miRNA Card

miRNA General Information
miRNA ID hsa-miR-16-2-3p
Description Homo sapiens miR-16-2 stem-loop
Comment This entry represents a second putative hairpin precursor sequence for miR-16, located on chromosome 3 (see also MIR:MI0000070). The sequence was previously named mir-16-3 here and in references [1] and [2].
Experiment cloned [7]
Sequence CCAAUAUUACUGUGCUGCUUUA
miRNA Expression in different cancers

    by mir_boxplot.py

circRNA-miRNA-gene regulatory network

Note about Netwrok:
This is a network diagram with miRNA (purple circle) as the center.
We used three tools(PITA, miRanda, targetScan) to predict the binding sites of circrna (green circle) and miRNA. Accordingly, for this miRNA that binds to circrna, we have three confidence levels, namely confident 1, confident 2 and confident 3. Confidence value indicates how many tools can deduce these results. For each confidence, we use different kinds of dashed lines.

Target circRNA with confidence

Confidence 3 (3 of 3 tools predicted)

CircID miRNA PITA miRanda targetScan

Confidence 2 (2 of 3 tools predicted)

CircID miRNA PITA miRanda targetScan

Confidence 1 (1 of 3 tools predicted)

CircID miRNA PITA miRanda targetScan
chr12:51352424|51352564 hsa-miR-16-2-3p 1 0 0
chr2:176201060|176201201 hsa-miR-16-2-3p 1 0 0
chr11:62527007|62527207 hsa-miR-16-2-3p 0 1 0
chr22:33893611|33893738 hsa-miR-16-2-3p 0 1 0
chr11:10609741|10609851 hsa-miR-16-2-3p 0 1 0
chr2:176201048|176201198 hsa-miR-16-2-3p 1 0 0
chr1:43976127|43976371 hsa-miR-16-2-3p 0 1 0
chr11:62526986|62527126 hsa-miR-16-2-3p 0 1 0
chr20:32166927|32167052 hsa-miR-16-2-3p 0 1 0
chr20:32167026|32167128 hsa-miR-16-2-3p 0 1 0
chr1:150496530|150496878 hsa-miR-16-2-3p 0 1 0
chr7:17345888|17346007 hsa-miR-16-2-3p 0 1 0
chr14:99679979|99680129 hsa-miR-16-2-3p 0 1 0
chr14:94062379|94062519 hsa-miR-16-2-3p 0 1 0
chr11:62526979|62527179 hsa-miR-16-2-3p 0 1 0
chr1:43976127~43976371 hsa-miR-16-2-3p 0 1 0
chr20:32167026~32167128 hsa-miR-16-2-3p 0 1 0
chr3:148741469~148741642 hsa-miR-16-2-3p 0 1 0
chr12:13217325~13217603 hsa-miR-16-2-3p 0 1 0
chr20:32166945|32167069 hsa-miR-16-2-3p 0 1 0
chr2:201220482|201220634 hsa-miR-16-2-3p 0 1 0
chr3:53254106|53254235 hsa-miR-16-2-3p 1 0 0
chr11:73411200|73411352 hsa-miR-16-2-3p 0 1 0
chr5:55430641|55430755 hsa-miR-16-2-3p 0 1 0
chr6:57098849|57098996 hsa-miR-16-2-3p 0 1 0
chr20:34076707|34077051 hsa-miR-16-2-3p 0 1 0
chr11:57801761|57801886 hsa-miR-16-2-3p 0 1 0
chr17:48060890|48061162 hsa-miR-16-2-3p 0 1 0
chr1:27307918|27308057 hsa-miR-16-2-3p 0 1 0
chr19:39486231|39486450 hsa-miR-16-2-3p 0 1 0
chr22:24184165|24184303 hsa-miR-16-2-3p 0 1 0
chr7:149179987|149180103 hsa-miR-16-2-3p 0 1 0
chr1:168249890|168250068 hsa-miR-16-2-3p 0 1 0
chr18:44677125|44677283 hsa-miR-16-2-3p 0 1 0
chr17:48060861|48061162 hsa-miR-16-2-3p 0 1 0
chr10:5035428|5035616 hsa-miR-16-2-3p 0 1 0
chr10:23113986|23114156 hsa-miR-16-2-3p -5 1 0
chr2:69542365|69542522 hsa-miR-16-2-3p -8 1 0
chr13:44575013|44575167 hsa-miR-16-2-3p -11 1 0
chr2:176201060|176201198 hsa-miR-16-2-3p 1 0 0
chr11:62526986|62527104 hsa-miR-16-2-3p 0 1 0
chr2:27224763|27225076 hsa-miR-16-2-3p 0 1 0
chr6:157206913|157207153 hsa-miR-16-2-3p 0 1 0
chr1:150470773|150470907 hsa-miR-16-2-3p 0 1 0
chrX:120437438|120437584 hsa-miR-16-2-3p 0 1 0
chr9:99054620|99055289 hsa-miR-16-2-3p 0 1 0
chr20:34076737|34077051 hsa-miR-16-2-3p 0 1 0
chr12:49003757|49003874 hsa-miR-16-2-3p 0 1 0
chr1:160356329|160356740 hsa-miR-16-2-3p 0 1 0
chr9:120898606|120898766 hsa-miR-16-2-3p 0 1 0
chr9:83969266|83969330 hsa-miR-16-2-3p 0 1 0
chr17:41867513|41867668 hsa-miR-16-2-3p 0 1 0
Target genes
miRNA Gene Gene Description HGNC ID details
hsa-miR-16-2-3p RARB retinoic acid receptor beta HGNC:9865 details
hsa-miR-16-2-3p NUCKS1 nuclear casein kinase and cyclin dependent kinase substrate 1 HGNC:29923 details
hsa-miR-16-2-3p ABCG2 ATP binding cassette subfamily G member 2 (Junior blood group) HGNC:74 details
hsa-miR-16-2-3p MYC MYC proto-oncogene, bHLH transcription factor HGNC:7553 details
hsa-miR-16-2-3p ZNF431 zinc finger protein 431 HGNC:20809 details
hsa-miR-16-2-3p ZFX zinc finger protein X-linked HGNC:12869 details
hsa-miR-16-2-3p YWHAG tyrosine 3-monooxygenase/tryptophan 5-monooxygenase activation protein gamma HGNC:12852 details
hsa-miR-16-2-3p NUS1 NUS1 dehydrodolichyl diphosphate synthase subunit HGNC:21042 details
hsa-miR-16-2-3p CDC25A cell division cycle 25A HGNC:1725 details
hsa-miR-16-2-3p ARL6IP1 ADP ribosylation factor like GTPase 6 interacting protein 1 HGNC:697 details
hsa-miR-16-2-3p SH3BP5 SH3 domain binding protein 5 HGNC:10827 details
hsa-miR-16-2-3p B2M beta-2-microglobulin HGNC:914 details
hsa-miR-16-2-3p RBBP6 RB binding protein 6, ubiquitin ligase HGNC:9889 details
hsa-miR-16-2-3p GRPEL2 GrpE like 2, mitochondrial HGNC:21060 details
hsa-miR-16-2-3p RSBN1 round spermatid basic protein 1 HGNC:25642 details
hsa-miR-16-2-3p KLHL15 kelch like family member 15 HGNC:29347 details
hsa-miR-16-2-3p CCNT1 cyclin T1 HGNC:1599 details
hsa-miR-16-2-3p MTRNR2L6 MT-RNR2 like 6 HGNC:37163 details
hsa-miR-16-2-3p UBE2D3 ubiquitin conjugating enzyme E2 D3 HGNC:12476 details
hsa-miR-16-2-3p details
hsa-miR-16-2-3p RPS4X ribosomal protein S4 X-linked HGNC:10424 details
hsa-miR-16-2-3p PRKAA1 protein kinase AMP-activated catalytic subunit alpha 1 HGNC:9376 details
hsa-miR-16-2-3p FRK fyn related Src family tyrosine kinase HGNC:3955 details
hsa-miR-16-2-3p UBE2E3 ubiquitin conjugating enzyme E2 E3 HGNC:12479 details
hsa-miR-16-2-3p EI24 EI24 autophagy associated transmembrane protein HGNC:13276 details
hsa-miR-16-2-3p SULT1B1 sulfotransferase family 1B member 1 HGNC:17845 details
hsa-miR-16-2-3p SUB1 SUB1 regulator of transcription HGNC:19985 details
hsa-miR-16-2-3p TBC1D15 TBC1 domain family member 15 HGNC:25694 details
hsa-miR-16-2-3p PTAR1 protein prenyltransferase alpha subunit repeat containing 1 HGNC:30449 details
hsa-miR-16-2-3p IPO7 importin 7 HGNC:9852 details
hsa-miR-16-2-3p ERGIC2 ERGIC and golgi 2 HGNC:30208 details
hsa-miR-16-2-3p ERBIN erbb2 interacting protein HGNC:15842 details
hsa-miR-16-2-3p CLCN3 chloride voltage-gated channel 3 HGNC:2021 details
hsa-miR-16-2-3p ATP6V1C1 ATPase H+ transporting V1 subunit C1 HGNC:856 details
hsa-miR-16-2-3p ANP32E acidic nuclear phosphoprotein 32 family member E HGNC:16673 details
hsa-miR-16-2-3p AMOTL1 angiomotin like 1 HGNC:17811 details
hsa-miR-16-2-3p AGO2 argonaute RISC catalytic component 2 HGNC:3263 details
hsa-miR-16-2-3p CCT4 chaperonin containing TCP1 subunit 4 HGNC:1617 details
hsa-miR-16-2-3p HOXA10 homeobox A10 HGNC:5100 details
hsa-miR-16-2-3p TMEM117 transmembrane protein 117 HGNC:25308 details
hsa-miR-16-2-3p DROSHA drosha ribonuclease III HGNC:17904 details
hsa-miR-16-2-3p RPS6KA5 ribosomal protein S6 kinase A5 HGNC:10434 details
hsa-miR-16-2-3p RAB1A RAB1A, member RAS oncogene family HGNC:9758 details
hsa-miR-16-2-3p PPIF peptidylprolyl isomerase F HGNC:9259 details
hsa-miR-16-2-3p MRPS30 mitochondrial ribosomal protein S30 HGNC:8769 details
hsa-miR-16-2-3p USP46 ubiquitin specific peptidase 46 HGNC:20075 details
hsa-miR-16-2-3p SH3GLB1 SH3 domain containing GRB2 like, endophilin B1 HGNC:10833 details
hsa-miR-16-2-3p PREPL prolyl endopeptidase like HGNC:30228 details
hsa-miR-16-2-3p NRIP1 nuclear receptor interacting protein 1 HGNC:8001 details
hsa-miR-16-2-3p NFATC2IP nuclear factor of activated T cells 2 interacting protein HGNC:25906 details
hsa-miR-16-2-3p details
hsa-miR-16-2-3p HOXA9 homeobox A9 HGNC:5109 details
hsa-miR-16-2-3p TUBB2A tubulin beta 2A class IIa HGNC:12412 details
hsa-miR-16-2-3p details
hsa-miR-16-2-3p PABPC4L poly(A) binding protein cytoplasmic 4 like HGNC:31955 details
hsa-miR-16-2-3p RNF44 ring finger protein 44 HGNC:19180 details
hsa-miR-16-2-3p CCDC14 coiled-coil domain containing 14 HGNC:25766 details
hsa-miR-16-2-3p TM9SF3 transmembrane 9 superfamily member 3 HGNC:21529 details
hsa-miR-16-2-3p VSNL1 visinin like 1 HGNC:12722 details
hsa-miR-16-2-3p details
hsa-miR-16-2-3p LPP LIM domain containing preferred translocation partner in lipoma HGNC:6679 details
hsa-miR-16-2-3p AR androgen receptor HGNC:644 details
hsa-miR-16-2-3p ALDH1A2 aldehyde dehydrogenase 1 family member A2 HGNC:15472 details
hsa-miR-16-2-3p CBS cystathionine beta-synthase HGNC:1550 details
hsa-miR-16-2-3p BID BH3 interacting domain death agonist HGNC:1050 details
hsa-miR-16-2-3p WASF2 WASP family member 2 HGNC:12733 details
hsa-miR-16-2-3p AGMAT agmatinase HGNC:18407 details
hsa-miR-16-2-3p TNPO1 transportin 1 HGNC:6401 details
hsa-miR-16-2-3p PTPN14 protein tyrosine phosphatase non-receptor type 14 HGNC:9647 details
hsa-miR-16-2-3p DYRK2 dual specificity tyrosine phosphorylation regulated kinase 2 HGNC:3093 details
hsa-miR-16-2-3p ACBD5 acyl-CoA binding domain containing 5 HGNC:23338 details
hsa-miR-16-2-3p COMMD3-BMI1 COMMD3-BMI1 readthrough HGNC:48326 details
hsa-miR-16-2-3p BMI1 BMI1 proto-oncogene, polycomb ring finger HGNC:1066 details
hsa-miR-16-2-3p AP3B1 adaptor related protein complex 3 subunit beta 1 HGNC:566 details
hsa-miR-16-2-3p IGFBP5 insulin like growth factor binding protein 5 HGNC:5474 details
hsa-miR-16-2-3p LRIG2 leucine rich repeats and immunoglobulin like domains 2 HGNC:20889 details
hsa-miR-16-2-3p CD302 CD302 molecule HGNC:30843 details
hsa-miR-16-2-3p LY75-CD302 LY75-CD302 readthrough HGNC:38828 details
hsa-miR-16-2-3p LY75 lymphocyte antigen 75 HGNC:6729 details
hsa-miR-16-2-3p MLX MAX dimerization protein MLX HGNC:11645 details
hsa-miR-16-2-3p NACC1 nucleus accumbens associated 1 HGNC:20967 details
hsa-miR-16-2-3p TMEM68 transmembrane protein 68 HGNC:26510 details
hsa-miR-16-2-3p CDK2AP1 cyclin dependent kinase 2 associated protein 1 HGNC:14002 details
hsa-miR-16-2-3p RHNO1 RAD9-HUS1-RAD1 interacting nuclear orphan 1 HGNC:28206 details
hsa-miR-16-2-3p ZNF585A zinc finger protein 585A HGNC:26305 details
hsa-miR-16-2-3p CMTM6 CKLF like MARVEL transmembrane domain containing 6 HGNC:19177 details
© 2021 Arieh Warshel Institute of Computational Biology, CUHK(SZ) | Designed by : Biomics Lab