miRNA Card

miRNA General Information
miRNA ID hsa-miR-1468-3p
Description Homo sapiens miR-1468 stem-loop
Comment This sequence was identified as a miRNA candidate by Berezikov et al [1], and confirmed later by cloning [2].
Experiment Illumina [3]
Sequence AGCAAAAUAAGCAAAUGGAAAA
miRNA Expression in different cancers

    by mir_boxplot.py

circRNA-miRNA-gene regulatory network

Note about Netwrok:
This is a network diagram with miRNA (purple circle) as the center.
We used three tools(PITA, miRanda, targetScan) to predict the binding sites of circrna (green circle) and miRNA. Accordingly, for this miRNA that binds to circrna, we have three confidence levels, namely confident 1, confident 2 and confident 3. Confidence value indicates how many tools can deduce these results. For each confidence, we use different kinds of dashed lines.

Target circRNA with confidence

Confidence 3 (3 of 3 tools predicted)

CircID miRNA PITA miRanda targetScan
chr16:28825366|28831072 hsa-miR-1468-3p 1 1 1

Confidence 2 (2 of 3 tools predicted)

CircID miRNA PITA miRanda targetScan
chr11:72010786|72012418 hsa-miR-1468-3p 1 1 0
chr9:134149704|134149838 hsa-miR-1468-3p 1 1 0

Confidence 1 (1 of 3 tools predicted)

CircID miRNA PITA miRanda targetScan
chr22:17180034|17180229 hsa-miR-1468-3p 0 1 0
chr1:78642545|78642670 hsa-miR-1468-3p 0 1 0
chr11:62242256|62242362 hsa-miR-1468-3p 0 1 0
chr13:113640465|113640554 hsa-miR-1468-3p 0 1 0
chr15:42568839|42568969 hsa-miR-1468-3p 0 1 0
chr22:32862622|32862760 hsa-miR-1468-3p 0 1 0
chr22:32862624|32862760 hsa-miR-1468-3p 0 1 0
chr3:101327702|101327816 hsa-miR-1468-3p 0 1 0
chr11:72010807|72012442 hsa-miR-1468-3p 0 1 0
chr16:1779150|1779239 hsa-miR-1468-3p 0 1 0
chr11:70470086~70470265 hsa-miR-1468-3p 0 1 0
chr11:62242241~62242362 hsa-miR-1468-3p 0 1 0
chr7:155251570~155251715 hsa-miR-1468-3p 0 1 0
chrX:110676047~110676260 hsa-miR-1468-3p 0 1 0
chr22:32862624~32862760 hsa-miR-1468-3p 0 1 0
chr6:111374703~111374782 hsa-miR-1468-3p 0 1 0
chr17:15230511~15230701 hsa-miR-1468-3p 0 1 0
chr7:8003908|8004059 hsa-miR-1468-3p 0 1 0
chr9:33922117|33922269 hsa-miR-1468-3p 0 1 0
chr13:21412236|21412390 hsa-miR-1468-3p 0 1 0
chr9:27055654|27055772 hsa-miR-1468-3p 0 1 0
chrX:44974836|44975014 hsa-miR-1468-3p 0 1 0
chr7:5674532|5674764 hsa-miR-1468-3p 0 1 0
chr10:91996424|91996549 hsa-miR-1468-3p 0 1 0
chr9:96320909|96321129 hsa-miR-1468-3p 0 1 0
chrX:47225974|47226344 hsa-miR-1468-3p 0 1 0
chr13:32517857|32527532 hsa-miR-1468-3p 0 1 0
chr4:5842142|5842340 hsa-miR-1468-3p 0 1 0
chr13:32521373|32527532 hsa-miR-1468-3p 0 1 0
chr9:33922000|33922269 hsa-miR-1468-3p 0 1 0
chrX:53937422|53937532 hsa-miR-1468-3p 0 1 0
chr8:123328190|123328384 hsa-miR-1468-3p 0 1 0
chr17:17703554|17703691 hsa-miR-1468-3p 0 1 0
chr2:71109991|71110122 hsa-miR-1468-3p 0 1 0
chr1:25823577|25823728 hsa-miR-1468-3p 0 1 0
chr22:32862487|32862760 hsa-miR-1468-3p 0 1 0
chr8:670143|670323 hsa-miR-1468-3p 0 1 0
chr13:113640465|113640652 hsa-miR-1468-3p 0 1 0
chr9:33922089|33922269 hsa-miR-1468-3p 0 1 0
chrX:110676059|110676342 hsa-miR-1468-3p 0 1 0
chr20:43548692|43548811 hsa-miR-1468-3p 0 1 0
chr17:15230507|15230628 hsa-miR-1468-3p 0 1 0
chr13:113640465|113640681 hsa-miR-1468-3p 0 1 0
chr13:113640402|113640620 hsa-miR-1468-3p 0 1 0
chrX:47225968|47226344 hsa-miR-1468-3p 0 1 0
chr9:86298036|86298166 hsa-miR-1468-3p 0 1 0
Target genes
miRNA Gene Gene Description HGNC ID details
hsa-miR-1468-3p ZNF701 zinc finger protein 701 HGNC:25597 details
hsa-miR-1468-3p ZNF525 zinc finger protein 525 HGNC:29423 details
hsa-miR-1468-3p CRYBG3 crystallin beta-gamma domain containing 3 HGNC:34427 details
hsa-miR-1468-3p FOXP1 forkhead box P1 HGNC:3823 details
hsa-miR-1468-3p ZNF24 zinc finger protein 24 HGNC:13032 details
hsa-miR-1468-3p TLR4 toll like receptor 4 HGNC:11850 details
hsa-miR-1468-3p POLI DNA polymerase iota HGNC:9182 details
hsa-miR-1468-3p OTUD7A OTU deubiquitinase 7A HGNC:20718 details
hsa-miR-1468-3p DDX39B DExD-box helicase 39B HGNC:13917 details
hsa-miR-1468-3p PLA2G2D phospholipase A2 group IID HGNC:9033 details
hsa-miR-1468-3p EIF4EBP2 eukaryotic translation initiation factor 4E binding protein 2 HGNC:3289 details
hsa-miR-1468-3p details
hsa-miR-1468-3p MANEA mannosidase endo-alpha HGNC:21072 details
hsa-miR-1468-3p FUT10 fucosyltransferase 10 HGNC:19234 details
hsa-miR-1468-3p details
hsa-miR-1468-3p ZFHX3 zinc finger homeobox 3 HGNC:777 details
hsa-miR-1468-3p YY1 YY1 transcription factor HGNC:12856 details
hsa-miR-1468-3p WNT7B Wnt family member 7B HGNC:12787 details
hsa-miR-1468-3p TMBIM6 transmembrane BAX inhibitor motif containing 6 HGNC:11723 details
hsa-miR-1468-3p STX6 syntaxin 6 HGNC:11441 details
hsa-miR-1468-3p STX16 syntaxin 16 HGNC:11431 details
hsa-miR-1468-3p SPATA2 spermatogenesis associated 2 HGNC:14681 details
hsa-miR-1468-3p SMG1 SMG1 nonsense mediated mRNA decay associated PI3K related kinase HGNC:30045 details
hsa-miR-1468-3p SGK1 serum/glucocorticoid regulated kinase 1 HGNC:10810 details
hsa-miR-1468-3p SELENOT selenoprotein T HGNC:18136 details
hsa-miR-1468-3p PSAT1 phosphoserine aminotransferase 1 HGNC:19129 details
hsa-miR-1468-3p PPP2R5E protein phosphatase 2 regulatory subunit B'epsilon HGNC:9313 details
hsa-miR-1468-3p PITPNA phosphatidylinositol transfer protein alpha HGNC:9001 details
hsa-miR-1468-3p PATL1 PAT1 homolog 1, processing body mRNA decay factor HGNC:26721 details
hsa-miR-1468-3p NFIB nuclear factor I B HGNC:7785 details
hsa-miR-1468-3p MTMR6 myotubularin related protein 6 HGNC:7453 details
hsa-miR-1468-3p KIF13A kinesin family member 13A HGNC:14566 details
hsa-miR-1468-3p HMGB2 high mobility group box 2 HGNC:5000 details
hsa-miR-1468-3p details
hsa-miR-1468-3p details
hsa-miR-1468-3p GMFB glia maturation factor beta HGNC:4373 details
hsa-miR-1468-3p FZD6 frizzled class receptor 6 HGNC:4044 details
hsa-miR-1468-3p MIGA2 mitoguardin 2 HGNC:23621 details
hsa-miR-1468-3p EOGT EGF domain specific O-linked N-acetylglucosamine transferase HGNC:28526 details
hsa-miR-1468-3p ELL2 elongation factor for RNA polymerase II 2 HGNC:17064 details
hsa-miR-1468-3p DLG5 discs large MAGUK scaffold protein 5 HGNC:2904 details
hsa-miR-1468-3p CCNA2 cyclin A2 HGNC:1578 details
hsa-miR-1468-3p BLCAP BLCAP apoptosis inducing factor HGNC:1055 details
hsa-miR-1468-3p ATP6V1B2 ATPase H+ transporting V1 subunit B2 HGNC:854 details
hsa-miR-1468-3p ANKRD11 ankyrin repeat domain 11 HGNC:21316 details
hsa-miR-1468-3p ZFYVE26 zinc finger FYVE-type containing 26 HGNC:20761 details
hsa-miR-1468-3p SOX4 SRY-box transcription factor 4 HGNC:11200 details
hsa-miR-1468-3p DICER1 dicer 1, ribonuclease III HGNC:17098 details
hsa-miR-1468-3p ARPP19 cAMP regulated phosphoprotein 19 HGNC:16967 details
hsa-miR-1468-3p SEC23A SEC23 homolog A, COPII coat complex component HGNC:10701 details
hsa-miR-1468-3p CNOT4 CCR4-NOT transcription complex subunit 4 HGNC:7880 details
hsa-miR-1468-3p PDRG1 p53 and DNA damage regulated 1 HGNC:16119 details
hsa-miR-1468-3p WDR45B WD repeat domain 45B HGNC:25072 details
hsa-miR-1468-3p SLC48A1 solute carrier family 48 member 1 HGNC:26035 details
hsa-miR-1468-3p MMGT1 membrane magnesium transporter 1 HGNC:28100 details
hsa-miR-1468-3p CCND2 cyclin D2 HGNC:1583 details
hsa-miR-1468-3p BTF3L4 basic transcription factor 3 like 4 HGNC:30547 details
hsa-miR-1468-3p BRWD3 bromodomain and WD repeat domain containing 3 HGNC:17342 details
hsa-miR-1468-3p ROCK1 Rho associated coiled-coil containing protein kinase 1 HGNC:10251 details
hsa-miR-1468-3p KLHL11 kelch like family member 11 HGNC:19008 details
hsa-miR-1468-3p PTBP2 polypyrimidine tract binding protein 2 HGNC:17662 details
hsa-miR-1468-3p SNRPB2 small nuclear ribonucleoprotein polypeptide B2 HGNC:11155 details
hsa-miR-1468-3p NBPF11 NBPF member 11 HGNC:31993 details
hsa-miR-1468-3p ZMAT3 zinc finger matrin-type 3 HGNC:29983 details
hsa-miR-1468-3p TUBB2A tubulin beta 2A class IIa HGNC:12412 details
hsa-miR-1468-3p SKIL SKI like proto-oncogene HGNC:10897 details
hsa-miR-1468-3p SEMA4C semaphorin 4C HGNC:10731 details
hsa-miR-1468-3p PPP1R15B protein phosphatase 1 regulatory subunit 15B HGNC:14951 details
hsa-miR-1468-3p PLEKHF2 pleckstrin homology and FYVE domain containing 2 HGNC:20757 details
hsa-miR-1468-3p G3BP2 G3BP stress granule assembly factor 2 HGNC:30291 details
hsa-miR-1468-3p CCNL1 cyclin L1 HGNC:20569 details
hsa-miR-1468-3p ZNF154 zinc finger protein 154 HGNC:12939 details
hsa-miR-1468-3p ERCC4 ERCC excision repair 4, endonuclease catalytic subunit HGNC:3436 details
hsa-miR-1468-3p UBN2 ubinuclein 2 HGNC:21931 details
hsa-miR-1468-3p UBE2D3 ubiquitin conjugating enzyme E2 D3 HGNC:12476 details
hsa-miR-1468-3p QKI QKI, KH domain containing RNA binding HGNC:21100 details
hsa-miR-1468-3p MOB1B MOB kinase activator 1B HGNC:29801 details
hsa-miR-1468-3p MED12L mediator complex subunit 12L HGNC:16050 details
hsa-miR-1468-3p FGF2 fibroblast growth factor 2 HGNC:3676 details
hsa-miR-1468-3p CEP350 centrosomal protein 350 HGNC:24238 details
hsa-miR-1468-3p SMAD4 SMAD family member 4 HGNC:6770 details
hsa-miR-1468-3p MCRIP2 MAPK regulated corepressor interacting protein 2 HGNC:14142 details
hsa-miR-1468-3p SPART spartin HGNC:18514 details
hsa-miR-1468-3p RAN RAN, member RAS oncogene family HGNC:9846 details
hsa-miR-1468-3p PSMA2 proteasome 20S subunit alpha 2 HGNC:9531 details
hsa-miR-1468-3p PPTC7 protein phosphatase targeting COQ7 HGNC:30695 details
hsa-miR-1468-3p NIPA1 NIPA magnesium transporter 1 HGNC:17043 details
hsa-miR-1468-3p LNPEP leucyl and cystinyl aminopeptidase HGNC:6656 details
hsa-miR-1468-3p ELOVL5 ELOVL fatty acid elongase 5 HGNC:21308 details
hsa-miR-1468-3p CREBL2 cAMP responsive element binding protein like 2 HGNC:2350 details
hsa-miR-1468-3p SF3B3 splicing factor 3b subunit 3 HGNC:10770 details
hsa-miR-1468-3p RNF111 ring finger protein 111 HGNC:17384 details
hsa-miR-1468-3p GRB10 growth factor receptor bound protein 10 HGNC:4564 details
hsa-miR-1468-3p F8A2 coagulation factor VIII associated 2 HGNC:31849 details
hsa-miR-1468-3p F8A3 coagulation factor VIII associated 3 HGNC:31850 details
hsa-miR-1468-3p ITM2C integral membrane protein 2C HGNC:6175 details
hsa-miR-1468-3p IMPA1 inositol monophosphatase 1 HGNC:6050 details
hsa-miR-1468-3p TBRG1 transforming growth factor beta regulator 1 HGNC:29551 details
hsa-miR-1468-3p RRAGD Ras related GTP binding D HGNC:19903 details
hsa-miR-1468-3p RNF11 ring finger protein 11 HGNC:10056 details
hsa-miR-1468-3p LDLR low density lipoprotein receptor HGNC:6547 details
hsa-miR-1468-3p KPNA6 karyopherin subunit alpha 6 HGNC:6399 details
hsa-miR-1468-3p AGFG1 ArfGAP with FG repeats 1 HGNC:5175 details
hsa-miR-1468-3p ZNF93 zinc finger protein 93 HGNC:13169 details
hsa-miR-1468-3p CCNL2 cyclin L2 HGNC:20570 details
hsa-miR-1468-3p NUP58 nucleoporin 58 HGNC:20261 details
hsa-miR-1468-3p AGTR2 angiotensin II receptor type 2 HGNC:338 details
hsa-miR-1468-3p MALT1 MALT1 paracaspase HGNC:6819 details
hsa-miR-1468-3p details
hsa-miR-1468-3p LINC00598 long intergenic non-protein coding RNA 598 HGNC:42770 details
hsa-miR-1468-3p RAVER2 ribonucleoprotein, PTB binding 2 HGNC:25577 details
hsa-miR-1468-3p RAB8B RAB8B, member RAS oncogene family HGNC:30273 details
hsa-miR-1468-3p GRAMD4 GRAM domain containing 4 HGNC:29113 details
hsa-miR-1468-3p DST dystonin HGNC:1090 details
hsa-miR-1468-3p DDX3X DEAD-box helicase 3 X-linked HGNC:2745 details
hsa-miR-1468-3p ANKRD50 ankyrin repeat domain 50 HGNC:29223 details
hsa-miR-1468-3p details
hsa-miR-1468-3p ADARB2 adenosine deaminase RNA specific B2 (inactive) HGNC:227 details
hsa-miR-1468-3p ZNF367 zinc finger protein 367 HGNC:18320 details
hsa-miR-1468-3p TNFRSF11A TNF receptor superfamily member 11a HGNC:11908 details
hsa-miR-1468-3p FAM135A family with sequence similarity 135 member A HGNC:21084 details
hsa-miR-1468-3p ESYT1 extended synaptotagmin 1 HGNC:29534 details
hsa-miR-1468-3p NDRG1 N-myc downstream regulated 1 HGNC:7679 details
hsa-miR-1468-3p MFF mitochondrial fission factor HGNC:24858 details
hsa-miR-1468-3p PAICS phosphoribosylaminoimidazole carboxylase and phosphoribosylaminoimidazolesuccinocarboxamide synthase HGNC:8587 details
hsa-miR-1468-3p FYTTD1 forty-two-three domain containing 1 HGNC:25407 details
hsa-miR-1468-3p ZNF772 zinc finger protein 772 HGNC:33106 details
hsa-miR-1468-3p WDR26 WD repeat domain 26 HGNC:21208 details
hsa-miR-1468-3p WBP4 WW domain binding protein 4 HGNC:12739 details
hsa-miR-1468-3p USP48 ubiquitin specific peptidase 48 HGNC:18533 details
hsa-miR-1468-3p USP13 ubiquitin specific peptidase 13 HGNC:12611 details
hsa-miR-1468-3p STOX2 storkhead box 2 HGNC:25450 details
hsa-miR-1468-3p SLC6A8 solute carrier family 6 member 8 HGNC:11055 details
hsa-miR-1468-3p RORA RAR related orphan receptor A HGNC:10258 details
hsa-miR-1468-3p SFTPA1 surfactant protein A1 HGNC:10798 details
hsa-miR-1468-3p POGZ pogo transposable element derived with ZNF domain HGNC:18801 details
hsa-miR-1468-3p MBNL3 muscleblind like splicing regulator 3 HGNC:20564 details
hsa-miR-1468-3p MBNL1 muscleblind like splicing regulator 1 HGNC:6923 details
hsa-miR-1468-3p LCLAT1 lysocardiolipin acyltransferase 1 HGNC:26756 details
hsa-miR-1468-3p IGF1R insulin like growth factor 1 receptor HGNC:5465 details
hsa-miR-1468-3p GIGYF1 GRB10 interacting GYF protein 1 HGNC:9126 details
hsa-miR-1468-3p ELMOD2 ELMO domain containing 2 HGNC:28111 details
hsa-miR-1468-3p E2F8 E2F transcription factor 8 HGNC:24727 details
hsa-miR-1468-3p CEP55 centrosomal protein 55 HGNC:1161 details
hsa-miR-1468-3p CHEK2 checkpoint kinase 2 HGNC:16627 details
hsa-miR-1468-3p CALM1 calmodulin 1 HGNC:1442 details
hsa-miR-1468-3p details
hsa-miR-1468-3p BOLA3 bolA family member 3 HGNC:24415 details
hsa-miR-1468-3p BMP3 bone morphogenetic protein 3 HGNC:1070 details
hsa-miR-1468-3p ARHGAP12 Rho GTPase activating protein 12 HGNC:16348 details
hsa-miR-1468-3p ARC activity regulated cytoskeleton associated protein HGNC:648 details
hsa-miR-1468-3p ACBD5 acyl-CoA binding domain containing 5 HGNC:23338 details
hsa-miR-1468-3p ZNF598 zinc finger protein 598, E3 ubiquitin ligase HGNC:28079 details
hsa-miR-1468-3p RPL7L1 ribosomal protein L7 like 1 HGNC:21370 details
hsa-miR-1468-3p MAVS mitochondrial antiviral signaling protein HGNC:29233 details
hsa-miR-1468-3p ZFP82 ZFP82 zinc finger protein HGNC:28682 details
hsa-miR-1468-3p ZNF678 zinc finger protein 678 HGNC:28652 details
hsa-miR-1468-3p ZXDA zinc finger X-linked duplicated A HGNC:13198 details
hsa-miR-1468-3p ZNF704 zinc finger protein 704 HGNC:32291 details
hsa-miR-1468-3p ZBTB18 zinc finger and BTB domain containing 18 HGNC:13030 details
hsa-miR-1468-3p WASL WASP like actin nucleation promoting factor HGNC:12735 details
hsa-miR-1468-3p TRIM33 tripartite motif containing 33 HGNC:16290 details
hsa-miR-1468-3p SAMD8 sterile alpha motif domain containing 8 HGNC:26320 details
hsa-miR-1468-3p RCAN2 regulator of calcineurin 2 HGNC:3041 details
hsa-miR-1468-3p PRKACB protein kinase cAMP-activated catalytic subunit beta HGNC:9381 details
hsa-miR-1468-3p details
hsa-miR-1468-3p NFAT5 nuclear factor of activated T cells 5 HGNC:7774 details
hsa-miR-1468-3p MYBL1 MYB proto-oncogene like 1 HGNC:7547 details
hsa-miR-1468-3p MLEC malectin HGNC:28973 details
hsa-miR-1468-3p MCC MCC regulator of WNT signaling pathway HGNC:6935 details
hsa-miR-1468-3p MARCKS myristoylated alanine rich protein kinase C substrate HGNC:6759 details
hsa-miR-1468-3p ITGA2 integrin subunit alpha 2 HGNC:6137 details
hsa-miR-1468-3p HNRNPF heterogeneous nuclear ribonucleoprotein F HGNC:5039 details
hsa-miR-1468-3p HBP1 HMG-box transcription factor 1 HGNC:23200 details
hsa-miR-1468-3p GNPTAB N-acetylglucosamine-1-phosphate transferase subunits alpha and beta HGNC:29670 details
hsa-miR-1468-3p GATA6 GATA binding protein 6 HGNC:4174 details
hsa-miR-1468-3p FBXO8 F-box protein 8 HGNC:13587 details
hsa-miR-1468-3p EVI5L ecotropic viral integration site 5 like HGNC:30464 details
hsa-miR-1468-3p ETS2 ETS proto-oncogene 2, transcription factor HGNC:3489 details
hsa-miR-1468-3p ENPP4 ectonucleotide pyrophosphatase/phosphodiesterase 4 HGNC:3359 details
hsa-miR-1468-3p EDEM1 ER degradation enhancing alpha-mannosidase like protein 1 HGNC:18967 details
hsa-miR-1468-3p DBN1 drebrin 1 HGNC:2695 details
hsa-miR-1468-3p CYP2U1 cytochrome P450 family 2 subfamily U member 1 HGNC:20582 details
hsa-miR-1468-3p CHIC1 cysteine rich hydrophobic domain 1 HGNC:1934 details
hsa-miR-1468-3p CFL2 cofilin 2 HGNC:1875 details
hsa-miR-1468-3p details
hsa-miR-1468-3p details
hsa-miR-1468-3p GDNF glial cell derived neurotrophic factor HGNC:4232 details
hsa-miR-1468-3p ARL8A ADP ribosylation factor like GTPase 8A HGNC:25192 details
hsa-miR-1468-3p AGO3 argonaute RISC catalytic component 3 HGNC:18421 details
hsa-miR-1468-3p STRBP spermatid perinuclear RNA binding protein HGNC:16462 details
hsa-miR-1468-3p ZNF680 zinc finger protein 680 HGNC:26897 details
hsa-miR-1468-3p ZNF107 zinc finger protein 107 HGNC:12887 details
hsa-miR-1468-3p YAP1 Yes1 associated transcriptional regulator HGNC:16262 details
hsa-miR-1468-3p ZMYND11 zinc finger MYND-type containing 11 HGNC:16966 details
hsa-miR-1468-3p ZDHHC18 zinc finger DHHC-type palmitoyltransferase 18 HGNC:20712 details
hsa-miR-1468-3p SYPL1 synaptophysin like 1 HGNC:11507 details
hsa-miR-1468-3p PAFAH1B2 platelet activating factor acetylhydrolase 1b catalytic subunit 2 HGNC:8575 details
hsa-miR-1468-3p CBX3 chromobox 3 HGNC:1553 details
hsa-miR-1468-3p CLVS2 clavesin 2 HGNC:23046 details
hsa-miR-1468-3p CCDC80 coiled-coil domain containing 80 HGNC:30649 details
hsa-miR-1468-3p TNFRSF21 TNF receptor superfamily member 21 HGNC:13469 details
hsa-miR-1468-3p TMPPE transmembrane protein with metallophosphoesterase domain HGNC:33865 details
hsa-miR-1468-3p TMEM41A transmembrane protein 41A HGNC:30544 details
hsa-miR-1468-3p PTMA prothymosin alpha HGNC:9623 details
hsa-miR-1468-3p NFYA nuclear transcription factor Y subunit alpha HGNC:7804 details
hsa-miR-1468-3p MAPK8 mitogen-activated protein kinase 8 HGNC:6881 details
hsa-miR-1468-3p LRRC58 leucine rich repeat containing 58 HGNC:26968 details
hsa-miR-1468-3p KCNJ2 potassium inwardly rectifying channel subfamily J member 2 HGNC:6263 details
hsa-miR-1468-3p details
hsa-miR-1468-3p ACVR2A activin A receptor type 2A HGNC:173 details
hsa-miR-1468-3p HCFC2 host cell factor C2 HGNC:24972 details
hsa-miR-1468-3p PLEKHA8 pleckstrin homology domain containing A8 HGNC:30037 details
hsa-miR-1468-3p ODF4 outer dense fiber of sperm tails 4 HGNC:19056 details
hsa-miR-1468-3p GPR151 G protein-coupled receptor 151 HGNC:23624 details
hsa-miR-1468-3p TAOK3 TAO kinase 3 HGNC:18133 details
hsa-miR-1468-3p MLLT6 MLLT6, PHD finger containing HGNC:7138 details
hsa-miR-1468-3p FAM104A family with sequence similarity 104 member A HGNC:25918 details
hsa-miR-1468-3p PEX26 peroxisomal biogenesis factor 26 HGNC:22965 details
hsa-miR-1468-3p RAB30 RAB30, member RAS oncogene family HGNC:9770 details
hsa-miR-1468-3p ZNF429 zinc finger protein 429 HGNC:20817 details
hsa-miR-1468-3p ZBTB33 zinc finger and BTB domain containing 33 HGNC:16682 details
hsa-miR-1468-3p CAPN7 calpain 7 HGNC:1484 details
hsa-miR-1468-3p MICA MHC class I polypeptide-related sequence A HGNC:7090 details
hsa-miR-1468-3p SPOP speckle type BTB/POZ protein HGNC:11254 details
hsa-miR-1468-3p DNAJC21 DnaJ heat shock protein family (Hsp40) member C21 HGNC:27030 details
hsa-miR-1468-3p NHLRC2 NHL repeat containing 2 HGNC:24731 details
hsa-miR-1468-3p PTPN14 protein tyrosine phosphatase non-receptor type 14 HGNC:9647 details
hsa-miR-1468-3p RAB23 RAB23, member RAS oncogene family HGNC:14263 details
hsa-miR-1468-3p details
hsa-miR-1468-3p ENAH ENAH actin regulator HGNC:18271 details
hsa-miR-1468-3p EMP2 epithelial membrane protein 2 HGNC:3334 details
hsa-miR-1468-3p ZZZ3 zinc finger ZZ-type containing 3 HGNC:24523 details
hsa-miR-1468-3p C19orf44 chromosome 19 open reading frame 44 HGNC:26141 details
hsa-miR-1468-3p details
hsa-miR-1468-3p DIP2A disco interacting protein 2 homolog A HGNC:17217 details
hsa-miR-1468-3p MTHFD1 methylenetetrahydrofolate dehydrogenase, cyclohydrolase and formyltetrahydrofolate synthetase 1 HGNC:7432 details
hsa-miR-1468-3p KIAA0513 KIAA0513 HGNC:29058 details
hsa-miR-1468-3p SNX19 sorting nexin 19 HGNC:21532 details
hsa-miR-1468-3p UBXN7 UBX domain protein 7 HGNC:29119 details
hsa-miR-1468-3p STK38 serine/threonine kinase 38 HGNC:17847 details
hsa-miR-1468-3p FKBP15 FKBP prolyl isomerase family member 15 HGNC:23397 details
hsa-miR-1468-3p DCTN6 dynactin subunit 6 HGNC:16964 details
hsa-miR-1468-3p CNEP1R1 CTD nuclear envelope phosphatase 1 regulatory subunit 1 HGNC:26759 details
hsa-miR-1468-3p CAMSAP1 calmodulin regulated spectrin associated protein 1 HGNC:19946 details
hsa-miR-1468-3p AMMECR1L AMMECR1 like HGNC:28658 details
hsa-miR-1468-3p NWD1 NACHT and WD repeat domain containing 1 HGNC:27619 details
hsa-miR-1468-3p PPFIBP1 PPFIA binding protein 1 HGNC:9249 details
hsa-miR-1468-3p WNK3 WNK lysine deficient protein kinase 3 HGNC:14543 details
hsa-miR-1468-3p SLC30A7 solute carrier family 30 member 7 HGNC:19306 details
hsa-miR-1468-3p details
hsa-miR-1468-3p CENPH centromere protein H HGNC:17268 details
hsa-miR-1468-3p TMTC1 transmembrane O-mannosyltransferase targeting cadherins 1 HGNC:24099 details
hsa-miR-1468-3p CDC42BPA CDC42 binding protein kinase alpha HGNC:1737 details
hsa-miR-1468-3p DEFB105B defensin beta 105B HGNC:29930 details
hsa-miR-1468-3p DEFB105A defensin beta 105A HGNC:18087 details
hsa-miR-1468-3p GRAMD2B GRAM domain containing 2B HGNC:24911 details
hsa-miR-1468-3p CHERP calcium homeostasis endoplasmic reticulum protein HGNC:16930 details
hsa-miR-1468-3p CD209 CD209 molecule HGNC:1641 details
hsa-miR-1468-3p MUC21 mucin 21, cell surface associated HGNC:21661 details
hsa-miR-1468-3p EREG epiregulin HGNC:3443 details
hsa-miR-1468-3p FXR1 FMR1 autosomal homolog 1 HGNC:4023 details
hsa-miR-1468-3p SECISBP2L SECIS binding protein 2 like HGNC:28997 details
hsa-miR-1468-3p ZBTB7B zinc finger and BTB domain containing 7B HGNC:18668 details
hsa-miR-1468-3p ATP6V0E1 ATPase H+ transporting V0 subunit e1 HGNC:863 details
hsa-miR-1468-3p HOXA11 homeobox A11 HGNC:5101 details
hsa-miR-1468-3p SP140L SP140 nuclear body protein like HGNC:25105 details
hsa-miR-1468-3p RABGAP1 RAB GTPase activating protein 1 HGNC:17155 details
© 2021 Arieh Warshel Institute of Computational Biology, CUHK(SZ) | Designed by : Biomics Lab