC:18445 details
hsa-miR-1277-5p CA8 carbonic anhydrase 8 HGNC:1382 details
hsa-miR-1277-5p BTN3A3 butyrophilin subfamily 3 member A3 HGNC:1140 details
hsa-miR-1277-5p BLOC1S4 biogenesis of lysosomal organelles complex 1 subunit 4 HGNC:24206 details
hsa-miR-1277-5p ATP2B4 ATPase plasma membrane Ca2+ transporting 4 HGNC:817 details
hsa-miR-1277-5p ARID5B AT-rich interaction domain 5B HGNC:17362 details
hsa-miR-1277-5p AP1AR adaptor related protein complex 1 associated regulatory protein HGNC:28808 details
hsa-miR-1277-5p TRMT112 tRNA methyltransferase activator subunit 11-2 HGNC:26940 details
hsa-miR-1277-5p ZNF557 zinc finger protein 557 HGNC:28632 details
hsa-miR-1277-5p SPRTN SprT-like N-terminal domain HGNC:25356 details
hsa-miR-1277-5p ZNF529 zinc finger protein 529 HGNC:29328 details
hsa-miR-1277-5p MSANTD4 Myb/SANT DNA binding domain containing 4 with coiled-coils HGNC:29383 details
hsa-miR-1277-5p NOLC1 nucleolar and coiled-body phosphoprotein 1 HGNC:15608 details
hsa-miR-1277-5p YDJC YdjC chitooligosaccharide deacetylase homolog HGNC:27158 details
hsa-miR-1277-5p SLC29A1 solute carrier family 29 member 1 (Augustine blood group) HGNC:11003 details
hsa-miR-1277-5p ZNF460 zinc finger protein 460 HGNC:21628 details
hsa-miR-1277-5p SVIP small VCP interacting protein HGNC:25238 details
hsa-miR-1277-5p HUWE1 HECT, UBA and WWE domain containing E3 ubiquitin protein ligase 1 HGNC:30892 details
hsa-miR-1277-5p CCL11 C-C motif chemokine ligand 11 HGNC:10610 details
hsa-miR-1277-5p CCDC80 coiled-coil domain containing 80 HGNC:30649 details
hsa-miR-1277-5p ZRANB1 zinc finger RANBP2-type containing 1 HGNC:18224 details
hsa-miR-1277-5p XPOT exportin for tRNA HGNC:12826 details
hsa-miR-1277-5p NHS NHS actin remodeling regulator HGNC:7820 details
hsa-miR-1277-5p POU2F1 POU class 2 homeobox 1 HGNC:9212 details
hsa-miR-1277-5p PANK3 pantothenate kinase 3 HGNC:19365 details
hsa-miR-1277-5p NR3C1 nuclear receptor subfamily 3 group C member 1 HGNC:7978 details
hsa-miR-1277-5p MB21D2 Mab-21 domain containing 2 HGNC:30438 details
hsa-miR-1277-5p MASTL microtubule associated serine/threonine kinase like HGNC:19042 details
hsa-miR-1277-5p IRF2BP2 interferon regulatory factor 2 binding protein 2 HGNC:21729 details
hsa-miR-1277-5p INO80D INO80 complex subunit D HGNC:25997 details
hsa-miR-1277-5p GRPEL2 GrpE like 2, mitochondrial HGNC:21060 details
hsa-miR-1277-5p EXOC8 exocyst complex component 8 HGNC:24659 details
hsa-miR-1277-5p ERGIC2 ERGIC and golgi 2 HGNC:30208 details
hsa-miR-1277-5p CPSF6 cleavage and polyadenylation specific factor 6 HGNC:13871 details
hsa-miR-1277-5p ATXN1 ataxin 1 HGNC:10548 details
hsa-miR-1277-5p ALKBH5 alkB homolog 5, RNA demethylase HGNC:25996 details
hsa-miR-1277-5p DDX3X DEAD-box helicase 3 X-linked HGNC:2745 details
hsa-miR-1277-5p CCDC14 coiled-coil domain containing 14 HGNC:25766 details
hsa-miR-1277-5p CMTM6 CKLF like MARVEL transmembrane domain containing 6 HGNC:19177 details
hsa-miR-1277-5p TM9SF3 transmembrane 9 superfamily member 3 HGNC:21529 details
hsa-miR-1277-5p RPS15A ribosomal protein S15a HGNC:10389 details
hsa-miR-1277-5p PSAT1 phosphoserine aminotransferase 1 HGNC:19129 details
hsa-miR-1277-5p PCK1 phosphoenolpyruvate carboxykinase 1 HGNC:8724 details
hsa-miR-1277-5p CD2AP CD2 associated protein HGNC:14258 details
hsa-miR-1277-5p ACVR2B activin A receptor type 2B HGNC:174 details
hsa-miR-1277-5p DHX36 DEAH-box helicase 36 HGNC:14410 details
hsa-miR-1277-5p EMC3 ER membrane protein complex subunit 3 HGNC:23999 details
hsa-miR-1277-5p NSUN3 NOP2/Sun RNA methyltransferase 3 HGNC:26208 details
hsa-miR-1277-5p LANCL3 LanC like 3 HGNC:24767 details
hsa-miR-1277-5p CEP97 centrosomal protein 97 HGNC:26244 details
hsa-miR-1277-5p SLCO1B3 solute carrier organic anion transporter family member 1B3 HGNC:10961 details
hsa-miR-1277-5p details
hsa-miR-1277-5p NEGR1 neuronal growth regulator 1 HGNC:17302 details
hsa-miR-1277-5p SMCHD1 structural maintenance of chromosomes flexible hinge domain containing 1 HGNC:29090 details
hsa-miR-1277-5p KYNU kynureninase HGNC:6469 details
hsa-miR-1277-5p SLITRK4 SLIT and NTRK like family member 4 HGNC:23502 details
hsa-miR-1277-5p ANTXR2 ANTXR cell adhesion molecule 2 HGNC:21732 details
hsa-miR-1277-5p details
hsa-miR-1277-5p RNF168 ring finger protein 168 HGNC:26661 details
hsa-miR-1277-5p TSPAN1 tetraspanin 1 HGNC:20657 details
hsa-miR-1277-5p SLC6A5 solute carrier family 6 member 5 HGNC:11051 details
hsa-miR-1277-5p NECAB1 N-terminal EF-hand calcium binding protein 1 HGNC:20983 details
hsa-miR-1277-5p AQP3 aquaporin 3 (Gill blood group) HGNC:636 details
hsa-miR-1277-5p EPDR1 ependymin related 1 HGNC:17572 details
hsa-miR-1277-5p L1CAM L1 cell adhesion molecule HGNC:6470 details
hsa-miR-1277-5p PRRC2C proline rich coiled-coil 2C HGNC:24903 details
hsa-miR-1277-5p AHCYL2 adenosylhomocysteinase like 2 HGNC:22204 details
hsa-miR-1277-5p SPRED1 sprouty related EVH1 domain containing 1 HGNC:20249 details
hsa-miR-1277-5p BRMS1L BRMS1 like transcriptional repressor HGNC:20512 details
hsa-miR-1277-5p LONRF3 LON peptidase N-terminal domain and ring finger 3 HGNC:21152 details
hsa-miR-1277-5p IKZF2 IKAROS family zinc finger 2 HGNC:13177 details
hsa-miR-1277-5p NCK2 NCK adaptor protein 2 HGNC:7665 details
hsa-miR-1277-5p CNTNAP5 contactin associated protein family member 5 HGNC:18748 details
hsa-miR-1277-5p STAM signal transducing adaptor molecule HGNC:11357 details
hsa-miR-1277-5p SIK3 SIK family kinase 3 HGNC:29165 details
hsa-miR-1277-5p KCNB1 potassium voltage-gated channel subfamily B member 1 HGNC:6231 details
hsa-miR-1277-5p NBPF10 NBPF member 10 HGNC:31992 details
hsa-miR-1277-5p ARHGEF11 Rho guanine nucleotide exchange factor 11 HGNC:14580 details
hsa-miR-1277-5p PCDH7 protocadherin 7 HGNC:8659 details
hsa-miR-1277-5p MFAP5 microfibril associated protein 5 HGNC:29673 details
hsa-miR-1277-5p DCAF4L1 DDB1 and CUL4 associated factor 4 like 1 HGNC:27723 details
hsa-miR-1277-5p WDTC1 WD and tetratricopeptide repeats 1 HGNC:29175 details
hsa-miR-1277-5p HHIP hedgehog interacting protein HGNC:14866 details
hsa-miR-1277-5p CXCL5 C-X-C motif chemokine ligand 5 HGNC:10642 details
hsa-miR-1277-5p IGFBP1 insulin like growth factor binding protein 1 HGNC:5469 details
hsa-miR-1277-5p ZMAT3 zinc finger matrin-type 3 HGNC:29983 details
hsa-miR-1277-5p ZBTB7A zinc finger and BTB domain containing 7A HGNC:18078 details
hsa-miR-1277-5p WDR12 WD repeat domain 12 HGNC:14098 details
hsa-miR-1277-5p UNK unk zinc finger HGNC:29369 details
hsa-miR-1277-5p TTYH3 tweety family member 3 HGNC:22222 details
hsa-miR-1277-5p TMEM178B transmembrane protein 178B HGNC:44112 details
hsa-miR-1277-5p TAOK1 TAO kinase 1 HGNC:29259 details
hsa-miR-1277-5p STYX serine/threonine/tyrosine interacting protein HGNC:11447 details
hsa-miR-1277-5p SRGAP2 SLIT-ROBO Rho GTPase activating protein 2 HGNC:19751 details
hsa-miR-1277-5p SNRK SNF related kinase HGNC:30598 details
hsa-miR-1277-5p SLC45A4 solute carrier family 45 member 4 HGNC:29196 details
hsa-miR-1277-5p SLC25A12 solute carrier family 25 member 12 HGNC:10982 details
hsa-miR-1277-5p PRIMA1 proline rich membrane anchor 1 HGNC:18319 details
hsa-miR-1277-5p NR2C2 nuclear receptor subfamily 2 group C member 2 HGNC:7972 details
hsa-miR-1277-5p MED28 mediator complex subunit 28 HGNC:24628 details
hsa-miR-1277-5p MCAM melanoma cell adhesion molecule HGNC:6934 details
hsa-miR-1277-5p MAPK6 mitogen-activated protein kinase 6 HGNC:6879 details
hsa-miR-1277-5p KIAA1671 KIAA1671 HGNC:29345 details
hsa-miR-1277-5p IGF1R insulin like growth factor 1 receptor HGNC:5465 details
hsa-miR-1277-5p HERPUD2 HERPUD family member 2 HGNC:21915 details
hsa-miR-1277-5p GREB1L GREB1 like retinoic acid receptor coactivator HGNC:31042 details
hsa-miR-1277-5p CADM1 cell adhesion molecule 1 HGNC:5951 details
hsa-miR-1277-5p C18orf32 chromosome 18 open reading frame 32 HGNC:31690 details
hsa-miR-1277-5p details
hsa-miR-1277-5p ADD2 adducin 2 HGNC:244 details
hsa-miR-1277-5p CRIPT CXXC repeat containing interactor of PDZ3 domain HGNC:14312 details
hsa-miR-1277-5p RPL24 ribosomal protein L24 HGNC:10325 details
hsa-miR-1277-5p FMNL2 formin like 2 HGNC:18267 details
hsa-miR-1277-5p ZPBP zona pellucida binding protein HGNC:15662 details
hsa-miR-1277-5p EN1 engrailed homeobox 1 HGNC:3342 details
hsa-miR-1277-5p ANP32E acidic nuclear phosphoprotein 32 family member E HGNC:16673 details
hsa-miR-1277-5p MTURN maturin, neural progenitor differentiation regulator homolog HGNC:25457 details
hsa-miR-1277-5p PURA purine rich element binding protein A HGNC:9701 details
hsa-miR-1277-5p ADAT2 adenosine deaminase tRNA specific 2 HGNC:21172 details
hsa-miR-1277-5p KIF14 kinesin family member 14 HGNC:19181 details
© 2021 Arieh Warshel Institute of Computational Biology, CUHK(SZ) | Designed by : Biomics Lab