miRNA Card

miRNA General Information
miRNA ID hsa-miR-16-5p
Description Homo sapiens miR-16-1 stem-loop
Comment Human miR-16 has been cloned by independent groups [1,2]. This precursor sequence maps to chromosome 13, and was named mir-16 in [1] and mir-16-precursor-13 in [2]. Lim et al. reported 2 identical chromosome 13 loci, which appear to map to the same locus in subsequent genome assemblies. This gene and miR-15a are clustered within 0.5 kb at 13q14. This region has been shown to be deleted in more than half of B cell chronic lymphocytic leukemias (CLL). Both miR-15a and miR-16 are deleted or down-regulated in more than two thirds of CLL cases [3]. A second putative mir-16 hairpin precursor is located on chromosome 3 (MIR:MI0000738).
Experiment cloned [1,5,7-9], Northern [1,6]
Sequence UAGCAGCACGUAAAUAUUGGCG
miRNA Expression in different cancers

    by mir_boxplot.py

circRNA-miRNA-gene regulatory network

Note about Netwrok:
This is a network diagram with miRNA (purple circle) as the center.
We used three tools(PITA, miRanda, targetScan) to predict the binding sites of circrna (green circle) and miRNA. Accordingly, for this miRNA that binds to circrna, we have three confidence levels, namely confident 1, confident 2 and confident 3. Confidence value indicates how many tools can deduce these results. For each confidence, we use different kinds of dashed lines.

Target circRNA with confidence

Confidence 3 (3 of 3 tools predicted)

Confidence 1 (1 of 3 tools predicted)

CircID miRNA PITA miRanda targetScan
chr5:147393254|147393370 hsa-miR-16-5p 1 0 0
chr16:23683917|23684079 hsa-miR-16-5p 1 0 0
chr1:207887181|207887433 hsa-miR-16-5p 1 0 0
chr1:22530090|22530272 hsa-miR-16-5p 0 1 0
chr13:99547012|99547086 hsa-miR-16-5p 0 1 0
chr19:54174189|54174373 hsa-miR-16-5p 0 1 0
chr10:99613501|99613723 hsa-miR-16-5p 0 1 0
chr19:41771178|41771292 hsa-miR-16-5p 0 1 0
chrX:71140780|71140857 hsa-miR-16-5p 0 1 0
chrX:71140747|71140857 hsa-miR-16-5p 0 1 0
chr2:216660581|216660727 hsa-miR-16-5p 0 1 0
chr2:88857353|88857507 hsa-miR-16-5p 0 1 0
chr12:6553076|6553229 hsa-miR-16-5p 0 1 0
chrX:141176334|141176467 hsa-miR-16-5p 0 1 0
chr7:114629871|114630005 hsa-miR-16-5p 0 1 0
chr21:46346845|46346970 hsa-miR-16-5p 0 1 0
chr1:201484246|201484348 hsa-miR-16-5p 0 1 0
chr16:4885667|4885810 hsa-miR-16-5p 0 1 0
chr2:88857368|88857525 hsa-miR-16-5p 0 1 0
chr15:40290770|40291071 hsa-miR-16-5p 0 1 0
chr14:104803202|104803407 hsa-miR-16-5p 0 1 0
chr5:146261648|146261795 hsa-miR-16-5p 0 1 0
chr12:754120|754324 hsa-miR-16-5p 0 1 0
chr3:49725068|49725286 hsa-miR-16-5p 0 1 0
chr19:54193180|54193293 hsa-miR-16-5p 0 1 0
chr19:54193233|54193334 hsa-miR-16-5p 0 1 0
chr1:1785379|1785639 hsa-miR-16-5p 0 1 0
chr19:54174158|54174373 hsa-miR-16-5p 0 1 0
chr16:11679315|11679637 hsa-miR-16-5p 0 1 0
chr17:1658253|1658603 hsa-miR-16-5p 0 1 0
chr21:42849198|42849382 hsa-miR-16-5p 0 1 0
chr10:37306241|37306397 hsa-miR-16-5p 0 1 0
chr15:39582471|39582680 hsa-miR-16-5p 0 1 0
chr19:15110234|15110579 hsa-miR-16-5p 0 1 0
chr7:6402864|6403162 hsa-miR-16-5p 0 1 0
chr10:72368076|72368173 hsa-miR-16-5p 0 1 0
chr11:73234204|73234381 hsa-miR-16-5p 0 1 0
chr22:41356441|41356734 hsa-miR-16-5p 0 1 0
chr2:218747162|218747372 hsa-miR-16-5p 0 1 0
chr2:88857368|88857576 hsa-miR-16-5p 0 1 0
chrX:71140741|71140857 hsa-miR-16-5p 0 1 0
chr17:50189424|50190092 hsa-miR-16-5p 0 1 0
chr14:81203925|81204002 hsa-miR-16-5p 0 1 0
chr22:31104944|31105282 hsa-miR-16-5p 0 1 0
chr14:37591455|37591615 hsa-miR-16-5p 0 1 0
chr8:30069734|30069900 hsa-miR-16-5p 0 1 0
chr13:50841138|50841354 hsa-miR-16-5p 0 1 0
chr7:16804953|16805121 hsa-miR-16-5p 0 1 0
chr12:122355187|122360983 hsa-miR-16-5p 0 1 0
chr1:29115699|29115803 hsa-miR-16-5p 0 1 0
chr15:48463111|48463196 hsa-miR-16-5p 0 1 0
chr6:42979052|42979218 hsa-miR-16-5p 0 1 0
chr15:65058427|65058555 hsa-miR-16-5p 0 1 0
chr5:817258|817438 hsa-miR-16-5p 0 1 0
chr11:47476783|47476956 hsa-miR-16-5p 0 1 0
chr1:19694446|19694553 hsa-miR-16-5p 0 1 0
chr7:98957995|98959382 hsa-miR-16-5p 0 1 0
chr18:51196826|51196951 hsa-miR-16-5p 0 1 0
chr6:34245856|34246050 hsa-miR-16-5p 0 1 0
chr20:354217|354505 hsa-miR-16-5p 0 1 0
chr22:37180843|37181225 hsa-miR-16-5p 0 1 0
chr3:120394994|120395137 hsa-miR-16-5p 0 1 0
chr14:20458063|20458174 hsa-miR-16-5p 0 1 0
chr1:11922861|11923121 hsa-miR-16-5p 1 0 0
chr4:113531265|113537410 hsa-miR-16-5p 1 0 0
chr22:36282538|36282712 hsa-miR-16-5p 1 0 0
chr20:21328594|21328670 hsa-miR-16-5p 1 0 0
chr16:88738314|88738665 hsa-miR-16-5p 1 0 0
chr7:2362645|2362764 hsa-miR-16-5p 0 1 0
chr1:151051814|151051987 hsa-miR-16-5p 0 1 0
chr12:69271617|69271772 hsa-miR-16-5p 0 1 0
chr12:14881967|14882149 hsa-miR-16-5p 0 1 0
chr10:97381431|97381769 hsa-miR-16-5p 0 1 0
chr6:7584921|7585033 hsa-miR-16-5p 0 1 0
chr2:189002329|189003755 hsa-miR-16-5p 0 1 0
chr3:120394923|120395137 hsa-miR-16-5p 0 1 0
chrX:153351917|153352109 hsa-miR-16-5p 0 1 0
chr14:39181440|39181656 hsa-miR-16-5p 0 1 0
chr20:32237446|32237784 hsa-miR-16-5p 0 1 0
chr12:64870656|64870794 hsa-miR-16-5p 0 1 0
chr15:24962160|24968029 hsa-miR-16-5p 0 1 0
chr6:122725215|122725393 hsa-miR-16-5p 0 1 0
chr17:1658253|1658576 hsa-miR-16-5p 0 1 0
chr2:89142677|89142836 hsa-miR-16-5p 0 1 0
chr6:143511525|143511697 hsa-miR-16-5p 0 1 0
chr5:140567515|140567670 hsa-miR-16-5p 0 1 0
chr17:82084834|82085069 hsa-miR-16-5p 0 1 0
chr16:67879715|67879971 hsa-miR-16-5p 0 1 0
chr6:30888737|30888962 hsa-miR-16-5p 0 1 0
chr1:34785916|34786083 hsa-miR-16-5p 0 1 0
chr22:32861174|32861241 hsa-miR-16-5p 0 1 0
chr14:39181503|39181656 hsa-miR-16-5p 0 1 0
chr16:11679506|11679659 hsa-miR-16-5p 0 1 0
chr19:54460264|54460408 hsa-miR-16-5p 0 1 0
chr4:2933650|2933818 hsa-miR-16-5p 0 1 0
chr1:23086709|23086819 hsa-miR-16-5p 0 1 0
chr15:56094119|56094304 hsa-miR-16-5p 0 1 0
chr9:133362688|133362828 hsa-miR-16-5p 0 1 0
chr17:4672992|4673308 hsa-miR-16-5p 0 1 0
chr1:7844654|7844791 hsa-miR-16-5p 0 1 0
chrX:23785697|23785770 hsa-miR-16-5p 0 1 0
chr16:4885667|4885792 hsa-miR-16-5p 0 1 0
chr12:46186359|46186495 hsa-miR-16-5p 0 1 0
chr16:4885667|4885813 hsa-miR-16-5p 0 1 0
chr6:33316205|33316386 hsa-miR-16-5p 0 1 0
chr8:21998755|21999116 hsa-miR-16-5p 0 1 0
chr17:2689591|2689769 hsa-miR-16-5p 0 1 0
chr2:85322528|85322734 hsa-miR-16-5p 0 1 0
chr12:50222259|50222452 hsa-miR-16-5p 0 1 0
chr8:119841811|119841948 hsa-miR-16-5p 0 1 0
chr1:22530083|22530289 hsa-miR-16-5p 0 1 0
chr12:14881967|14882160 hsa-miR-16-5p 0 1 0
chr8:54143690|54143938 hsa-miR-16-5p 0 1 0
chr7:20404653|20404759 hsa-miR-16-5p 0 1 0
chr16:28101573|28101868 hsa-miR-16-5p 0 1 0
chr8:144317052|144317252 hsa-miR-16-5p 0 1 0
chr6:78961351|78961523 hsa-miR-16-5p 0 1 0
chr11:11432661|11432777 hsa-miR-16-5p 0 1 0
chr1:230838743|230838862 hsa-miR-16-5p 0 1 0
chrX:66032468|66032618 hsa-miR-16-5p 0 1 0
chr10:103599524|103599655 hsa-miR-16-5p 0 1 0
chr8:38848525|38848637 hsa-miR-16-5p 0 1 0
chr4:124670837|124670968 hsa-miR-16-5p 0 1 0
chr12:14774693|14774903 hsa-miR-16-5p 0 1 0
chr19:54460247|54460408 hsa-miR-16-5p 0 1 0
chr1:22530086|22530219 hsa-miR-16-5p 0 1 0
chr1:201484285|201484466 hsa-miR-16-5p 0 1 0
chr16:3026368|3026566 hsa-miR-16-5p 0 1 0
chr11:62677927|62678093 hsa-miR-16-5p 0 1 0
chr1:184702848|184702985 hsa-miR-16-5p 0 1 0
chr2:207165467|207165643 hsa-miR-16-5p 0 1 0
chr9:35698080|35698340 hsa-miR-16-5p 0 1 0
chr9:35707451|35707769 hsa-miR-16-5p 0 1 0
chr15:24967932|24968032 hsa-miR-16-5p 0 1 0
chr9:136116517|136116657 hsa-miR-16-5p 0 1 0
chr5:168464819|168464950 hsa-miR-16-5p 0 1 0
chr17:50737315|50737432 hsa-miR-16-5p 0 1 0
chr3:15440578|15440861 hsa-miR-16-5p 0 1 0
chr1:84284902|84285046 hsa-miR-16-5p 0 1 0
chr13:84905745|84905899 hsa-miR-16-5p 0 1 0
chr17:1658253|1658621 hsa-miR-16-5p 0 1 0
chr2:27221218|27221347 hsa-miR-16-5p 0 1 0
chr22:50290261|50290362 hsa-miR-16-5p 0 1 0
chr15:98707704|98707911 hsa-miR-16-5p 0 1 0
chr5:139389779|139389888 hsa-miR-16-5p 0 1 0
chr6:116689320|116692392 hsa-miR-16-5p 0 1 0
chrX:71140777|71140857 hsa-miR-16-5p 0 1 0
chr7:20404679|20404772 hsa-miR-16-5p 0 1 0
chrX:54444897|54444985 hsa-miR-16-5p 0 1 0
chr1:22647420|22647617 hsa-miR-16-5p 0 1 0
chr16:28099069|28099203 hsa-miR-16-5p 0 1 0
chr19:54460276|54460553 hsa-miR-16-5p 0 1 0
chr10:100987978|100988229 hsa-miR-16-5p 0 1 0
chr8:109594072|109594216 hsa-miR-16-5p 0 1 0
chr12:53711365|53711481 hsa-miR-16-5p 0 1 0
chr1:109313858|109314004 hsa-miR-16-5p 0 1 0
chr1:225847067|225848525 hsa-miR-16-5p 0 1 0
chr3:49725068|49725162 hsa-miR-16-5p 0 1 0
chr22:36284098|36284488 hsa-miR-16-5p 0 1 0
chr19:30012283|30012445 hsa-miR-16-5p 0 1 0
chr17:50737302|50737430 hsa-miR-16-5p 0 1 0
chr5:146261595|146261806 hsa-miR-16-5p 0 1 0
chr17:58346070|58346245 hsa-miR-16-5p 0 1 0
chr12:754139|754277 hsa-miR-16-5p 0 1 0
chrX:30855196|30855291 hsa-miR-16-5p 0 1 0
chr5:139389779|139389897 hsa-miR-16-5p 0 1 0
chr7:5529197|5529293 hsa-miR-16-5p 0 1 0
chr2:88857333|88857525 hsa-miR-16-5p 0 1 0
chr15:40036255~40036428 hsa-miR-16-5p 0 1 0
chr17:3957044|3957141 hsa-miR-16-5p 0 1 0
chr11:34100298~34100466 hsa-miR-16-5p 0 1 0
chr13:99547012~99547086 hsa-miR-16-5p 0 1 0
chr14:39181398~39181656 hsa-miR-16-5p 0 1 0
chr1:226965318~226965697 hsa-miR-16-5p 0 1 0
chr2:88857368~88857507 hsa-miR-16-5p 0 1 0
chr2:223054152~223054248 hsa-miR-16-5p 0 1 0
chrX:71140747~71140857 hsa-miR-16-5p 0 1 0
chr9:35707404~35707769 hsa-miR-16-5p 0 1 0
chr17:1658253~1658591 hsa-miR-16-5p 0 1 0
chr20:17633475~17633609 hsa-miR-16-5p 0 1 0
chr10:97381414~97381769 hsa-miR-16-5p 0 1 0
chr1:170546835~170547011 hsa-miR-16-5p 0 1 0
chr4:173322333~173322482 hsa-miR-16-5p 0 1 0
chr12:95658403~95658516 hsa-miR-16-5p 0 1 0
chr16:1809357~1809833 hsa-miR-16-5p 0 1 0
chr9:129177826~129177956 hsa-miR-16-5p 0 1 0
chr8:95154466~95154546 hsa-miR-16-5p 0 1 0
chr12:117144499~117144597 hsa-miR-16-5p 0 1 0
chr1:26779683~26779841 hsa-miR-16-5p 0 1 0
chr7:73573938~73574114 hsa-miR-16-5p 0 1 0
chr17:82060883~82061276 hsa-miR-16-5p 0 1 0
chr1:243496648~243496821 hsa-miR-16-5p 0 1 0
chr15:47772494~47772653 hsa-miR-16-5p 0 1 0
chr19:49915275~49915440 hsa-miR-16-5p 0 1 0
chr5:314417~314596 hsa-miR-16-5p 0 1 0
chr15:90228214~90228366 hsa-miR-16-5p 0 1 0
chr13:113087412~113087799 hsa-miR-16-5p 0 1 0
chr15:72375763~72375967 hsa-miR-16-5p 0 1 0
chr16:23571206~23571306 hsa-miR-16-5p 0 1 0
chr2:195736502~195736746 hsa-miR-16-5p 0 1 0
chr11:73234204~73234350 hsa-miR-16-5p 0 1 0
chr11:65884639~65885118 hsa-miR-16-5p 0 1 0
chr19:39389362~39389700 hsa-miR-16-5p 0 1 0
chr22:46292954~46293137 hsa-miR-16-5p 0 1 0
chr17:82085663~82085831 hsa-miR-16-5p 0 1 0
chr3:40462015~40462119 hsa-miR-16-5p 0 1 0
chr12:15903030~15903176 hsa-miR-16-5p 0 1 0
chr1:182586119~182586268 hsa-miR-16-5p 0 1 0
chr3:123913792~123913885 hsa-miR-16-5p 0 1 0
chr10:6269461~6269608 hsa-miR-16-5p 0 1 0
chr13:51760076~51760283 hsa-miR-16-5p 0 1 0
chr16:67879721~67879971 hsa-miR-16-5p 0 1 0
chrX:71140741~71140857 hsa-miR-16-5p 0 1 0
chr2:33365378~33365481 hsa-miR-16-5p 0 1 0
chr2:88857368~88857498 hsa-miR-16-5p 0 1 0
chrX:71140756~71140857 hsa-miR-16-5p 0 1 0
chr10:32268963~32269071 hsa-miR-16-5p 0 1 0
chr22:36476733~36476856 hsa-miR-16-5p 0 1 0
chr22:41356441~41356734 hsa-miR-16-5p 0 1 0
chr10:72368076~72368173 hsa-miR-16-5p 0 1 0
chr11:33743571~33743779 hsa-miR-16-5p 0 1 0
chr16:4885667~4885849 hsa-miR-16-5p 0 1 0
chr6:33319728~33320110 hsa-miR-16-5p 0 1 0
chr7:143390799~143391049 hsa-miR-16-5p 0 1 0
chr14:105854623~105854723 hsa-miR-16-5p 0 1 0
chr11:47282588~47282942 hsa-miR-16-5p 0 1 0
chr1:37815975~37816105 hsa-miR-16-5p 0 1 0
chr14:105854679~105854956 hsa-miR-16-5p 0 1 0
chr9:124880248~124880366 hsa-miR-16-5p 0 1 0
chr10:127061749~127106301 hsa-miR-16-5p 0 1 0
chr18:47155288~47155364 hsa-miR-16-5p 0 1 0
chr14:37591455~37591615 hsa-miR-16-5p 0 1 0
chr3:10126299~10126435 hsa-miR-16-5p 0 1 0
chr7:44111895~44112188 hsa-miR-16-5p 0 1 0
chr16:88738314~88738665 hsa-miR-16-5p 0 1 0
chrX:71140780~71140857 hsa-miR-16-5p 0 1 0
chr15:88871420~88871529 hsa-miR-16-5p 0 1 0
chr22:41356409~41356808 hsa-miR-16-5p 0 1 0
chr12:55832800~55832929 hsa-miR-16-5p 0 1 0
chr17:50199556~50199849 hsa-miR-16-5p 0 1 0
chr12:14881967~14882149 hsa-miR-16-5p 0 1 0
chr9:5774254~5774504 hsa-miR-16-5p 0 1 0
chr12:14881951~14882131 hsa-miR-16-5p 0 1 0
chr14:65627254~65627354 hsa-miR-16-5p 0 1 0
chr6:42012329|42012523 hsa-miR-16-5p 1 0 0
chr1:44636099|44636331 hsa-miR-16-5p 1 0 0
chr16:10906579|10906689 hsa-miR-16-5p 0 1 0
chr18:49205805|49205986 hsa-miR-16-5p 0 1 0
chr12:6529959|6530076 hsa-miR-16-5p 0 1 0
chr5:142797860|142797975 hsa-miR-16-5p 0 1 0
chr19:10751285|10751368 hsa-miR-16-5p 0 1 0
chr12:131796703|131796813 hsa-miR-16-5p 0 1 0
chr7:5529125|5529257 hsa-miR-16-5p 0 1 0
chr17:44350752|44351151 hsa-miR-16-5p 0 1 0
chr5:138465928|138466068 hsa-miR-16-5p 0 1 0
chr7:127994297|127994485 hsa-miR-16-5p 0 1 0
chr17:7063823|7064014 hsa-miR-16-5p 0 1 0
chr6:41053366|41053695 hsa-miR-16-5p 0 1 0
chr16:58534147|58534351 hsa-miR-16-5p 0 1 0
chrX:71140786|71140857 hsa-miR-16-5p 0 1 0
chr14:22909483|22911403 hsa-miR-16-5p 0 1 0
chr6:73486995|73487177 hsa-miR-16-5p 0 1 0
chr7:44058156|44058480 hsa-miR-16-5p 0 1 0
chr6:104763607|104763759 hsa-miR-16-5p 0 1 0
chr10:113072764|113072885 hsa-miR-16-5p 0 1 0
chr2:171482094|171482312 hsa-miR-16-5p 0 1 0
chr11:10797404|10797503 hsa-miR-16-5p 0 1 0
chr11:3825461|3825666 hsa-miR-16-5p 0 1 0
chr21:46346821|46346981 hsa-miR-16-5p 0 1 0
chr2:167160342|167160527 hsa-miR-16-5p 0 1 0
chr11:300070|300282 hsa-miR-16-5p 0 1 0
chr1:150577287|150577458 hsa-miR-16-5p 0 1 0
chr9:132235411|132235578 hsa-miR-16-5p 0 1 0
chr19:1621940|1622176 hsa-miR-16-5p 0 1 0
chr22:42383670|42383810 hsa-miR-16-5p 0 1 0
chr9:242740|242806 hsa-miR-16-5p 0 1 0
chr10:79195768|79195960 hsa-miR-16-5p 0 1 0
chr2:20283445|20290790 hsa-miR-16-5p 0 1 0
chr10:128070061|128070180 hsa-miR-16-5p 0 1 0
chr17:7849685|7849857 hsa-miR-16-5p 0 1 0
chr5:142797860|142797963 hsa-miR-16-5p 0 1 0
chr2:88857368|88857558 hsa-miR-16-5p 0 1 0
chr17:40167985|40168097 hsa-miR-16-5p 0 1 0
chr20:34075457|34075594 hsa-miR-16-5p 0 1 0
chr11:9396165|9396331 hsa-miR-16-5p 0 1 0
chr20:63862302|63862530 hsa-miR-16-5p 0 1 0
chr4:82834246|82834464 hsa-miR-16-5p 0 1 0
chr6:139167731|139167902 hsa-miR-16-5p 0 1 0
chr2:208331784|208332038 hsa-miR-16-5p 0 1 0
chr17:44350496|44351435 hsa-miR-16-5p 0 1 0
chr16:88726757|88726918 hsa-miR-16-5p 0 1 0
chr12:55772138|55772275 hsa-miR-16-5p 0 1 0
chr20:31605478|31605660 hsa-miR-16-5p 0 1 0
chr19:35735256|35735489 hsa-miR-16-5p 0 1 0
chrX:71140744|71140857 hsa-miR-16-5p 0 1 0
chr22:50730148|50730338 hsa-miR-16-5p 0 1 0
chr17:75266006|75266192 hsa-miR-16-5p 0 1 0
chr17:63706635|63706885 hsa-miR-16-5p 0 1 0
chr18:56618004|56624454 hsa-miR-16-5p 0 1 0
chr6:34245848|34246177 hsa-miR-16-5p 0 1 0
chr8:30069848|30069959 hsa-miR-16-5p 0 1 0
chr6:41587024|41587156 hsa-miR-16-5p 0 1 0
chr17:80340038|80340208 hsa-miR-16-5p 0 1 0
chr15:77483121|77483211 hsa-miR-16-5p 0 1 0
chr19:19502192|19502295 hsa-miR-16-5p 0 1 0
chr9:136501788|136502036 hsa-miR-16-5p 0 1 0
chr17:58270864|58270972 hsa-miR-16-5p 0 1 0
chr19:2290074|2290166 hsa-miR-16-5p 0 1 0
chr18:26019002|26019195 hsa-miR-16-5p 0 1 0
chr5:138023184|138023377 hsa-miR-16-5p 0 1 0
chr11:67441438|67441833 hsa-miR-16-5p 0 1 0
chr8:21913539|21913652 hsa-miR-16-5p 0 1 0
chr1:110339544|110339724 hsa-miR-16-5p 0 1 0
chr9:99915201|99915362 hsa-miR-16-5p 0 1 0
chr22:24091688|24091765 hsa-miR-16-5p 0 1 0
chr1:207887213|207887420 hsa-miR-16-5p 1 0 0
chr1:6221674|6221747 hsa-miR-16-5p 1 0 0
chr4:186134944|186135109 hsa-miR-16-5p 0 1 0
chr19:6415036|6415398 hsa-miR-16-5p 0 1 0
chr19:41771176|41771290 hsa-miR-16-5p 0 1 0
chr2:85591725|85591814 hsa-miR-16-5p 0 1 0
chr1:21597238|21597986 hsa-miR-16-5p 0 1 0
chr17:78124539|78124653 hsa-miR-16-5p 0 1 0
chr11:62677939|62678084 hsa-miR-16-5p 0 1 0
chr15:72375773|72375981 hsa-miR-16-5p 0 1 0
chr2:20290652|20290774 hsa-miR-16-5p 0 1 0
chr19:50280037|50280141 hsa-miR-16-5p 0 1 0
chr2:216660673|216661884 hsa-miR-16-5p 0 1 0
chr12:124324557|124324668 hsa-miR-16-5p 0 1 0
chr19:55679712|55679887 hsa-miR-16-5p 0 1 0
chr2:88857436|88857576 hsa-miR-16-5p 0 1 0
chr22:29057180|29057300 hsa-miR-16-5p 0 1 0
chr16:11679315|11679657 hsa-miR-16-5p 0 1 0
chr16:4885628|4885777 hsa-miR-16-5p 0 1 0
chr1:11960646|11960729 hsa-miR-16-5p 0 1 0
chr2:88857368|88857498 hsa-miR-16-5p 0 1 0
chr1:22530134|22530272 hsa-miR-16-5p 0 1 0
chr2:88857353|88857498 hsa-miR-16-5p 0 1 0
chrX:20015298|20016156 hsa-miR-16-5p 0 1 0
chr4:75804157|75805160 hsa-miR-16-5p 0 1 0
chr16:764689|764976 hsa-miR-16-5p 0 1 0
chr7:150742725|150742870 hsa-miR-16-5p 0 1 0
chr19:14405771|14405875 hsa-miR-16-5p 0 1 0
chr11:46672330|46672434 hsa-miR-16-5p 0 1 0
chr17:75889448|75889676 hsa-miR-16-5p 0 1 0
chr12:47751472|47751770 hsa-miR-16-5p 0 1 0
chr17:1658253|1658591 hsa-miR-16-5p 0 1 0
chr8:23483108|23483240 hsa-miR-16-5p 0 1 0
chr20:3929513|3929665 hsa-miR-16-5p 0 1 0
chr12:49033227|49033454 hsa-miR-16-5p 0 1 0
chr7:44111895|44112188 hsa-miR-16-5p 0 1 0
chr14:101628881|101629249 hsa-miR-16-5p 0 1 0
chr7:5529197|5529289 hsa-miR-16-5p 0 1 0
chr12:8047882|8048005 hsa-miR-16-5p 0 1 0
chr7:44058198|44058480 hsa-miR-16-5p 0 1 0
chr14:39181337|39181656 hsa-miR-16-5p 0 1 0
chr2:88857368|88857502 hsa-miR-16-5p 0 1 0
chr9:134158534|134158769 hsa-miR-16-5p 0 1 0
chr16:29968071|29968242 hsa-miR-16-5p 0 1 0
chr1:156726906|156727084 hsa-miR-16-5p 0 1 0
chr12:119686387|119686608 hsa-miR-16-5p 0 1 0
chr1:160876592|160876800 hsa-miR-16-5p 0 1 0
chr8:20220724|20221106 hsa-miR-16-5p 0 1 0
chr4:2591184|2591294 hsa-miR-16-5p 0 1 0
chr16:4885667|4885849 hsa-miR-16-5p 0 1 0
chr9:122148142|122148277 hsa-miR-16-5p 0 1 0
chr16:67879826|67879971 hsa-miR-16-5p 0 1 0
chr9:113597088|113597316 hsa-miR-16-5p 0 1 0
chr11:62677927|62678090 hsa-miR-16-5p 0 1 0
chr7:149180193|149180341 hsa-miR-16-5p 0 1 0
chr11:85664164|85664381 hsa-miR-16-5p 0 1 0
chr5:140567467|140567670 hsa-miR-16-5p 0 1 0
chr2:88857368|88857522 hsa-miR-16-5p 0 1 0
chrX:40072668|40072858 hsa-miR-16-5p 0 1 0
chr1:236806144|236816543 hsa-miR-16-5p 0 1 0
chr22:42160432|42160564 hsa-miR-16-5p 0 1 0
chr10:110119308|110119520 hsa-miR-16-5p 0 1 0
chr11:61403932|61404225 hsa-miR-16-5p 0 1 0
chr19:35721743|35722385 hsa-miR-16-5p 0 1 0
chr11:3825504|3825666 hsa-miR-16-5p 0 1 0
chr14:39181500|39181656 hsa-miR-16-5p 0 1 0
chr8:133238842|133238965 hsa-miR-16-5p 0 1 0
chr17:69135659|69135821 hsa-miR-16-5p 0 1 0
chr22:41436437|41436511 hsa-miR-16-5p 0 1 0
chr17:76084027|76084280 hsa-miR-16-5p 0 1 0
chr16:74606776|74606974 hsa-miR-16-5p 0 1 0
chr16:90043995|90044144 hsa-miR-16-5p 0 1 0
chr19:7535741|7535971 hsa-miR-16-5p 0 1 0
chr1:94897897|94898067 hsa-miR-16-5p 0 1 0
chr2:88857366|88857576 hsa-miR-16-5p 0 1 0
chr14:75176361|75176593 hsa-miR-16-5p 0 1 0
chr7:150692520|150692681 hsa-miR-16-5p 0 1 0
chr13:110512211|110512372 hsa-miR-16-5p 0 1 0
chr2:85322528|85322702 hsa-miR-16-5p 0 1 0
chr1:245687359|245687538 hsa-miR-16-5p 0 1 0
chr15:89477566|89477943 hsa-miR-16-5p 0 1 0
chr4:73118831|73120289 hsa-miR-16-5p 0 1 0
chr2:88857368|88857578 hsa-miR-16-5p 0 1 0
chr2:175114748|175114861 hsa-miR-16-5p 0 1 0
chr17:1658253|1658645 hsa-miR-16-5p 0 1 0
chr7:44213695|44213886 hsa-miR-16-5p 0 1 0
chr2:216660694|216661884 hsa-miR-16-5p 0 1 0
chr1:156210939|156211075 hsa-miR-16-5p 0 1 0
chr16:4885667|4885846 hsa-miR-16-5p 0 1 0
chr16:4885487|4885834 hsa-miR-16-5p 0 1 0
chr7:1542819|1542945 hsa-miR-16-5p 0 1 0
chr5:314417|314601 hsa-miR-16-5p 0 1 0
chr20:17633475|17633609 hsa-miR-16-5p 0 1 0
chr2:88857366|88857510 hsa-miR-16-5p 0 1 0
chr17:29073568|29073753 hsa-miR-16-5p 0 1 0
chr11:66643827|66644064 hsa-miR-16-5p 0 1 0
chr7:1542819|1542969 hsa-miR-16-5p 0 1 0
chr22:41356409|41356734 hsa-miR-16-5p 0 1 0
chr19:41902321|41902635 hsa-miR-16-5p 0 1 0
chr11:57303266|57303392 hsa-miR-16-5p 0 1 0
chr1:26942721|26942948 hsa-miR-16-5p 0 1 0
chr11:72110571|72111281 hsa-miR-16-5p 0 1 0
chr1:155675010|155679512 hsa-miR-16-5p 0 1 0
chr15:51552011|51552206 hsa-miR-16-5p 0 1 0
chr22:26457859|26458577 hsa-miR-16-5p 0 1 0
chr9:33986760|34017189 hsa-miR-16-5p 0 1 0
chr14:22906195|22909595 hsa-miR-16-5p 0 1 0
chr3:49992778|49992847 hsa-miR-16-5p 0 1 0
chr5:37114960|37120340 hsa-miR-16-5p 0 1 0
chr1:41070595|41075451 hsa-miR-16-5p 0 1 0
chr3:119825949|119826159 hsa-miR-16-5p 0 1 0
chr17:68126477|68126635 hsa-miR-16-5p 0 1 0
chr6:31968717|31969023 hsa-miR-16-5p 0 1 0
chr6:138417600|138417764 hsa-miR-16-5p 0 1 0
chr8:61714269|61714362 hsa-miR-16-5p 0 1 0
chr6:85450241|85450407 hsa-miR-16-5p 0 1 0
chrX:71140756|71140857 hsa-miR-16-5p 0 1 0
chr19:13968590|13968824 hsa-miR-16-5p 0 1 0
chr16:2936271|2936396 hsa-miR-16-5p 0 1 0
chr2:88857421|88857525 hsa-miR-16-5p 0 1 0
chr16:1809238|1809833 hsa-miR-16-5p 0 1 0
chr11:119126935|119127125 hsa-miR-16-5p 0 1 0
chr7:105665066|105665288 hsa-miR-16-5p 0 1 0
chr15:78922572|78922739 hsa-miR-16-5p 0 1 0
chr17:1656735|1658541 hsa-miR-16-5p 0 1 0
chr10:126970702|127110354 hsa-miR-16-5p 0 1 0
chr19:14405771|14405885 hsa-miR-16-5p 0 1 0
chr1:33281786|33295015 hsa-miR-16-5p 0 1 0
chr16:4885667|4885876 hsa-miR-16-5p 0 1 0
chr19:53183570|53183663 hsa-miR-16-5p 0 1 0
chr5:140567515|140567630 hsa-miR-16-5p 0 1 0
chr11:62677927|62678096 hsa-miR-16-5p 0 1 0
chr16:23667572|23667734 hsa-miR-16-5p 0 1 0
chr3:50337173|50337344 hsa-miR-16-5p 0 1 0
chr11:62677939|62678073 hsa-miR-16-5p 0 1 0
chr20:11918392|11918480 hsa-miR-16-5p 0 1 0
chr2:88857368|88857512 hsa-miR-16-5p 0 1 0
chr12:132045426|132045560 hsa-miR-16-5p 0 1 0
chr13:44301701|44301857 hsa-miR-16-5p 0 1 0
chr10:122087163|122087386 hsa-miR-16-5p 0 1 0
chr1:32365477|32365565 hsa-miR-16-5p 0 1 0
chr17:44088387|44088527 hsa-miR-16-5p 0 1 0
chr9:35698077|35698358 hsa-miR-16-5p 0 1 0
chr17:28721700|28721860 hsa-miR-16-5p 0 1 0
chr16:57428964|57429150 hsa-miR-16-5p 0 1 0
chr17:81106763|81106907 hsa-miR-16-5p 0 1 0
chr22:24186285|24186408 hsa-miR-16-5p 0 1 0
chr11:64258885|64259103 hsa-miR-16-5p 0 1 0
chr1:19110406|19110798 hsa-miR-16-5p 0 1 0
chr22:50290261|50290359 hsa-miR-16-5p 0 1 0
chr2:203428043|203428176 hsa-miR-16-5p 0 1 0
chr3:49725068|49725187 hsa-miR-16-5p 0 1 0
chr17:76011576|76011662 hsa-miR-16-5p 0 1 0
chrX:65512743|65512901 hsa-miR-16-5p 0 1 0
chr12:15903069|15903207 hsa-miR-16-5p 0 1 0
chr16:67879727|67879971 hsa-miR-16-5p 0 1 0
chr16:4885667|4885853 hsa-miR-16-5p 0 1 0
chr3:15653120|15653243 hsa-miR-16-5p 0 1 0
chrX:20015298|20016177 hsa-miR-16-5p 0 1 0
chr4:73091870|73092023 hsa-miR-16-5p 0 1 0
chr15:40036193|40036349 hsa-miR-16-5p 0 1 0
chr16:4882606|4882758 hsa-miR-16-5p 0 1 0
chr11:73234229|73234342 hsa-miR-16-5p 0 1 0
chr9:16419287|16419493 hsa-miR-16-5p 0 1 0
chr17:75521516|75521729 hsa-miR-16-5p 0 1 0
chr11:75566745|75566922 hsa-miR-16-5p 0 1 0
chr1:28466623|28466741 hsa-miR-16-5p 0 1 0
chr1:157122419|157122572 hsa-miR-16-5p 0 1 0
chr17:28749491|28749742 hsa-miR-16-5p 0 1 0
chr1:161119572|161119899 hsa-miR-16-5p 0 1 0
chr22:46292954|46293137 hsa-miR-16-5p 0 1 0
chr10:72887259|72887425 hsa-miR-16-5p 0 1 0
chr7:100156933|100157136 hsa-miR-16-5p 0 1 0
chr1:150811126|150811387 hsa-miR-16-5p 0 1 0
chr1:1014130|1014423 hsa-miR-16-5p 0 1 0
chr11:74001207|74001371 hsa-miR-16-5p 0 1 0
chr7:23199391|23199542 hsa-miR-16-5p 0 1 0
chr19:41771081|41771341 hsa-miR-16-5p 0 1 0
chr18:50285876|50286045 hsa-miR-16-5p 0 1 0
chr2:210612144|210612293 hsa-miR-16-5p 0 1 0
chr3:49360085|49360205 hsa-miR-16-5p 0 1 0
chr18:48817221|48817376 hsa-miR-16-5p 0 1 0
chr11:85664281|85664442 hsa-miR-16-5p 0 1 0
chr9:128523620|128523846 hsa-miR-16-5p 0 1 0
chr20:43692164|43692289 hsa-miR-16-5p 0 1 0
chr15:101330220|101330310 hsa-miR-16-5p 0 1 0
chr16:88876711|88876933 hsa-miR-16-5p 0 1 0
chr19:44683575|44683677 hsa-miR-16-5p 0 1 0
chr14:22946704|22946829 hsa-miR-16-5p 0 1 0
chr14:106737376|106737607 hsa-miR-16-5p 0 1 0
chr14:75954731|75954834 hsa-miR-16-5p 0 1 0
chr11:62677927|62678084 hsa-miR-16-5p 0 1 0
chr11:62677927|62678073 hsa-miR-16-5p 0 1 0
chr13:113098082|113098197 hsa-miR-16-5p 0 1 0
chr3:45678710|45678965 hsa-miR-16-5p 0 1 0
chr1:154583125|154583338 hsa-miR-16-5p 0 1 0
chr16:4895314|4895629 hsa-miR-16-5p 0 1 0
chr14:37591400|37591615 hsa-miR-16-5p 0 1 0
chr11:61801595|61801803 hsa-miR-16-5p 0 1 0
chr14:105392986|105393356 hsa-miR-16-5p 0 1 0
chr16:4885667|4885903 hsa-miR-16-5p 0 1 0
chr11:72696632|72697166 hsa-miR-16-5p 0 1 0
chr1:34785933|34786083 hsa-miR-16-5p 0 1 0
chr11:62677939|62678077 hsa-miR-16-5p 0 1 0
chr13:110512207|110512372 hsa-miR-16-5p 0 1 0
chr7:44058258|44058480 hsa-miR-16-5p 0 1 0
chr1:232514498|232514699 hsa-miR-16-5p 0 1 0
chr2:88857394|88857507 hsa-miR-16-5p 0 1 0
chr16:74469223|74469387 hsa-miR-16-5p 0 1 0
chr6:34245841|34246050 hsa-miR-16-5p 0 1 0
chr14:39181446|39181656 hsa-miR-16-5p 0 1 0
chr11:119095006|119095121 hsa-miR-16-5p 0 1 0
chr14:105393254|105393372 hsa-miR-16-5p 0 1 0
chr8:86457958|86458025 hsa-miR-16-5p 0 1 0
chr14:105854652|105854972 hsa-miR-16-5p 0 1 0
chr3:130574163|130574329 hsa-miR-16-5p 0 1 0
chr3:120394994|120395218 hsa-miR-16-5p 0 1 0
chr14:105854679|105855077 hsa-miR-16-5p 0 1 0
chr22:44151548|44151701 hsa-miR-16-5p 0 1 0
chr2:85322528|85322697 hsa-miR-16-5p 0 1 0
chrX:153351977|153352100 hsa-miR-16-5p 0 1 0
chr4:76144149|76144473 hsa-miR-16-5p 0 1 0
chr6:34245894|34246050 hsa-miR-16-5p 0 1 0
chr14:105854679|105854956 hsa-miR-16-5p 0 1 0
chr14:105854652|105854962 hsa-miR-16-5p 0 1 0
chr18:47155290|47155407 hsa-miR-16-5p 0 1 0
chr22:21694187|21694330 hsa-miR-16-5p 0 1 0
chr17:63705303|63705482 hsa-miR-16-5p -5 1 0
chr9:100455094|100455262 hsa-miR-16-5p -6 1 0
chr6:33316205|33316332 hsa-miR-16-5p 0 1 0
chr5:139389797|139389909 hsa-miR-16-5p -11 1 0
chr3:10289800|10290167 hsa-miR-16-5p -7 1 0
chr16:58707224|58707342 hsa-miR-16-5p -11 1 0
chr2:88857368|88857507 hsa-miR-16-5p -10 1 0
chr1:157122466|157122565 hsa-miR-16-5p -13 1 0
chr19:6211041|6211231 hsa-miR-16-5p 0 1 0
chr20:31605478|31605759 hsa-miR-16-5p -3 1 0
chr12:49032621|49032827 hsa-miR-16-5p -10 1 0
chr1:34785916|34786101 hsa-miR-16-5p -7 1 0
chr12:53474953|53475153 hsa-miR-16-5p -9 1 0
chr17:73279916|73280121 hsa-miR-16-5p -6 1 0
chr19:50268285|50271439 hsa-miR-16-5p -11 1 0
chr16:52655740|52655996 hsa-miR-16-5p -4 1 0
chr8:29059121|29059247 hsa-miR-16-5p -9 1 0
chr18:23914470|23914849 hsa-miR-16-5p -3 1 0
chr12:754148|754324 hsa-miR-16-5p -7 1 0
chr22:36284110|36284488 hsa-miR-16-5p -9 1 0
chr11:68614043|68614185 hsa-miR-16-5p -9 1 0
chr22:26494878|26494939 hsa-miR-16-5p -12 1 0
chr11:86808584|86808711 hsa-miR-16-5p 1 0 0
chr16:24823734|24823811 hsa-miR-16-5p 1 0 0
chr2:241817332|241817465 hsa-miR-16-5p 1 0 0
chr5:147393254|147393375 hsa-miR-16-5p 1 0 0
chr1:6221629|6221747 hsa-miR-16-5p 1 0 0
chr16:31130515|31130601 hsa-miR-16-5p 0 1 0
chr1:45017964|45018083 hsa-miR-16-5p 0 1 0
chr19:39445710|39445965 hsa-miR-16-5p 0 1 0
chr2:159797097|159797237 hsa-miR-16-5p 0 1 0
chr1:51301651|51302391 hsa-miR-16-5p 0 1 0
chr2:216660661|216661884 hsa-miR-16-5p 0 1 0
chr12:101744979|101745081 hsa-miR-16-5p 0 1 0
chr6:122725247|122725393 hsa-miR-16-5p 0 1 0
chr19:41771199|41771308 hsa-miR-16-5p 0 1 0
chr2:73847397|73847562 hsa-miR-16-5p 0 1 0
chr22:42160432|42160609 hsa-miR-16-5p 0 1 0
chr6:33403861|33403955 hsa-miR-16-5p 0 1 0
chr20:41360069|41360168 hsa-miR-16-5p 0 1 0
chr6:33319739|33320053 hsa-miR-16-5p 0 1 0
chr10:110119289|110119520 hsa-miR-16-5p 0 1 0
chr19:41771239|41771308 hsa-miR-16-5p 0 1 0
chr6:31412176|31412385 hsa-miR-16-5p 0 1 0
chr3:192797116|192797244 hsa-miR-16-5p 0 1 0
chr2:86151297|86151436 hsa-miR-16-5p 0 1 0
chr2:189002971|189003776 hsa-miR-16-5p 0 1 0
chr12:49032621|49032794 hsa-miR-16-5p 0 1 0
chr17:49600177|49600306 hsa-miR-16-5p 0 1 0
chr2:88857368|88857510 hsa-miR-16-5p 0 1 0
chr1:94897819|94898067 hsa-miR-16-5p 0 1 0
chr6:31950307|31950650 hsa-miR-16-5p 0 1 0
chr6:136343362|136343452 hsa-miR-16-5p 0 1 0
chr2:189667218|189667384 hsa-miR-16-5p 0 1 0
chr17:747326|747424 hsa-miR-16-5p 0 1 0
chr19:19655124|19655226 hsa-miR-16-5p 0 1 0
chr20:17633475|17633582 hsa-miR-16-5p 0 1 0
chr16:3729026|3729145 hsa-miR-16-5p 0 1 0
chr10:110898397|110898517 hsa-miR-16-5p 0 1 0
chr16:67286469|67286633 hsa-miR-16-5p 0 1 0
chr9:94480451|94480595 hsa-miR-16-5p 0 1 0
chr11:62677927|62678069 hsa-miR-16-5p 0 1 0
chr12:15903027|15903176 hsa-miR-16-5p 0 1 0
chr8:119841818|119841948 hsa-miR-16-5p 0 1 0
chr10:72062636|72062718 hsa-miR-16-5p 0 1 0
chr22:43174284|43174539 hsa-miR-16-5p 0 1 0
chrX:149501721|149501845 hsa-miR-16-5p 0 1 0
chr17:50187053|50190092 hsa-miR-16-5p 0 1 0
chr17:50189681|50190074 hsa-miR-16-5p 0 1 0
chr11:2913011|2913205 hsa-miR-16-5p 0 1 0
chr22:50290095|50290416 hsa-miR-16-5p 0 1 0
chr11:62677939|62678069 hsa-miR-16-5p 0 1 0
chrX:20015223|20016125 hsa-miR-16-5p 0 1 0
chr11:72696632|72697148 hsa-miR-16-5p 0 1 0
chr6:32163237|32163328 hsa-miR-16-5p 0 1 0
chr1:26942678|26942948 hsa-miR-16-5p 0 1 0
chr2:88857353|88857576 hsa-miR-16-5p 0 1 0
chr13:50020538|50020669 hsa-miR-16-5p 0 1 0
chr10:128106679|128106886 hsa-miR-16-5p 0 1 0
chrX:54444866|54444985 hsa-miR-16-5p 0 1 0
chr1:156726906|156727010 hsa-miR-16-5p 0 1 0
chr5:178206634|178206792 hsa-miR-16-5p 0 1 0
chr7:151034360|151034579 hsa-miR-16-5p 0 1 0
chr13:100634834|100635077 hsa-miR-16-5p 0 1 0
chr12:100159058|100159203 hsa-miR-16-5p 0 1 0
chr19:54148446|54148670 hsa-miR-16-5p 0 1 0
chr3:45678737|45678894 hsa-miR-16-5p 0 1 0
chr5:76834710|76834845 hsa-miR-16-5p 0 1 0
chr7:150329277|150329469 hsa-miR-16-5p 0 1 0
chr11:62677927|62678060 hsa-miR-16-5p 0 1 0
chr2:222650374|222650482 hsa-miR-16-5p 0 1 0
chr9:129177826|129177956 hsa-miR-16-5p 0 1 0
chr13:113087412|113087799 hsa-miR-16-5p 0 1 0
chr5:314486|314596 hsa-miR-16-5p 0 1 0
chr14:103520502|103520685 hsa-miR-16-5p 0 1 0
chr9:136942240|136942373 hsa-miR-16-5p 0 1 0
chr8:58450591|58450754 hsa-miR-16-5p 0 1 0
chr22:39316706|39316765 hsa-miR-16-5p 0 1 0
chr16:2855629|2855900 hsa-miR-16-5p 0 1 0
chr19:54148446|54148502 hsa-miR-16-5p 0 1 0
chrX:19353058|19353219 hsa-miR-16-5p 0 1 0
chr17:50199556|50201426 hsa-miR-16-5p 0 1 0
chr7:149180193|149180343 hsa-miR-16-5p 0 1 0
chr17:60135267|60135425 hsa-miR-16-5p 0 1 0
chr11:1881478|1881596 hsa-miR-16-5p 0 1 0
chr2:88857436|88857580 hsa-miR-16-5p 0 1 0
chr1:156210962|156211075 hsa-miR-16-5p 0 1 0
chr11:46672291|46672434 hsa-miR-16-5p 0 1 0
chr14:39181557|39181656 hsa-miR-16-5p 0 1 0
chr3:47847927|47848306 hsa-miR-16-5p 0 1 0
chr2:88857394|88857520 hsa-miR-16-5p 0 1 0
chr3:15713543|15713641 hsa-miR-16-5p 0 1 0
chr7:30160812|30160966 hsa-miR-16-5p 0 1 0
chr7:140179213|140179372 hsa-miR-16-5p 0 1 0
chr1:34785935|34786083 hsa-miR-16-5p 0 1 0
chr1:34785900|34786083 hsa-miR-16-5p 0 1 0
chr20:20591177|20591314 hsa-miR-16-5p 0 1 0
chr22:29328867|29330509 hsa-miR-16-5p 0 1 0
chr3:180324582|180324712 hsa-miR-16-5p 0 1 0
chr22:41356686|41356808 hsa-miR-16-5p 0 1 0
chr2:218449810|218449926 hsa-miR-16-5p 0 1 0
chr16:47699253|47699384 hsa-miR-16-5p 0 1 0
chr3:134356371|134356478 hsa-miR-16-5p 0 1 0
chr12:113174721|113175070 hsa-miR-16-5p 0 1 0
chr7:141661603|141661806 hsa-miR-16-5p 0 1 0
chr1:45566608|45566904 hsa-miR-16-5p 0 1 0
chr10:97381414|97381769 hsa-miR-16-5p 0 1 0
chr14:35403429|35403544 hsa-miR-16-5p 0 1 0
chr12:113174649|113174744 hsa-miR-16-5p 0 1 0
chr2:232847467|232850286 hsa-miR-16-5p 0 1 0
chr6:149456791|149461861 hsa-miR-16-5p 0 1 0
chr2:222558918|222559121 hsa-miR-16-5p 0 1 0
chr3:50584792|50584986 hsa-miR-16-5p 0 1 0
chr19:55390450|55390539 hsa-miR-16-5p 0 1 0
chr16:68354323|68354453 hsa-miR-16-5p 0 1 0
chr1:64807365|64807466 hsa-miR-16-5p 0 1 0
chr1:26942673|26943005 hsa-miR-16-5p 0 1 0
chr21:46346839|46346970 hsa-miR-16-5p 0 1 0
chr16:4885667|4885777 hsa-miR-16-5p 0 1 0
chr19:39445812|39445965 hsa-miR-16-5p 0 1 0
chr19:54193180|54193334 hsa-miR-16-5p 0 1 0
chr17:747326|747514 hsa-miR-16-5p 0 1 0
chr22:36284110|36284475 hsa-miR-16-5p 0 1 0
chr12:15903037|15903176 hsa-miR-16-5p 0 1 0
chr2:233460143|233460345 hsa-miR-16-5p 0 1 0
chr19:54148467|54148670 hsa-miR-16-5p 0 1 0
chr9:35698080|35698364 hsa-miR-16-5p 0 1 0
chrX:135362814|135362948 hsa-miR-16-5p 0 1 0
chr16:29985332|29985578 hsa-miR-16-5p 0 1 0
chr1:11661130|11661352 hsa-miR-16-5p 0 1 0
chr14:75176361|75176557 hsa-miR-16-5p 0 1 0
chr8:42318857|42319021 hsa-miR-16-5p 0 1 0
chr6:34245848|34246022 hsa-miR-16-5p 0 1 0
chr15:90227902|90228114 hsa-miR-16-5p 0 1 0
chr19:54460279|54460553 hsa-miR-16-5p 0 1 0
chr19:50268344|50271468 hsa-miR-16-5p 0 1 0
chr17:35820332|35820437 hsa-miR-16-5p 0 1 0
chr4:37586525|37586649 hsa-miR-16-5p 0 1 0
chr1:45566614|45566946 hsa-miR-16-5p 0 1 0
chr16:4885667|4885779 hsa-miR-16-5p 0 1 0
chr1:59874420|59874548 hsa-miR-16-5p 0 1 0
chrX:47651810|47652126 hsa-miR-16-5p 0 1 0
chr1:20661255|20661379 hsa-miR-16-5p 0 1 0
chr16:90044021|90044193 hsa-miR-16-5p 0 1 0
chr7:117667086|117667189 hsa-miR-16-5p 0 1 0
chr17:29073527|29073753 hsa-miR-16-5p 0 1 0
chr16:57516356|57516463 hsa-miR-16-5p 0 1 0
chr10:32268963|32269071 hsa-miR-16-5p 0 1 0
chr19:2233366|2233442 hsa-miR-16-5p 0 1 0
chr14:20458065|20458174 hsa-miR-16-5p 0 1 0
chr10:87743373|87743557 hsa-miR-16-5p 0 1 0
chr1:204221977|204222082 hsa-miR-16-5p 0 1 0
chr8:95154466|95154546 hsa-miR-16-5p 0 1 0
chr19:50268263|50268367 hsa-miR-16-5p 0 1 0
chr1:204221977|204222073 hsa-miR-16-5p 0 1 0
chr19:13154499|13154633 hsa-miR-16-5p 0 1 0
chr9:106929114|106929317 hsa-miR-16-5p 0 1 0
chr11:62598522|62598609 hsa-miR-16-5p 0 1 0
chr6:44003416|44003680 hsa-miR-16-5p 0 1 0
chr10:79354334|79354514 hsa-miR-16-5p 0 1 0
chr1:6221547|6221747 hsa-miR-16-5p 1 0 0
chr12:12975323|12975438 hsa-miR-16-5p 1 0 0
chr6:26055816|26056046 hsa-miR-16-5p 1 0 0
chr1:22647522|22647666 hsa-miR-16-5p 1 0 0
Target genes
miRNA Gene Gene Description HGNC ID details
hsa-miR-16-5p BRCA1 BRCA1 DNA repair associated HGNC:1100 details
hsa-miR-16-5p BCL2 BCL2 apoptosis regulator HGNC:990 details
hsa-miR-16-5p CCNE1 cyclin E1 HGNC:1589 details
hsa-miR-16-5p HMGA1 high mobility group AT-hook 1 HGNC:5010 details
hsa-miR-16-5p CCND1 cyclin D1 HGNC:1582 details
hsa-miR-16-5p CFL2 cofilin 2 HGNC:1875 details
hsa-miR-16-5p CSHL1 chorionic somatomammotropin hormone like 1 HGNC:2442 details
hsa-miR-16-5p CRHBP corticotropin releasing hormone binding protein HGNC:2356 details
hsa-miR-16-5p CCNT2 cyclin T2 HGNC:1600 details
hsa-miR-16-5p VEGFA vascular endothelial growth factor A HGNC:12680 details
hsa-miR-16-5p CCND3 cyclin D3 HGNC:1585 details
hsa-miR-16-5p CDK6 cyclin dependent kinase 6 HGNC:1777 details
hsa-miR-16-5p ZNF559 zinc finger protein 559 HGNC:28197 details
hsa-miR-16-5p WIPF1 WAS/WASL interacting protein family member 1 HGNC:12736 details
hsa-miR-16-5p VPS45 vacuolar protein sorting 45 homolog HGNC:14579 details
hsa-miR-16-5p UGP2 UDP-glucose pyrophosphorylase 2 HGNC:12527 details
hsa-miR-16-5p UGDH UDP-glucose 6-dehydrogenase HGNC:12525 details
hsa-miR-16-5p HSP90B1 heat shock protein 90 beta family member 1 HGNC:12028 details
hsa-miR-16-5p TIA1 TIA1 cytotoxic granule associated RNA binding protein HGNC:11802 details
hsa-miR-16-5p SLC35B3 solute carrier family 35 member B3 HGNC:21601 details
hsa-miR-16-5p SLC35A1 solute carrier family 35 member A1 HGNC:11021 details
hsa-miR-16-5p SKAP2 src kinase associated phosphoprotein 2 HGNC:15687 details
hsa-miR-16-5p RNASEL ribonuclease L HGNC:10050 details
hsa-miR-16-5p RHOT1 ras homolog family member T1 HGNC:21168 details
hsa-miR-16-5p RAD51C RAD51 paralog C HGNC:9820 details
hsa-miR-16-5p PRIM1 DNA primase subunit 1 HGNC:9369 details
hsa-miR-16-5p PNN pinin, desmosome associated protein HGNC:9162 details
hsa-miR-16-5p PMS1 PMS1 homolog 1, mismatch repair system component HGNC:9121 details
hsa-miR-16-5p PHKB phosphorylase kinase regulatory subunit beta HGNC:8927 details
hsa-miR-16-5p PDCD6IP programmed cell death 6 interacting protein HGNC:8766 details
hsa-miR-16-5p OSGEPL1 O-sialoglycoprotein endopeptidase like 1 HGNC:23075 details
hsa-miR-16-5p OMA1 OMA1 zinc metallopeptidase HGNC:29661 details
hsa-miR-16-5p NT5DC1 5'-nucleotidase domain containing 1 HGNC:21556 details
hsa-miR-16-5p MSH2 mutS homolog 2 HGNC:7325 details
hsa-miR-16-5p MCL1 MCL1 apoptosis regulator, BCL2 family member HGNC:6943 details
hsa-miR-16-5p details
hsa-miR-16-5p C2orf74 chromosome 2 open reading frame 74 HGNC:34439 details
hsa-miR-16-5p details
hsa-miR-16-5p details
hsa-miR-16-5p JUN Jun proto-oncogene, AP-1 transcription factor subunit HGNC:6204 details
hsa-miR-16-5p HSPA1A heat shock protein family A (Hsp70) member 1A HGNC:5232 details
hsa-miR-16-5p HSDL2 hydroxysteroid dehydrogenase like 2 HGNC:18572 details
hsa-miR-16-5p details
hsa-miR-16-5p C17orf80 chromosome 17 open reading frame 80 HGNC:29601 details
hsa-miR-16-5p HERC6 HECT and RLD domain containing E3 ubiquitin protein ligase family member 6 HGNC:26072 details
hsa-miR-16-5p HDHD2 haloacid dehalogenase like hydrolase domain containing 2 HGNC:25364 details
hsa-miR-16-5p HACE1 HECT domain and ankyrin repeat containing E3 ubiquitin protein ligase 1 HGNC:21033 details
hsa-miR-16-5p details
hsa-miR-16-5p GTF2H1 general transcription factor IIH subunit 1 HGNC:4655 details
hsa-miR-16-5p GOLPH3L golgi phosphoprotein 3 like HGNC:24882 details
hsa-miR-16-5p GOLGA5 golgin A5 HGNC:4428 details
hsa-miR-16-5p ECHDC1 ethylmalonyl-CoA decarboxylase 1 HGNC:21489 details
hsa-miR-16-5p CREBL2 cAMP responsive element binding protein like 2 HGNC:2350 details
hsa-miR-16-5p CEP63 centrosomal protein 63 HGNC:25815 details
hsa-miR-16-5p CENPJ centromere protein J HGNC:17272 details
hsa-miR-16-5p CDC14B cell division cycle 14B HGNC:1719 details
hsa-miR-16-5p CARD8 caspase recruitment domain family member 8 HGNC:17057 details
hsa-miR-16-5p TMEM251 transmembrane protein 251 HGNC:20218 details
hsa-miR-16-5p ANAPC16 anaphase promoting complex subunit 16 HGNC:26976 details
hsa-miR-16-5p ASXL2 ASXL transcriptional regulator 2 HGNC:23805 details
hsa-miR-16-5p WT1 WT1 transcription factor HGNC:12796 details
hsa-miR-16-5p CADM1 cell adhesion molecule 1 HGNC:5951 details
hsa-miR-16-5p RAB21 RAB21, member RAS oncogene family HGNC:18263 details
hsa-miR-16-5p PDCD4 programmed cell death 4 HGNC:8763 details
hsa-miR-16-5p TPI1 triosephosphate isomerase 1 HGNC:12009 details
hsa-miR-16-5p ACTR1A actin related protein 1A HGNC:167 details
hsa-miR-16-5p RAB9B RAB9B, member RAS oncogene family HGNC:14090 details
hsa-miR-16-5p ACVR2A activin A receptor type 2A HGNC:173 details
hsa-miR-16-5p WNT3A Wnt family member 3A HGNC:15983 details
hsa-miR-16-5p TPPP3 tubulin polymerization promoting protein family member 3 HGNC:24162 details
hsa-miR-16-5p details
hsa-miR-16-5p CCND2 cyclin D2 HGNC:1583 details
hsa-miR-16-5p AKT3 AKT serine/threonine kinase 3 HGNC:393 details
hsa-miR-16-5p RPS6 ribosomal protein S6 HGNC:10429 details
hsa-miR-16-5p MYB MYB proto-oncogene, transcription factor HGNC:7545 details
hsa-miR-16-5p AURKB aurora kinase B HGNC:11390 details
hsa-miR-16-5p CAPRIN1 cell cycle associated protein 1 HGNC:6743 details
hsa-miR-16-5p ARL2 ADP ribosylation factor like GTPase 2 HGNC:693 details
hsa-miR-16-5p TNFSF9 TNF superfamily member 9 HGNC:11939 details
hsa-miR-16-5p KCNN4 potassium calcium-activated channel subfamily N member 4 HGNC:6293 details
hsa-miR-16-5p IFRD1 interferon related developmental regulator 1 HGNC:5456 details
hsa-miR-16-5p PHLDB2 pleckstrin homology like domain family B member 2 HGNC:29573 details
hsa-miR-16-5p FGF2 fibroblast growth factor 2 HGNC:3676 details
hsa-miR-16-5p SLC25A22 solute carrier family 25 member 22 HGNC:19954 details
hsa-miR-16-5p GSTM4 glutathione S-transferase mu 4 HGNC:4636 details
hsa-miR-16-5p VTI1B vesicle transport through interaction with t-SNAREs 1B HGNC:17793 details
hsa-miR-16-5p GALNT7 polypeptide N-acetylgalactosaminyltransferase 7 HGNC:4129 details
hsa-miR-16-5p ALG3 ALG3 alpha-1,3- mannosyltransferase HGNC:23056 details
hsa-miR-16-5p details
hsa-miR-16-5p PISD phosphatidylserine decarboxylase HGNC:8999 details
hsa-miR-16-5p HMOX1 heme oxygenase 1 HGNC:5013 details
hsa-miR-16-5p ATG9A autophagy related 9A HGNC:22408 details
hsa-miR-16-5p details
hsa-miR-16-5p RAB30 RAB30, member RAS oncogene family HGNC:9770 details
hsa-miR-16-5p NPR3 natriuretic peptide receptor 3 HGNC:7945 details
hsa-miR-16-5p PSAT1 phosphoserine aminotransferase 1 HGNC:19129 details
hsa-miR-16-5p NAA25 N-alpha-acetyltransferase 25, NatB auxiliary subunit HGNC:25783 details
hsa-miR-16-5p RTN4 reticulon 4 HGNC:14085 details
hsa-miR-16-5p TOR4A torsin family 4 member A HGNC:25981 details
hsa-miR-16-5p SLC38A1 solute carrier family 38 member 1 HGNC:13447 details
hsa-miR-16-5p details
hsa-miR-16-5p TPM3 tropomyosin 3 HGNC:12012 details
hsa-miR-16-5p SQSTM1 sequestosome 1 HGNC:11280 details
hsa-miR-16-5p MMS19 MMS19 homolog, cytosolic iron-sulfur assembly component HGNC:13824 details
hsa-miR-16-5p LUZP1 leucine zipper protein 1 HGNC:14985 details
hsa-miR-16-5p ACP2 acid phosphatase 2, lysosomal HGNC:123 details
hsa-miR-16-5p SEC24A SEC24 homolog A, COPII coat complex component HGNC:10703 details
hsa-miR-16-5p ZNF622 zinc finger protein 622 HGNC:30958 details
hsa-miR-16-5p PURA purine rich element binding protein A HGNC:9701 details
hsa-miR-16-5p TOMM34 translocase of outer mitochondrial membrane 34 HGNC:15746 details
hsa-miR-16-5p NOB1 NIN1 (RPN12) binding protein 1 homolog HGNC:29540 details
hsa-miR-16-5p SRPRB SRP receptor subunit beta HGNC:24085 details
hsa-miR-16-5p CHORDC1 cysteine and histidine rich domain containing 1 HGNC:14525 details
hsa-miR-16-5p IFRD2 interferon related developmental regulator 2 HGNC:5457 details
hsa-miR-16-5p PNPLA6 patatin like phospholipase domain containing 6 HGNC:16268 details
hsa-miR-16-5p details
hsa-miR-16-5p CA12 carbonic anhydrase 12 HGNC:1371 details
hsa-miR-16-5p GFPT1 glutamine--fructose-6-phosphate transaminase 1 HGNC:4241 details
hsa-miR-16-5p PPIF peptidylprolyl isomerase F HGNC:9259 details
hsa-miR-16-5p ARHGDIA Rho GDP dissociation inhibitor alpha HGNC:678 details
hsa-miR-16-5p LYPLA2 lysophospholipase 2 HGNC:6738 details
hsa-miR-16-5p YIF1B Yip1 interacting factor homolog B, membrane trafficking protein HGNC:30511 details
hsa-miR-16-5p TMEM43 transmembrane protein 43 HGNC:28472 details
hsa-miR-16-5p EIF4E eukaryotic translation initiation factor 4E HGNC:3287 details
hsa-miR-16-5p SLC16A3 solute carrier family 16 member 3 HGNC:10924 details
hsa-miR-16-5p SHOC2 SHOC2 leucine rich repeat scaffold protein HGNC:15454 details
hsa-miR-16-5p ZNF384 zinc finger protein 384 HGNC:11955 details
hsa-miR-16-5p TMEM109 transmembrane protein 109 HGNC:28771 details
hsa-miR-16-5p PAFAH1B2 platelet activating factor acetylhydrolase 1b catalytic subunit 2 HGNC:8575 details
hsa-miR-16-5p DNAJB4 DnaJ heat shock protein family (Hsp40) member B4 HGNC:14886 details
hsa-miR-16-5p NAPG NSF attachment protein gamma HGNC:7642 details
hsa-miR-16-5p details
hsa-miR-16-5p LAMTOR3 late endosomal/lysosomal adaptor, MAPK and MTOR activator 3 HGNC:15606 details
hsa-miR-16-5p KPNA3 karyopherin subunit alpha 3 HGNC:6396 details
hsa-miR-16-5p TXN2 thioredoxin 2 HGNC:17772 details
hsa-miR-16-5p MLLT11 MLLT11 transcription factor 7 cofactor HGNC:16997 details
hsa-miR-16-5p IPO4 importin 4 HGNC:19426 details
hsa-miR-16-5p details
hsa-miR-16-5p PTGS2 prostaglandin-endoperoxide synthase 2 HGNC:9605 details
hsa-miR-16-5p LAMTOR5 late endosomal/lysosomal adaptor, MAPK and MTOR activator 5 HGNC:17955 details
hsa-miR-16-5p SPTLC1 serine palmitoyltransferase long chain base subunit 1 HGNC:11277 details
hsa-miR-16-5p ABCF2 ATP binding cassette subfamily F member 2 HGNC:71 details
hsa-miR-16-5p UBE2V1 ubiquitin conjugating enzyme E2 V1 HGNC:12494 details
hsa-miR-16-5p PANX1 pannexin 1 HGNC:8599 details
hsa-miR-16-5p PLK1 polo like kinase 1 HGNC:9077 details
hsa-miR-16-5p PTCD3 pentatricopeptide repeat domain 3 HGNC:24717 details
hsa-miR-16-5p GFM1 G elongation factor mitochondrial 1 HGNC:13780 details
hsa-miR-16-5p UBE2S ubiquitin conjugating enzyme E2 S HGNC:17895 details
hsa-miR-16-5p MCU mitochondrial calcium uniporter HGNC:23526 details
hsa-miR-16-5p HARS2 histidyl-tRNA synthetase 2, mitochondrial HGNC:4817 details
hsa-miR-16-5p CACNA2D1 calcium voltage-gated channel auxiliary subunit alpha2delta 1 HGNC:1399 details
hsa-miR-16-5p F2 coagulation factor II, thrombin HGNC:3535 details
hsa-miR-16-5p UBE4A ubiquitination factor E4A HGNC:12499 details
hsa-miR-16-5p SLC38A5 solute carrier family 38 member 5 HGNC:18070 details
hsa-miR-16-5p RFT1 RFT1 homolog HGNC:30220 details
hsa-miR-16-5p CDK5RAP1 CDK5 regulatory subunit associated protein 1 HGNC:15880 details
hsa-miR-16-5p LAMC1 laminin subunit gamma 1 HGNC:6492 details
hsa-miR-16-5p FNDC3B fibronectin type III domain containing 3B HGNC:24670 details
hsa-miR-16-5p SLC7A1 solute carrier family 7 member 1 HGNC:11057 details
hsa-miR-16-5p SERPINE2 serpin family E member 2 HGNC:8951 details
hsa-miR-16-5p SLC12A2 solute carrier family 12 member 2 HGNC:10911 details
hsa-miR-16-5p EGFR epidermal growth factor receptor HGNC:3236 details
hsa-miR-16-5p IGF2R insulin like growth factor 2 receptor HGNC:5467 details
hsa-miR-16-5p NOTCH2 notch receptor 2 HGNC:7882 details
hsa-miR-16-5p UTP15 UTP15 small subunit processome component HGNC:25758 details
hsa-miR-16-5p ITGA2 integrin subunit alpha 2 HGNC:6137 details
hsa-miR-16-5p GNL3L G protein nucleolar 3 like HGNC:25553 details
hsa-miR-16-5p GPAM glycerol-3-phosphate acyltransferase, mitochondrial HGNC:24865 details
hsa-miR-16-5p NAA15 N-alpha-acetyltransferase 15, NatA auxiliary subunit HGNC:30782 details
hsa-miR-16-5p PPP2R5C protein phosphatase 2 regulatory subunit B'gamma HGNC:9311 details
hsa-miR-16-5p LAMTOR2 late endosomal/lysosomal adaptor, MAPK and MTOR activator 2 HGNC:29796 details
hsa-miR-16-5p MRPL20 mitochondrial ribosomal protein L20 HGNC:14478 details
hsa-miR-16-5p ABHD10 abhydrolase domain containing 10, depalmitoylase HGNC:25656 details
hsa-miR-16-5p PPM1D protein phosphatase, Mg2+/Mn2+ dependent 1D HGNC:9277 details
hsa-miR-16-5p BMI1 BMI1 proto-oncogene, polycomb ring finger HGNC:1066 details
hsa-miR-16-5p CHUK component of inhibitor of nuclear factor kappa B kinase complex HGNC:1974 details
hsa-miR-16-5p TP53 tumor protein p53 HGNC:11998 details
hsa-miR-16-5p NFKB1 nuclear factor kappa B subunit 1 HGNC:7794 details
hsa-miR-16-5p ZYX zyxin HGNC:13200 details
hsa-miR-16-5p NCOR2 nuclear receptor corepressor 2 HGNC:7673 details
hsa-miR-16-5p AXIN2 axin 2 HGNC:904 details
hsa-miR-16-5p KDR kinase insert domain receptor HGNC:6307 details
hsa-miR-16-5p FGFR1 fibroblast growth factor receptor 1 HGNC:3688 details
hsa-miR-16-5p HMGA2 high mobility group AT-hook 2 HGNC:5009 details
hsa-miR-16-5p PIM1 Pim-1 proto-oncogene, serine/threonine kinase HGNC:8986 details
hsa-miR-16-5p IFNG interferon gamma HGNC:5438 details
hsa-miR-16-5p UNG uracil DNA glycosylase HGNC:12572 details
hsa-miR-16-5p details
hsa-miR-16-5p SRP68 signal recognition particle 68 HGNC:11302 details
hsa-miR-16-5p RECK reversion inducing cysteine rich protein with kazal motifs HGNC:11345 details
hsa-miR-16-5p DSP desmoplakin HGNC:3052 details
hsa-miR-16-5p RPL10 ribosomal protein L10 HGNC:10298 details
hsa-miR-16-5p SEC11A SEC11 homolog A, signal peptidase complex subunit HGNC:17718 details
hsa-miR-16-5p details
hsa-miR-16-5p RPS27 ribosomal protein S27 HGNC:10416 details
hsa-miR-16-5p YTHDC1 YTH domain containing 1 HGNC:30626 details
hsa-miR-16-5p GRWD1 glutamate rich WD repeat containing 1 HGNC:21270 details
hsa-miR-16-5p PPAN peter pan homolog HGNC:9227 details
hsa-miR-16-5p NT5C3A 5'-nucleotidase, cytosolic IIIA HGNC:17820 details
hsa-miR-16-5p TRMT10C tRNA methyltransferase 10C, mitochondrial RNase P subunit HGNC:26022 details
hsa-miR-16-5p SMAD1 SMAD family member 1 HGNC:6767 details
hsa-miR-16-5p TRIM32 tripartite motif containing 32 HGNC:16380 details
hsa-miR-16-5p HSPA1B heat shock protein family A (Hsp70) member 1B HGNC:5233 details
hsa-miR-16-5p DNAJC2 DnaJ heat shock protein family (Hsp40) member C2 HGNC:13192 details
hsa-miR-16-5p RPL4 ribosomal protein L4 HGNC:10353 details
hsa-miR-16-5p NOC4L nucleolar complex associated 4 homolog HGNC:28461 details
hsa-miR-16-5p MRPL12 mitochondrial ribosomal protein L12 HGNC:10378 details
hsa-miR-16-5p EIF1 eukaryotic translation initiation factor 1 HGNC:3249 details
hsa-miR-16-5p PON2 paraoxonase 2 HGNC:9205 details
hsa-miR-16-5p EMC6 ER membrane protein complex subunit 6 HGNC:28430 details
hsa-miR-16-5p PTRH1 peptidyl-tRNA hydrolase 1 homolog HGNC:27039 details
hsa-miR-16-5p UBE2C ubiquitin conjugating enzyme E2 C HGNC:15937 details
hsa-miR-16-5p EEF1G eukaryotic translation elongation factor 1 gamma HGNC:3213 details
hsa-miR-16-5p LSM10 LSM10, U7 small nuclear RNA associated HGNC:17562 details
hsa-miR-16-5p YBX3 Y-box binding protein 3 HGNC:2428 details
hsa-miR-16-5p INTS5 integrator complex subunit 5 HGNC:29352 details
hsa-miR-16-5p MRPS31 mitochondrial ribosomal protein S31 HGNC:16632 details
hsa-miR-16-5p CDC123 cell division cycle 123 HGNC:16827 details
hsa-miR-16-5p TMBIM6 transmembrane BAX inhibitor motif containing 6 HGNC:11723 details
hsa-miR-16-5p RPL12 ribosomal protein L12 HGNC:10302 details
hsa-miR-16-5p MRPL1 mitochondrial ribosomal protein L1 HGNC:14275 details
hsa-miR-16-5p ACOT8 acyl-CoA thioesterase 8 HGNC:15919 details
hsa-miR-16-5p SLC27A4 solute carrier family 27 member 4 HGNC:10998 details
hsa-miR-16-5p LIN7C lin-7 homolog C, crumbs cell polarity complex component HGNC:17789 details
hsa-miR-16-5p ABCF1 ATP binding cassette subfamily F member 1 HGNC:70 details
hsa-miR-16-5p METAP2 methionyl aminopeptidase 2 HGNC:16672 details
hsa-miR-16-5p CD44 CD44 molecule (Indian blood group) HGNC:1681 details
hsa-miR-16-5p details
hsa-miR-16-5p SLC30A1 solute carrier family 30 member 1 HGNC:11012 details
hsa-miR-16-5p RPL27A ribosomal protein L27a HGNC:10329 details
hsa-miR-16-5p AUP1 AUP1 lipid droplet regulating VLDL assembly factor HGNC:891 details
hsa-miR-16-5p SLC1A5 solute carrier family 1 member 5 HGNC:10943 details
hsa-miR-16-5p EIF3C eukaryotic translation initiation factor 3 subunit C HGNC:3279 details
hsa-miR-16-5p AP2M1 adaptor related protein complex 2 subunit mu 1 HGNC:564 details
hsa-miR-16-5p DHX36 DEAH-box helicase 36 HGNC:14410 details
hsa-miR-16-5p details
hsa-miR-16-5p DNTTIP2 deoxynucleotidyltransferase terminal interacting protein 2 HGNC:24013 details
hsa-miR-16-5p UGT8 UDP glycosyltransferase 8 HGNC:12555 details
hsa-miR-16-5p SLC39A14 solute carrier family 39 member 14 HGNC:20858 details
hsa-miR-16-5p TNPO3 transportin 3 HGNC:17103 details
hsa-miR-16-5p SMPD4 sphingomyelin phosphodiesterase 4 HGNC:32949 details
hsa-miR-16-5p WDR18 WD repeat domain 18 HGNC:17956 details
hsa-miR-16-5p SNRPC small nuclear ribonucleoprotein polypeptide C HGNC:11157 details
hsa-miR-16-5p GPATCH4 G-patch domain containing 4 HGNC:25982 details
hsa-miR-16-5p DDX52 DExD-box helicase 52 HGNC:20038 details
hsa-miR-16-5p EIF2B2 eukaryotic translation initiation factor 2B subunit beta HGNC:3258 details
hsa-miR-16-5p ELP3 elongator acetyltransferase complex subunit 3 HGNC:20696 details
hsa-miR-16-5p XKR8 XK related 8 HGNC:25508 details
hsa-miR-16-5p GRB2 growth factor receptor bound protein 2 HGNC:4566 details
hsa-miR-16-5p SNRPB2 small nuclear ribonucleoprotein polypeptide B2 HGNC:11155 details
hsa-miR-16-5p SERBP1 SERPINE1 mRNA binding protein 1 HGNC:17860 details
hsa-miR-16-5p CMPK1 cytidine/uridine monophosphate kinase 1 HGNC:18170 details
hsa-miR-16-5p FNTA farnesyltransferase, CAAX box, alpha HGNC:3782 details
hsa-miR-16-5p TMEM126A transmembrane protein 126A HGNC:25382 details
hsa-miR-16-5p WBP11 WW domain binding protein 11 HGNC:16461 details
hsa-miR-16-5p ALDH2 aldehyde dehydrogenase 2 family member HGNC:404 details
hsa-miR-16-5p PCMT1 protein-L-isoaspartate (D-aspartate) O-methyltransferase HGNC:8728 details
hsa-miR-16-5p RBM6 RNA binding motif protein 6 HGNC:9903 details
hsa-miR-16-5p RPS6KB1 ribosomal protein S6 kinase B1 HGNC:10436 details
hsa-miR-16-5p DDHD2 DDHD domain containing 2 HGNC:29106 details
hsa-miR-16-5p NIN ninein HGNC:14906 details
hsa-miR-16-5p FLCN folliculin HGNC:27310 details
hsa-miR-16-5p ATF7 activating transcription factor 7 HGNC:792 details
hsa-miR-16-5p GATAD2A GATA zinc finger domain containing 2A HGNC:29989 details
hsa-miR-16-5p KATNAL1 katanin catalytic subunit A1 like 1 HGNC:28361 details
hsa-miR-16-5p BFAR bifunctional apoptosis regulator HGNC:17613 details
hsa-miR-16-5p TBRG1 transforming growth factor beta regulator 1 HGNC:29551 details
hsa-miR-16-5p ZNRF3 zinc and ring finger 3 HGNC:18126 details
hsa-miR-16-5p CDC25A cell division cycle 25A HGNC:1725 details
hsa-miR-16-5p ABL2 ABL proto-oncogene 2, non-receptor tyrosine kinase HGNC:77 details
hsa-miR-16-5p N4BP1 NEDD4 binding protein 1 HGNC:29850 details
hsa-miR-16-5p MGAT4A alpha-1,3-mannosyl-glycoprotein 4-beta-N-acetylglucosaminyltransferase A HGNC:7047 details
hsa-miR-16-5p TIMM10B translocase of inner mitochondrial membrane 10B HGNC:4022 details
hsa-miR-16-5p KIF5B kinesin family member 5B HGNC:6324 details
hsa-miR-16-5p CALR calreticulin HGNC:1455 details
hsa-miR-16-5p EIF4G3 eukaryotic translation initiation factor 4 gamma 3 HGNC:3298 details
hsa-miR-16-5p details
hsa-miR-16-5p RHOF ras homolog family member F, filopodia associated HGNC:15703 details
hsa-miR-16-5p TNFRSF12A TNF receptor superfamily member 12A HGNC:18152 details
hsa-miR-16-5p PPA1 inorganic pyrophosphatase 1 HGNC:9226 details
hsa-miR-16-5p TPT1 tumor protein, translationally-controlled 1 HGNC:12022 details
hsa-miR-16-5p TAF15 TATA-box binding protein associated factor 15 HGNC:11547 details
hsa-miR-16-5p TACO1 translational activator of cytochrome c oxidase I HGNC:24316 details
hsa-miR-16-5p RPL9 ribosomal protein L9 HGNC:10369 details
hsa-miR-16-5p CYCS cytochrome c, somatic HGNC:19986 details
hsa-miR-16-5p TUBB tubulin beta class I HGNC:20778 details
hsa-miR-16-5p PDF peptide deformylase, mitochondrial HGNC:30012 details
hsa-miR-16-5p LUC7L LUC7 like HGNC:6723 details
hsa-miR-16-5p EIF2B5 eukaryotic translation initiation factor 2B subunit epsilon HGNC:3261 details
hsa-miR-16-5p NAA10 N-alpha-acetyltransferase 10, NatA catalytic subunit HGNC:18704 details
hsa-miR-16-5p TUBB4B tubulin beta 4B class IVb HGNC:20771 details
hsa-miR-16-5p STX4 syntaxin 4 HGNC:11439 details
hsa-miR-16-5p CD55 CD55 molecule (Cromer blood group) HGNC:2665 details
hsa-miR-16-5p EIF3E eukaryotic translation initiation factor 3 subunit E HGNC:3277 details
hsa-miR-16-5p INF2 inverted formin 2 HGNC:23791 details
hsa-miR-16-5p LMF2 lipase maturation factor 2 HGNC:25096 details
hsa-miR-16-5p details
hsa-miR-16-5p BAG6 BAG cochaperone 6 HGNC:13919 details
hsa-miR-16-5p VMP1 vacuole membrane protein 1 HGNC:29559 details
hsa-miR-16-5p SYF2 SYF2 pre-mRNA splicing factor HGNC:19824 details
hsa-miR-16-5p NARS2 asparaginyl-tRNA synthetase 2, mitochondrial HGNC:26274 details
hsa-miR-16-5p POFUT1 protein O-fucosyltransferase 1 HGNC:14988 details
hsa-miR-16-5p ENY2 ENY2 transcription and export complex 2 subunit HGNC:24449 details
hsa-miR-16-5p MTOR mechanistic target of rapamycin kinase HGNC:3942 details
hsa-miR-16-5p STEAP3 STEAP3 metalloreductase HGNC:24592 details
hsa-miR-16-5p WDR43 WD repeat domain 43 HGNC:28945 details
hsa-miR-16-5p TRMT1 tRNA methyltransferase 1 HGNC:25980 details
hsa-miR-16-5p SNX12 sorting nexin 12 HGNC:14976 details
hsa-miR-16-5p XPO1 exportin 1 HGNC:12825 details
hsa-miR-16-5p SNX6 sorting nexin 6 HGNC:14970 details
hsa-miR-16-5p PHIP pleckstrin homology domain interacting protein HGNC:15673 details
hsa-miR-16-5p LAMTOR1 late endosomal/lysosomal adaptor, MAPK and MTOR activator 1 HGNC:26068 details
hsa-miR-16-5p TGFBI transforming growth factor beta induced HGNC:11771 details
hsa-miR-16-5p ANAPC13 anaphase promoting complex subunit 13 HGNC:24540 details
hsa-miR-16-5p DNAJA4 DnaJ heat shock protein family (Hsp40) member A4 HGNC:14885 details
hsa-miR-16-5p MDN1 midasin AAA ATPase 1 HGNC:18302 details
hsa-miR-16-5p DNAJA2 DnaJ heat shock protein family (Hsp40) member A2 HGNC:14884 details
hsa-miR-16-5p USP9X ubiquitin specific peptidase 9 X-linked HGNC:12632 details
hsa-miR-16-5p C8orf44 chromosome 8 open reading frame 44 HGNC:25646 details
hsa-miR-16-5p TMEM168 transmembrane protein 168 HGNC:25826 details
hsa-miR-16-5p details
hsa-miR-16-5p NCKAP5L NCK associated protein 5 like HGNC:29321 details
hsa-miR-16-5p SGK3 serum/glucocorticoid regulated kinase family member 3 HGNC:10812 details
hsa-miR-16-5p ZRANB1 zinc finger RANBP2-type containing 1 HGNC:18224 details
hsa-miR-16-5p TRIM44 tripartite motif containing 44 HGNC:19016 details
hsa-miR-16-5p TEX15 testis expressed 15, meiosis and synapsis associated HGNC:11738 details
hsa-miR-16-5p HNRNPA2B1 heterogeneous nuclear ribonucleoprotein A2/B1 HGNC:5033 details
hsa-miR-16-5p RIMS3 regulating synaptic membrane exocytosis 3 HGNC:21292 details
hsa-miR-16-5p CEP55 centrosomal protein 55 HGNC:1161 details
hsa-miR-16-5p IVNS1ABP influenza virus NS1A binding protein HGNC:16951 details
hsa-miR-16-5p PI4K2B phosphatidylinositol 4-kinase type 2 beta HGNC:18215 details
hsa-miR-16-5p CAAP1 caspase activity and apoptosis inhibitor 1 HGNC:25834 details
hsa-miR-16-5p LATS1 large tumor suppressor kinase 1 HGNC:6514 details
hsa-miR-16-5p BCL11B BAF chromatin remodeling complex subunit BCL11B HGNC:13222 details
hsa-miR-16-5p SLC39A10 solute carrier family 39 member 10 HGNC:20861 details
hsa-miR-16-5p ATP13A3 ATPase 13A3 HGNC:24113 details
hsa-miR-16-5p AVL9 AVL9 cell migration associated HGNC:28994 details
hsa-miR-16-5p TMEM100 transmembrane protein 100 HGNC:25607 details
hsa-miR-16-5p SIPA1L2 signal induced proliferation associated 1 like 2 HGNC:23800 details
hsa-miR-16-5p SMAD7 SMAD family member 7 HGNC:6773 details
hsa-miR-16-5p ZBTB34 zinc finger and BTB domain containing 34 HGNC:31446 details
hsa-miR-16-5p SALL1 spalt like transcription factor 1 HGNC:10524 details
hsa-miR-16-5p PRDM4 PR/SET domain 4 HGNC:9348 details
hsa-miR-16-5p FTL ferritin light chain HGNC:3999 details
hsa-miR-16-5p BCAS2 BCAS2 pre-mRNA processing factor HGNC:975 details
hsa-miR-16-5p YBX1 Y-box binding protein 1 HGNC:8014 details
hsa-miR-16-5p NDUFA9 NADH:ubiquinone oxidoreductase subunit A9 HGNC:7693 details
hsa-miR-16-5p MKI67 marker of proliferation Ki-67 HGNC:7107 details
hsa-miR-16-5p CCPG1 cell cycle progression 1 HGNC:24227 details
hsa-miR-16-5p NIPAL2 NIPA like domain containing 2 HGNC:25854 details
hsa-miR-16-5p MICU2 mitochondrial calcium uptake 2 HGNC:31830 details
hsa-miR-16-5p BCCIP BRCA2 and CDKN1A interacting protein HGNC:978 details
hsa-miR-16-5p WDR3 WD repeat domain 3 HGNC:12755 details
hsa-miR-16-5p details
hsa-miR-16-5p DIABLO diablo IAP-binding mitochondrial protein HGNC:21528 details
hsa-miR-16-5p SERPINB5 serpin family B member 5 HGNC:8949 details
hsa-miR-16-5p UTP23 UTP23 small subunit processome component HGNC:28224 details
hsa-miR-16-5p PYGB glycogen phosphorylase B HGNC:9723 details
hsa-miR-16-5p NOC3L NOC3 like DNA replication regulator HGNC:24034 details
hsa-miR-16-5p DDX41 DEAD-box helicase 41 HGNC:18674 details
hsa-miR-16-5p PHLDA2 pleckstrin homology like domain family A member 2 HGNC:12385 details
hsa-miR-16-5p SGTA small glutamine rich tetratricopeptide repeat co-chaperone alpha HGNC:10819 details
hsa-miR-16-5p RRP12 ribosomal RNA processing 12 homolog HGNC:29100 details
hsa-miR-16-5p RPL10L ribosomal protein L10 like HGNC:17976 details
hsa-miR-16-5p EIF3CL eukaryotic translation initiation factor 3 subunit C like HGNC:26347 details
hsa-miR-16-5p FASTKD2 FAST kinase domains 2 HGNC:29160 details
hsa-miR-16-5p details
hsa-miR-16-5p CDIPT CDP-diacylglycerol--inositol 3-phosphatidyltransferase HGNC:1769 details
hsa-miR-16-5p PLRG1 pleiotropic regulator 1 HGNC:9089 details
hsa-miR-16-5p VMA21 vacuolar ATPase assembly factor VMA21 HGNC:22082 details
hsa-miR-16-5p G3BP2 G3BP stress granule assembly factor 2 HGNC:30291 details
hsa-miR-16-5p PRKAR1A protein kinase cAMP-dependent type I regulatory subunit alpha HGNC:9388 details
hsa-miR-16-5p details
hsa-miR-16-5p AGK acylglycerol kinase HGNC:21869 details
hsa-miR-16-5p FDXR ferredoxin reductase HGNC:3642 details
hsa-miR-16-5p EIF3M eukaryotic translation initiation factor 3 subunit M HGNC:24460 details
hsa-miR-16-5p CDC23 cell division cycle 23 HGNC:1724 details
hsa-miR-16-5p MALSU1 mitochondrial assembly of ribosomal large subunit 1 HGNC:21721 details
hsa-miR-16-5p RACGAP1 Rac GTPase activating protein 1 HGNC:9804 details
hsa-miR-16-5p USP7 ubiquitin specific peptidase 7 HGNC:12630 details
hsa-miR-16-5p ZC3H11A zinc finger CCCH-type containing 11A HGNC:29093 details
hsa-miR-16-5p SRP72 signal recognition particle 72 HGNC:11303 details
hsa-miR-16-5p BZW1 basic leucine zipper and W2 domains 1 HGNC:18380 details
hsa-miR-16-5p RPS6KA3 ribosomal protein S6 kinase A3 HGNC:10432 details
hsa-miR-16-5p DLD dihydrolipoamide dehydrogenase HGNC:2898 details
hsa-miR-16-5p KDSR 3-ketodihydrosphingosine reductase HGNC:4021 details
hsa-miR-16-5p TERF2IP TERF2 interacting protein HGNC:19246 details
hsa-miR-16-5p NSF N-ethylmaleimide sensitive factor, vesicle fusing ATPase HGNC:8016 details
hsa-miR-16-5p USP42 ubiquitin specific peptidase 42 HGNC:20068 details
hsa-miR-16-5p EDC3 enhancer of mRNA decapping 3 HGNC:26114 details
hsa-miR-16-5p LAMP2 lysosomal associated membrane protein 2 HGNC:6501 details
hsa-miR-16-5p KCNG3 potassium voltage-gated channel modifier subfamily G member 3 HGNC:18306 details
hsa-miR-16-5p details
hsa-miR-16-5p AP3D1 adaptor related protein complex 3 subunit delta 1 HGNC:568 details
hsa-miR-16-5p ONECUT2 one cut homeobox 2 HGNC:8139 details
hsa-miR-16-5p OIP5 Opa interacting protein 5 HGNC:20300 details
hsa-miR-16-5p SP1 Sp1 transcription factor HGNC:11205 details
hsa-miR-16-5p CYB561A3 cytochrome b561 family member A3 HGNC:23014 details
hsa-miR-16-5p ENPP4 ectonucleotide pyrophosphatase/phosphodiesterase 4 HGNC:3359 details
hsa-miR-16-5p PRKAB2 protein kinase AMP-activated non-catalytic subunit beta 2 HGNC:9379 details
hsa-miR-16-5p KMT2A lysine methyltransferase 2A HGNC:7132 details
hsa-miR-16-5p TMEM245 transmembrane protein 245 HGNC:1363 details
hsa-miR-16-5p details
hsa-miR-16-5p CDC27 cell division cycle 27 HGNC:1728 details
hsa-miR-16-5p PLSCR4 phospholipid scramblase 4 HGNC:16497 details
hsa-miR-16-5p SEH1L SEH1 like nucleoporin HGNC:30379 details
hsa-miR-16-5p UBN2 ubinuclein 2 HGNC:21931 details
hsa-miR-16-5p DESI1 desumoylating isopeptidase 1 HGNC:24577 details
hsa-miR-16-5p CDK17 cyclin dependent kinase 17 HGNC:8750 details
hsa-miR-16-5p TLK1 tousled like kinase 1 HGNC:11841 details
hsa-miR-16-5p PLAG1 PLAG1 zinc finger HGNC:9045 details
hsa-miR-16-5p TBRG4 transforming growth factor beta regulator 4 HGNC:17443 details
hsa-miR-16-5p MPDU1 mannose-P-dolichol utilization defect 1 HGNC:7207 details
hsa-miR-16-5p details
hsa-miR-16-5p NCAPG non-SMC condensin I complex subunit G HGNC:24304 details
hsa-miR-16-5p RBM15B RNA binding motif protein 15B HGNC:24303 details
hsa-miR-16-5p RRP15 ribosomal RNA processing 15 homolog HGNC:24255 details
hsa-miR-16-5p NAMPT nicotinamide phosphoribosyltransferase HGNC:30092 details
hsa-miR-16-5p details
hsa-miR-16-5p COMMD10 COMM domain containing 10 HGNC:30201 details
hsa-miR-16-5p NRP1 neuropilin 1 HGNC:8004 details
hsa-miR-16-5p GEMIN5 gem nuclear organelle associated protein 5 HGNC:20043 details
hsa-miR-16-5p EPHA2 EPH receptor A2 HGNC:3386 details
hsa-miR-16-5p ASCC3 activating signal cointegrator 1 complex subunit 3 HGNC:18697 details
hsa-miR-16-5p PTPRJ protein tyrosine phosphatase receptor type J HGNC:9673 details
hsa-miR-16-5p PLAUR plasminogen activator, urokinase receptor HGNC:9053 details
hsa-miR-16-5p C1orf56 chromosome 1 open reading frame 56 HGNC:26045 details
hsa-miR-16-5p HSPA9 heat shock protein family A (Hsp70) member 9 HGNC:5244 details
hsa-miR-16-5p SLC25A6 solute carrier family 25 member 6 HGNC:10992 details
hsa-miR-16-5p AIMP1 aminoacyl tRNA synthetase complex interacting multifunctional protein 1 HGNC:10648 details
hsa-miR-16-5p CLNS1A chloride nucleotide-sensitive channel 1A HGNC:2080 details
hsa-miR-16-5p details
hsa-miR-16-5p MRPL3 mitochondrial ribosomal protein L3 HGNC:10379 details
hsa-miR-16-5p HSPBP1 HSPA (Hsp70) binding protein 1 HGNC:24989 details
hsa-miR-16-5p CDC20 cell division cycle 20 HGNC:1723 details
hsa-miR-16-5p PSMD12 proteasome 26S subunit, non-ATPase 12 HGNC:9557 details
hsa-miR-16-5p PLCXD2 phosphatidylinositol specific phospholipase C X domain containing 2 HGNC:26462 details
hsa-miR-16-5p EEF1A1 eukaryotic translation elongation factor 1 alpha 1 HGNC:3189 details
hsa-miR-16-5p DHX8 DEAH-box helicase 8 HGNC:2749 details
hsa-miR-16-5p TIMM13 translocase of inner mitochondrial membrane 13 HGNC:11816 details
hsa-miR-16-5p ELOVL5 ELOVL fatty acid elongase 5 HGNC:21308 details
hsa-miR-16-5p LY6K lymphocyte antigen 6 family member K HGNC:24225 details
hsa-miR-16-5p NOL11 nucleolar protein 11 HGNC:24557 details
hsa-miR-16-5p MRPS10 mitochondrial ribosomal protein S10 HGNC:14502 details
hsa-miR-16-5p details
hsa-miR-16-5p LARP4 La ribonucleoprotein 4 HGNC:24320 details
hsa-miR-16-5p MEPCE methylphosphate capping enzyme HGNC:20247 details
hsa-miR-16-5p DCUN1D5 defective in cullin neddylation 1 domain containing 5 HGNC:28409 details
hsa-miR-16-5p RPRD1B regulation of nuclear pre-mRNA domain containing 1B HGNC:16209 details
hsa-miR-16-5p RANGAP1 Ran GTPase activating protein 1 HGNC:9854 details
hsa-miR-16-5p RPL5 ribosomal protein L5 HGNC:10360 details
hsa-miR-16-5p MRPL10 mitochondrial ribosomal protein L10 HGNC:14055 details
hsa-miR-16-5p AHCYL1 adenosylhomocysteinase like 1 HGNC:344 details
hsa-miR-16-5p CLASP1 cytoplasmic linker associated protein 1 HGNC:17088 details
hsa-miR-16-5p EIF5B eukaryotic translation initiation factor 5B HGNC:30793 details
hsa-miR-16-5p EIF4G1 eukaryotic translation initiation factor 4 gamma 1 HGNC:3296 details
hsa-miR-16-5p SMAD5 SMAD family member 5 HGNC:6771 details
hsa-miR-16-5p NARF nuclear prelamin A recognition factor HGNC:29916 details
hsa-miR-16-5p MAP7 microtubule associated protein 7 HGNC:6869 details
hsa-miR-16-5p AHCYL2 adenosylhomocysteinase like 2 HGNC:22204 details
hsa-miR-16-5p NUP50 nucleoporin 50 HGNC:8065 details
hsa-miR-16-5p HSPA4L heat shock protein family A (Hsp70) member 4 like HGNC:17041 details
hsa-miR-16-5p TLE4 TLE family member 4, transcriptional corepressor HGNC:11840 details
hsa-miR-16-5p FBXL18 F-box and leucine rich repeat protein 18 HGNC:21874 details
hsa-miR-16-5p NDUFA4 NDUFA4 mitochondrial complex associated HGNC:7687 details
hsa-miR-16-5p RNMT RNA guanine-7 methyltransferase HGNC:10075 details
hsa-miR-16-5p AADAT aminoadipate aminotransferase HGNC:17929 details
hsa-miR-16-5p MTHFR methylenetetrahydrofolate reductase HGNC:7436 details
hsa-miR-16-5p SAV1 salvador family WW domain containing protein 1 HGNC:17795 details
hsa-miR-16-5p CARD10 caspase recruitment domain family member 10 HGNC:16422 details
hsa-miR-16-5p KCNC4 potassium voltage-gated channel subfamily C member 4 HGNC:6236 details
hsa-miR-16-5p SNX16 sorting nexin 16 HGNC:14980 details
hsa-miR-16-5p GABARAPL1 GABA type A receptor associated protein like 1 HGNC:4068 details
hsa-miR-16-5p details
hsa-miR-16-5p PRKAR2A protein kinase cAMP-dependent type II regulatory subunit alpha HGNC:9391 details
hsa-miR-16-5p SIRT4 sirtuin 4 HGNC:14932 details
hsa-miR-16-5p PHKA1 phosphorylase kinase regulatory subunit alpha 1 HGNC:8925 details
hsa-miR-16-5p TMCC1 transmembrane and coiled-coil domain family 1 HGNC:29116 details
hsa-miR-16-5p UBE2Q1 ubiquitin conjugating enzyme E2 Q1 HGNC:15698 details
hsa-miR-16-5p SLC35B2 solute carrier family 35 member B2 HGNC:16872 details
hsa-miR-16-5p AP2A1 adaptor related protein complex 2 subunit alpha 1 HGNC:561 details
hsa-miR-16-5p PUM1 pumilio RNA binding family member 1 HGNC:14957 details
hsa-miR-16-5p PWWP2A PWWP domain containing 2A HGNC:29406 details
hsa-miR-16-5p TUBA1C tubulin alpha 1c HGNC:20768 details
hsa-miR-16-5p TUBB3 tubulin beta 3 class III HGNC:20772 details
hsa-miR-16-5p ASNS asparagine synthetase (glutamine-hydrolyzing) HGNC:753 details
hsa-miR-16-5p HYAL3 hyaluronidase 3 HGNC:5322 details
hsa-miR-16-5p DNAJC1 DnaJ heat shock protein family (Hsp40) member C1 HGNC:20090 details
hsa-miR-16-5p SLC29A1 solute carrier family 29 member 1 (Augustine blood group) HGNC:11003 details
hsa-miR-16-5p STAU1 staufen double-stranded RNA binding protein 1 HGNC:11370 details
hsa-miR-16-5p TNFRSF10A TNF receptor superfamily member 10a HGNC:11904 details
hsa-miR-16-5p RPS2 ribosomal protein S2 HGNC:10404 details
hsa-miR-16-5p CENPF centromere protein F HGNC:1857 details
hsa-miR-16-5p RMDN1 regulator of microtubule dynamics 1 HGNC:24285 details
hsa-miR-16-5p SPATA5 spermatogenesis associated 5 HGNC:18119 details
hsa-miR-16-5p EARS2 glutamyl-tRNA synthetase 2, mitochondrial HGNC:29419 details
hsa-miR-16-5p CCT6B chaperonin containing TCP1 subunit 6B HGNC:1621 details
hsa-miR-16-5p PSMD11 proteasome 26S subunit, non-ATPase 11 HGNC:9556 details
hsa-miR-16-5p STRAP serine/threonine kinase receptor associated protein HGNC:30796 details
hsa-miR-16-5p COMT catechol-O-methyltransferase HGNC:2228 details
hsa-miR-16-5p SLIRP SRA stem-loop interacting RNA binding protein HGNC:20495 details
hsa-miR-16-5p GALNT3 polypeptide N-acetylgalactosaminyltransferase 3 HGNC:4125 details
hsa-miR-16-5p PRPSAP1 phosphoribosyl pyrophosphate synthetase associated protein 1 HGNC:9466 details
hsa-miR-16-5p DNAJC15 DnaJ heat shock protein family (Hsp40) member C15 HGNC:20325 details
hsa-miR-16-5p ANKLE2 ankyrin repeat and LEM domain containing 2 HGNC:29101 details
hsa-miR-16-5p PRNP prion protein HGNC:9449 details
hsa-miR-16-5p SLC38A2 solute carrier family 38 member 2 HGNC:13448 details
hsa-miR-16-5p ZNF598 zinc finger protein 598, E3 ubiquitin ligase HGNC:28079 details
hsa-miR-16-5p GTPBP8 GTP binding protein 8 (putative) HGNC:25007 details
hsa-miR-16-5p KIDINS220 kinase D interacting substrate 220 HGNC:29508 details
hsa-miR-16-5p VIM vimentin HGNC:12692 details
hsa-miR-16-5p DMAP1 DNA methyltransferase 1 associated protein 1 HGNC:18291 details
hsa-miR-16-5p SUPT16H SPT16 homolog, facilitates chromatin remodeling subunit HGNC:11465 details
hsa-miR-16-5p ELOVL1 ELOVL fatty acid elongase 1 HGNC:14418 details
hsa-miR-16-5p SNRPA1 small nuclear ribonucleoprotein polypeptide A' HGNC:11152 details
hsa-miR-16-5p COPS5 COP9 signalosome subunit 5 HGNC:2240 details
hsa-miR-16-5p CDK9 cyclin dependent kinase 9 HGNC:1780 details
hsa-miR-16-5p ASB6 ankyrin repeat and SOCS box containing 6 HGNC:17181 details
hsa-miR-16-5p TTC1 tetratricopeptide repeat domain 1 HGNC:12391 details
hsa-miR-16-5p RBMS3 RNA binding motif single stranded interacting protein 3 HGNC:13427 details
hsa-miR-16-5p MRPS25 mitochondrial ribosomal protein S25 HGNC:14511 details
hsa-miR-16-5p SUCLA2 succinate-CoA ligase ADP-forming subunit beta HGNC:11448 details
hsa-miR-16-5p MRPS2 mitochondrial ribosomal protein S2 HGNC:14495 details
hsa-miR-16-5p XPNPEP3 X-prolyl aminopeptidase 3 HGNC:28052 details
hsa-miR-16-5p SACM1L SAC1 like phosphatidylinositide phosphatase HGNC:17059 details
hsa-miR-16-5p EIF3A eukaryotic translation initiation factor 3 subunit A HGNC:3271 details
hsa-miR-16-5p TMEM87A transmembrane protein 87A HGNC:24522 details
hsa-miR-16-5p PPT1 palmitoyl-protein thioesterase 1 HGNC:9325 details
hsa-miR-16-5p RPLP0 ribosomal protein lateral stalk subunit P0 HGNC:10371 details
hsa-miR-16-5p PPP2R1A protein phosphatase 2 scaffold subunit Aalpha HGNC:9302 details
hsa-miR-16-5p EIF4B eukaryotic translation initiation factor 4B HGNC:3285 details
hsa-miR-16-5p SRPK1 SRSF protein kinase 1 HGNC:11305 details
hsa-miR-16-5p DOCK5 dedicator of cytokinesis 5 HGNC:23476 details
hsa-miR-16-5p SPRYD3 SPRY domain containing 3 HGNC:25920 details
hsa-miR-16-5p ATL2 atlastin GTPase 2 HGNC:24047 details
hsa-miR-16-5p CDV3 CDV3 homolog HGNC:26928 details
hsa-miR-16-5p CXorf38 chromosome X open reading frame 38 HGNC:28589 details
hsa-miR-16-5p FAM89A family with sequence similarity 89 member A HGNC:25057 details
hsa-miR-16-5p SLC25A39 solute carrier family 25 member 39 HGNC:24279 details
hsa-miR-16-5p GLRX glutaredoxin HGNC:4330 details
hsa-miR-16-5p DLC1 DLC1 Rho GTPase activating protein HGNC:2897 details
hsa-miR-16-5p HOXA3 homeobox A3 HGNC:5104 details
hsa-miR-16-5p CCNE2 cyclin E2 HGNC:1590 details
hsa-miR-16-5p ARL3 ADP ribosylation factor like GTPase 3 HGNC:694 details
hsa-miR-16-5p MYO5A myosin VA HGNC:7602 details
hsa-miR-16-5p VEZT vezatin, adherens junctions transmembrane protein HGNC:18258 details
hsa-miR-16-5p PAG1 phosphoprotein membrane anchor with glycosphingolipid microdomains 1 HGNC:30043 details
hsa-miR-16-5p DMTF1 cyclin D binding myb like transcription factor 1 HGNC:14603 details
hsa-miR-16-5p HELZ helicase with zinc finger HGNC:16878 details
hsa-miR-16-5p SLC11A2 solute carrier family 11 member 2 HGNC:10908 details
hsa-miR-16-5p RAB1B RAB1B, member RAS oncogene family HGNC:18370 details
hsa-miR-16-5p PNP purine nucleoside phosphorylase HGNC:7892 details
hsa-miR-16-5p KPNA1 karyopherin subunit alpha 1 HGNC:6394 details
hsa-miR-16-5p NUFIP2 nuclear FMR1 interacting protein 2 HGNC:17634 details
hsa-miR-16-5p SON SON DNA and RNA binding protein HGNC:11183 details
hsa-miR-16-5p HSD17B8 hydroxysteroid 17-beta dehydrogenase 8 HGNC:3554 details
hsa-miR-16-5p DDX21 DExD-box helicase 21 HGNC:2744 details
hsa-miR-16-5p DCAF13 DDB1 and CUL4 associated factor 13 HGNC:24535 details
hsa-miR-16-5p NOP14 NOP14 nucleolar protein HGNC:16821 details
hsa-miR-16-5p DAP3 death associated protein 3 HGNC:2673 details
hsa-miR-16-5p NTHL1 nth like DNA glycosylase 1 HGNC:8028 details
hsa-miR-16-5p PEX14 peroxisomal biogenesis factor 14 HGNC:8856 details
hsa-miR-16-5p TRMT13 tRNA methyltransferase 13 homolog HGNC:25502 details
hsa-miR-16-5p EIF5 eukaryotic translation initiation factor 5 HGNC:3299 details
hsa-miR-16-5p RABGGTB Rab geranylgeranyltransferase subunit beta HGNC:9796 details
hsa-miR-16-5p IDH3A isocitrate dehydrogenase (NAD(+)) 3 catalytic subunit alpha HGNC:5384 details
hsa-miR-16-5p THEM4 thioesterase superfamily member 4 HGNC:17947 details
hsa-miR-16-5p BMS1 BMS1 ribosome biogenesis factor HGNC:23505 details
hsa-miR-16-5p CPT1A carnitine palmitoyltransferase 1A HGNC:2328 details
hsa-miR-16-5p MLLT1 MLLT1 super elongation complex subunit HGNC:7134 details
hsa-miR-16-5p EDC4 enhancer of mRNA decapping 4 HGNC:17157 details
hsa-miR-16-5p CIB1 calcium and integrin binding 1 HGNC:16920 details
hsa-miR-16-5p NDUFAF4 NADH:ubiquinone oxidoreductase complex assembly factor 4 HGNC:21034 details
hsa-miR-16-5p OGDH oxoglutarate dehydrogenase HGNC:8124 details
hsa-miR-16-5p EIF2A eukaryotic translation initiation factor 2A HGNC:3254 details
hsa-miR-16-5p EEF2 eukaryotic translation elongation factor 2 HGNC:3214 details
hsa-miR-16-5p DNAJB1 DnaJ heat shock protein family (Hsp40) member B1 HGNC:5270 details
hsa-miR-16-5p TAF9 TATA-box binding protein associated factor 9 HGNC:11542 details
hsa-miR-16-5p RPS12 ribosomal protein S12 HGNC:10385 details
hsa-miR-16-5p TNFAIP2 TNF alpha induced protein 2 HGNC:11895 details
hsa-miR-16-5p TIMM17A translocase of inner mitochondrial membrane 17A HGNC:17315 details
hsa-miR-16-5p GRPEL2 GrpE like 2, mitochondrial HGNC:21060 details
hsa-miR-16-5p CNOT7 CCR4-NOT transcription complex subunit 7 HGNC:14101 details
hsa-miR-16-5p DMD dystrophin HGNC:2928 details
hsa-miR-16-5p RCL1 RNA terminal phosphate cyclase like 1 HGNC:17687 details
hsa-miR-16-5p SDHAF2 succinate dehydrogenase complex assembly factor 2 HGNC:26034 details
hsa-miR-16-5p YARS2 tyrosyl-tRNA synthetase 2 HGNC:24249 details
hsa-miR-16-5p GTF3C2 general transcription factor IIIC subunit 2 HGNC:4665 details
hsa-miR-16-5p LARP1 La ribonucleoprotein 1, translational regulator HGNC:29531 details
hsa-miR-16-5p VAMP8 vesicle associated membrane protein 8 HGNC:12647 details
hsa-miR-16-5p TFAP4 transcription factor AP-4 HGNC:11745 details
hsa-miR-16-5p DKC1 dyskerin pseudouridine synthase 1 HGNC:2890 details
hsa-miR-16-5p POLR3A RNA polymerase III subunit A HGNC:30074 details
hsa-miR-16-5p LRPPRC leucine rich pentatricopeptide repeat containing HGNC:15714 details
hsa-miR-16-5p DDX54 DEAD-box helicase 54 HGNC:20084 details
hsa-miR-16-5p CHP1 calcineurin like EF-hand protein 1 HGNC:17433 details
hsa-miR-16-5p B4GALT1 beta-1,4-galactosyltransferase 1 HGNC:924 details
hsa-miR-16-5p ATP6V1B2 ATPase H+ transporting V1 subunit B2 HGNC:854 details
hsa-miR-16-5p RIF1 replication timing regulatory factor 1 HGNC:23207 details
hsa-miR-16-5p NCAPD2 non-SMC condensin I complex subunit D2 HGNC:24305 details
hsa-miR-16-5p DCAF7 DDB1 and CUL4 associated factor 7 HGNC:30915 details
hsa-miR-16-5p SFXN1 sideroflexin 1 HGNC:16085 details
hsa-miR-16-5p YIPF4 Yip1 domain family member 4 HGNC:28145 details
hsa-miR-16-5p PRRC2C proline rich coiled-coil 2C HGNC:24903 details
hsa-miR-16-5p RBMS1 RNA binding motif single stranded interacting protein 1 HGNC:9907 details
hsa-miR-16-5p SRSF1 serine and arginine rich splicing factor 1 HGNC:10780 details
hsa-miR-16-5p PHC3 polyhomeotic homolog 3 HGNC:15682 details
hsa-miR-16-5p FURIN furin, paired basic amino acid cleaving enzyme HGNC:8568 details
hsa-miR-16-5p CCT3 chaperonin containing TCP1 subunit 3 HGNC:1616 details
hsa-miR-16-5p IFT74 intraflagellar transport 74 HGNC:21424 details
hsa-miR-16-5p details
hsa-miR-16-5p ZNF207 zinc finger protein 207 HGNC:12998 details
hsa-miR-16-5p RNF149 ring finger protein 149 HGNC:23137 details
hsa-miR-16-5p RUNX1T1 RUNX1 partner transcriptional co-repressor 1 HGNC:1535 details
hsa-miR-16-5p BTG2 BTG anti-proliferation factor 2 HGNC:1131 details
hsa-miR-16-5p ATG14 autophagy related 14 HGNC:19962 details
hsa-miR-16-5p details
hsa-miR-16-5p details
hsa-miR-16-5p ASH1L ASH1 like histone lysine methyltransferase HGNC:19088 details
hsa-miR-16-5p XPO7 exportin 7 HGNC:14108 details
hsa-miR-16-5p KPNA2 karyopherin subunit alpha 2 HGNC:6395 details
hsa-miR-16-5p HSPD1 heat shock protein family D (Hsp60) member 1 HGNC:5261 details
hsa-miR-16-5p IMPDH2 inosine monophosphate dehydrogenase 2 HGNC:6053 details
hsa-miR-16-5p COA6 cytochrome c oxidase assembly factor 6 HGNC:18025 details
hsa-miR-16-5p ASPH aspartate beta-hydroxylase HGNC:757 details
hsa-miR-16-5p CDKN2A cyclin dependent kinase inhibitor 2A HGNC:1787 details
hsa-miR-16-5p DTD1 D-aminoacyl-tRNA deacylase 1 HGNC:16219 details
hsa-miR-16-5p RRP36 ribosomal RNA processing 36 HGNC:21374 details
hsa-miR-16-5p details
hsa-miR-16-5p MRPS14 mitochondrial ribosomal protein S14 HGNC:14049 details
hsa-miR-16-5p HSPH1 heat shock protein family H (Hsp110) member 1 HGNC:16969 details
hsa-miR-16-5p SNX15 sorting nexin 15 HGNC:14978 details
hsa-miR-16-5p KIF23 kinesin family member 23 HGNC:6392 details
hsa-miR-16-5p PDIA6 protein disulfide isomerase family A member 6 HGNC:30168 details
hsa-miR-16-5p ABCC4 ATP binding cassette subfamily C member 4 HGNC:55 details
hsa-miR-16-5p TRAP1 TNF receptor associated protein 1 HGNC:16264 details
hsa-miR-16-5p TFPI tissue factor pathway inhibitor HGNC:11760 details
hsa-miR-16-5p VASN vasorin HGNC:18517 details
hsa-miR-16-5p SLC3A2 solute carrier family 3 member 2 HGNC:11026 details
hsa-miR-16-5p DDX31 DEAD-box helicase 31 HGNC:16715 details
hsa-miR-16-5p EIF3K eukaryotic translation initiation factor 3 subunit K HGNC:24656 details
hsa-miR-16-5p RPLP1 ribosomal protein lateral stalk subunit P1 HGNC:10372 details
hsa-miR-16-5p QSOX2 quiescin sulfhydryl oxidase 2 HGNC:30249 details
hsa-miR-16-5p MRFAP1 Morf4 family associated protein 1 HGNC:24549 details
hsa-miR-16-5p CUL4A cullin 4A HGNC:2554 details
hsa-miR-16-5p TRUB2 TruB pseudouridine synthase family member 2 HGNC:17170 details
hsa-miR-16-5p ELAC2 elaC ribonuclease Z 2 HGNC:14198 details
hsa-miR-16-5p PA2G4 proliferation-associated 2G4 HGNC:8550 details
hsa-miR-16-5p ALDH18A1 aldehyde dehydrogenase 18 family member A1 HGNC:9722 details
hsa-miR-16-5p KDM2A lysine demethylase 2A HGNC:13606 details
hsa-miR-16-5p NLE1 notchless homolog 1 HGNC:19889 details
hsa-miR-16-5p HEATR1 HEAT repeat containing 1 HGNC:25517 details
hsa-miR-16-5p PACSIN3 protein kinase C and casein kinase substrate in neurons 3 HGNC:8572 details
hsa-miR-16-5p RPL13 ribosomal protein L13 HGNC:10303 details
hsa-miR-16-5p RAB1A RAB1A, member RAS oncogene family HGNC:9758 details
hsa-miR-16-5p CKAP5 cytoskeleton associated protein 5 HGNC:28959 details
hsa-miR-16-5p SLC7A5 solute carrier family 7 member 5 HGNC:11063 details
hsa-miR-16-5p SEC61A1 SEC61 translocon subunit alpha 1 HGNC:18276 details
hsa-miR-16-5p PSME4 proteasome activator subunit 4 HGNC:20635 details
hsa-miR-16-5p CHPT1 choline phosphotransferase 1 HGNC:17852 details
hsa-miR-16-5p AFG3L2 AFG3 like matrix AAA peptidase subunit 2 HGNC:315 details
hsa-miR-16-5p APP amyloid beta precursor protein HGNC:620 details
hsa-miR-16-5p SPCS3 signal peptidase complex subunit 3 HGNC:26212 details
hsa-miR-16-5p HIGD1A HIG1 hypoxia inducible domain family member 1A HGNC:29527 details
hsa-miR-16-5p SPTBN2 spectrin beta, non-erythrocytic 2 HGNC:11276 details
hsa-miR-16-5p STXBP3 syntaxin binding protein 3 HGNC:11446 details
hsa-miR-16-5p DDX3X DEAD-box helicase 3 X-linked HGNC:2745 details
hsa-miR-16-5p IPO7 importin 7 HGNC:9852 details
hsa-miR-16-5p ATOX1 antioxidant 1 copper chaperone HGNC:798 details
hsa-miR-16-5p RAB23 RAB23, member RAS oncogene family HGNC:14263 details
hsa-miR-16-5p SF3A3 splicing factor 3a subunit 3 HGNC:10767 details
hsa-miR-16-5p FEM1C fem-1 homolog C HGNC:16933 details
hsa-miR-16-5p PDE4D phosphodiesterase 4D HGNC:8783 details
hsa-miR-16-5p AGPAT5 1-acylglycerol-3-phosphate O-acyltransferase 5 HGNC:20886 details
hsa-miR-16-5p CAMKK2 calcium/calmodulin dependent protein kinase kinase 2 HGNC:1470 details
hsa-miR-16-5p ATAD5 ATPase family AAA domain containing 5 HGNC:25752 details
hsa-miR-16-5p GCC1 GRIP and coiled-coil domain containing 1 HGNC:19095 details
hsa-miR-16-5p TFAP2A transcription factor AP-2 alpha HGNC:11742 details
hsa-miR-16-5p CNNM2 cyclin and CBS domain divalent metal cation transport mediator 2 HGNC:103 details
hsa-miR-16-5p EPC1 enhancer of polycomb homolog 1 HGNC:19876 details
hsa-miR-16-5p ZFHX3 zinc finger homeobox 3 HGNC:777 details
hsa-miR-16-5p HAUS3 HAUS augmin like complex subunit 3 HGNC:28719 details
hsa-miR-16-5p SLC9A6 solute carrier family 9 member A6 HGNC:11079 details
hsa-miR-16-5p USP15 ubiquitin specific peptidase 15 HGNC:12613 details
hsa-miR-16-5p PPP1R11 protein phosphatase 1 regulatory inhibitor subunit 11 HGNC:9285 details
hsa-miR-16-5p TNRC6B trinucleotide repeat containing adaptor 6B HGNC:29190 details
hsa-miR-16-5p C1orf21 chromosome 1 open reading frame 21 HGNC:15494 details
hsa-miR-16-5p GNB1 G protein subunit beta 1 HGNC:4396 details
hsa-miR-16-5p DNAJC9 DnaJ heat shock protein family (Hsp40) member C9 HGNC:19123 details
hsa-miR-16-5p SLC35A4 solute carrier family 35 member A4 HGNC:20753 details
hsa-miR-16-5p ANPEP alanyl aminopeptidase, membrane HGNC:500 details
hsa-miR-16-5p ALG2 ALG2 alpha-1,3/1,6-mannosyltransferase HGNC:23159 details
hsa-miR-16-5p PELO pelota mRNA surveillance and ribosome rescue factor HGNC:8829 details
hsa-miR-16-5p NOP10 NOP10 ribonucleoprotein HGNC:14378 details
hsa-miR-16-5p GTF3C1 general transcription factor IIIC subunit 1 HGNC:4664 details
hsa-miR-16-5p UTP3 UTP3 small subunit processome component HGNC:24477 details
hsa-miR-16-5p CDCA8 cell division cycle associated 8 HGNC:14629 details
hsa-miR-16-5p RPL30 ribosomal protein L30 HGNC:10333 details
hsa-miR-16-5p MTHFD1L methylenetetrahydrofolate dehydrogenase (NADP+ dependent) 1 like HGNC:21055 details
hsa-miR-16-5p ITGB4 integrin subunit beta 4 HGNC:6158 details
hsa-miR-16-5p UXT ubiquitously expressed prefoldin like chaperone HGNC:12641 details
hsa-miR-16-5p TPBG trophoblast glycoprotein HGNC:12004 details
hsa-miR-16-5p ATP6V1E1 ATPase H+ transporting V1 subunit E1 HGNC:857 details
hsa-miR-16-5p AIFM2 apoptosis inducing factor mitochondria associated 2 HGNC:21411 details
hsa-miR-16-5p CNPY3 canopy FGF signaling regulator 3 HGNC:11968 details
hsa-miR-16-5p CDK1 cyclin dependent kinase 1 HGNC:1722 details
hsa-miR-16-5p PABPC4 poly(A) binding protein cytoplasmic 4 HGNC:8557 details
hsa-miR-16-5p details
hsa-miR-16-5p DHX37 DEAH-box helicase 37 HGNC:17210 details
hsa-miR-16-5p BYSL bystin like HGNC:1157 details
hsa-miR-16-5p RAB12 RAB12, member RAS oncogene family HGNC:31332 details
hsa-miR-16-5p MACF1 microtubule actin crosslinking factor 1 HGNC:13664 details
hsa-miR-16-5p KIF2A kinesin family member 2A HGNC:6318 details
hsa-miR-16-5p AGRN agrin HGNC:329 details
hsa-miR-16-5p CDC5L cell division cycle 5 like HGNC:1743 details
hsa-miR-16-5p TMEM41A transmembrane protein 41A HGNC:30544 details
hsa-miR-16-5p PSMC2 proteasome 26S subunit, ATPase 2 HGNC:9548 details
hsa-miR-16-5p TTC17 tetratricopeptide repeat domain 17 HGNC:25596 details
hsa-miR-16-5p EML4 EMAP like 4 HGNC:1316 details
hsa-miR-16-5p UTP20 UTP20 small subunit processome component HGNC:17897 details
hsa-miR-16-5p CLUH clustered mitochondria homolog HGNC:29094 details
hsa-miR-16-5p XPOT exportin for tRNA HGNC:12826 details
hsa-miR-16-5p PSME3 proteasome activator subunit 3 HGNC:9570 details
hsa-miR-16-5p NEMF nuclear export mediator factor HGNC:10663 details
hsa-miR-16-5p HSPA5 heat shock protein family A (Hsp70) member 5 HGNC:5238 details
hsa-miR-16-5p TMTC3 transmembrane O-mannosyltransferase targeting cadherins 3 HGNC:26899 details
hsa-miR-16-5p MRRF mitochondrial ribosome recycling factor HGNC:7234 details
hsa-miR-16-5p ERLIN2 ER lipid raft associated 2 HGNC:1356 details
hsa-miR-16-5p NUP160 nucleoporin 160 HGNC:18017 details
hsa-miR-16-5p AHNAK2 AHNAK nucleoprotein 2 HGNC:20125 details
hsa-miR-16-5p MFN2 mitofusin 2 HGNC:16877 details
hsa-miR-16-5p LMO7 LIM domain 7 HGNC:6646 details
hsa-miR-16-5p SYPL1 synaptophysin like 1 HGNC:11507 details
hsa-miR-16-5p CSDE1 cold shock domain containing E1 HGNC:29905 details
hsa-miR-16-5p ANKRD17 ankyrin repeat domain 17 HGNC:23575 details
hsa-miR-16-5p RNF111 ring finger protein 111 HGNC:17384 details
hsa-miR-16-5p EXD2 exonuclease 3'-5' domain containing 2 HGNC:20217 details
hsa-miR-16-5p NHLRC3 NHL repeat containing 3 HGNC:33751 details
hsa-miR-16-5p ACBD5 acyl-CoA binding domain containing 5 HGNC:23338 details
hsa-miR-16-5p OSBPL3 oxysterol binding protein like 3 HGNC:16370 details
hsa-miR-16-5p GPR180 G protein-coupled receptor 180 HGNC:28899 details
hsa-miR-16-5p AGO2 argonaute RISC catalytic component 2 HGNC:3263 details
hsa-miR-16-5p PAPOLG poly(A) polymerase gamma HGNC:14982 details
hsa-miR-16-5p STK38 serine/threonine kinase 38 HGNC:17847 details
hsa-miR-16-5p CD274 CD274 molecule HGNC:17635 details
hsa-miR-16-5p MLLT6 MLLT6, PHD finger containing HGNC:7138 details
hsa-miR-16-5p GTPBP1 GTP binding protein 1 HGNC:4669 details
hsa-miR-16-5p MED13 mediator complex subunit 13 HGNC:22474 details
hsa-miR-16-5p SETD1B SET domain containing 1B, histone lysine methyltransferase HGNC:29187 details
hsa-miR-16-5p IPPK inositol-pentakisphosphate 2-kinase HGNC:14645 details
hsa-miR-16-5p SYNJ1 synaptojanin 1 HGNC:11503 details
hsa-miR-16-5p RNF217 ring finger protein 217 HGNC:21487 details
hsa-miR-16-5p RNF144B ring finger protein 144B HGNC:21578 details
hsa-miR-16-5p RFK riboflavin kinase HGNC:30324 details
hsa-miR-16-5p SPRED1 sprouty related EVH1 domain containing 1 HGNC:20249 details
hsa-miR-16-5p CYP26B1 cytochrome P450 family 26 subfamily B member 1 HGNC:20581 details
hsa-miR-16-5p MIB1 MIB E3 ubiquitin protein ligase 1 HGNC:21086 details
hsa-miR-16-5p CAPZA2 capping actin protein of muscle Z-line subunit alpha 2 HGNC:1490 details
hsa-miR-16-5p WEE1 WEE1 G2 checkpoint kinase HGNC:12761 details
hsa-miR-16-5p CDCA4 cell division cycle associated 4 HGNC:14625 details
hsa-miR-16-5p MAP4 microtubule associated protein 4 HGNC:6862 details
hsa-miR-16-5p GOLT1B golgi transport 1B HGNC:20175 details
hsa-miR-16-5p PPP6C protein phosphatase 6 catalytic subunit HGNC:9323 details
hsa-miR-16-5p LAMB3 laminin subunit beta 3 HGNC:6490 details
hsa-miR-16-5p MTHFD2 methylenetetrahydrofolate dehydrogenase (NADP+ dependent) 2, methenyltetrahydrofolate cyclohydrolase HGNC:7434 details
hsa-miR-16-5p POLDIP2 DNA polymerase delta interacting protein 2 HGNC:23781 details
hsa-miR-16-5p RPS25 ribosomal protein S25 HGNC:10413 details
hsa-miR-16-5p details
hsa-miR-16-5p GLT8D1 glycosyltransferase 8 domain containing 1 HGNC:24870 details
hsa-miR-16-5p RPL3 ribosomal protein L3 HGNC:10332 details
hsa-miR-16-5p EIF3H eukaryotic translation initiation factor 3 subunit H HGNC:3273 details
hsa-miR-16-5p details
hsa-miR-16-5p LYAR Ly1 antibody reactive HGNC:26021 details
hsa-miR-16-5p DUSP14 dual specificity phosphatase 14 HGNC:17007 details
hsa-miR-16-5p SSU72 SSU72 homolog, RNA polymerase II CTD phosphatase HGNC:25016 details
hsa-miR-16-5p OXNAD1 oxidoreductase NAD binding domain containing 1 HGNC:25128 details
hsa-miR-16-5p FTH1 ferritin heavy chain 1 HGNC:3976 details
hsa-miR-16-5p RBM28 RNA binding motif protein 28 HGNC:21863 details
hsa-miR-16-5p details
hsa-miR-16-5p RPL21 ribosomal protein L21 HGNC:10313 details
hsa-miR-16-5p RRP9 ribosomal RNA processing 9, U3 small nucleolar RNA binding protein HGNC:16829 details
hsa-miR-16-5p details
hsa-miR-16-5p ACTG1 actin gamma 1 HGNC:144 details
hsa-miR-16-5p PCK2 phosphoenolpyruvate carboxykinase 2, mitochondrial HGNC:8725 details
hsa-miR-16-5p HSP90AA1 heat shock protein 90 alpha family class A member 1 HGNC:5253 details
hsa-miR-16-5p LSG1 large 60S subunit nuclear export GTPase 1 HGNC:25652 details
hsa-miR-16-5p SLC25A32 solute carrier family 25 member 32 HGNC:29683 details
hsa-miR-16-5p AAAS aladin WD repeat nucleoporin HGNC:13666 details
hsa-miR-16-5p MRPS23 mitochondrial ribosomal protein S23 HGNC:14509 details
hsa-miR-16-5p details
hsa-miR-16-5p MERTK MER proto-oncogene, tyrosine kinase HGNC:7027 details
hsa-miR-16-5p GTF3C4 general transcription factor IIIC subunit 4 HGNC:4667 details
hsa-miR-16-5p SRP19 signal recognition particle 19 HGNC:11300 details
hsa-miR-16-5p details
hsa-miR-16-5p WNT5A Wnt family member 5A HGNC:12784 details
hsa-miR-16-5p CDK2 cyclin dependent kinase 2 HGNC:1771 details
hsa-miR-16-5p GTF3C3 general transcription factor IIIC subunit 3 HGNC:4666 details
hsa-miR-16-5p IWS1 interacts with SUPT6H, CTD assembly factor 1 HGNC:25467 details
hsa-miR-16-5p TTLL12 tubulin tyrosine ligase like 12 HGNC:28974 details
hsa-miR-16-5p PVR PVR cell adhesion molecule HGNC:9705 details
hsa-miR-16-5p KIF2C kinesin family member 2C HGNC:6393 details
hsa-miR-16-5p TBL3 transducin beta like 3 HGNC:11587 details
hsa-miR-16-5p CAMK2G calcium/calmodulin dependent protein kinase II gamma HGNC:1463 details
hsa-miR-16-5p ATXN2L ataxin 2 like HGNC:31326 details
hsa-miR-16-5p RPSA ribosomal protein SA HGNC:6502 details
hsa-miR-16-5p TSPAN3 tetraspanin 3 HGNC:17752 details
hsa-miR-16-5p SCAF4 SR-related CTD associated factor 4 HGNC:19304 details
hsa-miR-16-5p COPS7B COP9 signalosome subunit 7B HGNC:16760 details
hsa-miR-16-5p HNRNPDL heterogeneous nuclear ribonucleoprotein D like HGNC:5037 details
hsa-miR-16-5p C17orf75 chromosome 17 open reading frame 75 HGNC:30173 details
hsa-miR-16-5p WDR75 WD repeat domain 75 HGNC:25725 details
hsa-miR-16-5p AP2B1 adaptor related protein complex 2 subunit beta 1 HGNC:563 details
hsa-miR-16-5p BTF3 basic transcription factor 3 HGNC:1125 details
hsa-miR-16-5p SMURF2 SMAD specific E3 ubiquitin protein ligase 2 HGNC:16809 details
hsa-miR-16-5p KIF1B kinesin family member 1B HGNC:16636 details
hsa-miR-16-5p CASK calcium/calmodulin dependent serine protein kinase HGNC:1497 details
hsa-miR-16-5p RPL14 ribosomal protein L14 HGNC:10305 details
hsa-miR-16-5p CDC37 cell division cycle 37, HSP90 cochaperone HGNC:1735 details
hsa-miR-16-5p SOWAHC sosondowah ankyrin repeat domain family member C HGNC:26149 details
hsa-miR-16-5p CDADC1 cytidine and dCMP deaminase domain containing 1 HGNC:20299 details
hsa-miR-16-5p SPATA2 spermatogenesis associated 2 HGNC:14681 details
hsa-miR-16-5p PRR3 proline rich 3 HGNC:21149 details
hsa-miR-16-5p UFC1 ubiquitin-fold modifier conjugating enzyme 1 HGNC:26941 details
hsa-miR-16-5p CPSF7 cleavage and polyadenylation specific factor 7 HGNC:30098 details
hsa-miR-16-5p CRKL CRK like proto-oncogene, adaptor protein HGNC:2363 details
hsa-miR-16-5p FAT3 FAT atypical cadherin 3 HGNC:23112 details
hsa-miR-16-5p SZRD1 SUZ RNA binding domain containing 1 HGNC:30232 details
hsa-miR-16-5p EN2 engrailed homeobox 2 HGNC:3343 details
hsa-miR-16-5p MYO5B myosin VB HGNC:7603 details
hsa-miR-16-5p PDK4 pyruvate dehydrogenase kinase 4 HGNC:8812 details
hsa-miR-16-5p C2orf42 chromosome 2 open reading frame 42 HGNC:26056 details
hsa-miR-16-5p CDC37L1 cell division cycle 37 like 1 HGNC:17179 details
hsa-miR-16-5p FBXW7 F-box and WD repeat domain containing 7 HGNC:16712 details
hsa-miR-16-5p STK33 serine/threonine kinase 33 HGNC:14568 details
hsa-miR-16-5p details
hsa-miR-16-5p details
hsa-miR-16-5p AK2 adenylate kinase 2 HGNC:362 details
hsa-miR-16-5p PAK1IP1 PAK1 interacting protein 1 HGNC:20882 details
hsa-miR-16-5p PSPH phosphoserine phosphatase HGNC:9577 details
hsa-miR-16-5p RPL31 ribosomal protein L31 HGNC:10334 details
hsa-miR-16-5p details
hsa-miR-16-5p ARG2 arginase 2 HGNC:664 details
hsa-miR-16-5p STIP1 stress induced phosphoprotein 1 HGNC:11387 details
hsa-miR-16-5p ARPC5L actin related protein 2/3 complex subunit 5 like HGNC:23366 details
hsa-miR-16-5p EIF3F eukaryotic translation initiation factor 3 subunit F HGNC:3275 details
hsa-miR-16-5p IPO11 importin 11 HGNC:20628 details
hsa-miR-16-5p RPS3A ribosomal protein S3A HGNC:10421 details
hsa-miR-16-5p UTP14A UTP14A small subunit processome component HGNC:10665 details
hsa-miR-16-5p SLC4A1AP solute carrier family 4 member 1 adaptor protein HGNC:13813 details
hsa-miR-16-5p MRPL21 mitochondrial ribosomal protein L21 HGNC:14479 details
hsa-miR-16-5p LAMTOR4 late endosomal/lysosomal adaptor, MAPK and MTOR activator 4 HGNC:33772 details
hsa-miR-16-5p RPL6 ribosomal protein L6 HGNC:10362 details
hsa-miR-16-5p KIN Kin17 DNA and RNA binding protein HGNC:6327 details
hsa-miR-16-5p POLR1C RNA polymerase I and III subunit C HGNC:20194 details
hsa-miR-16-5p HTRA1 HtrA serine peptidase 1 HGNC:9476 details
hsa-miR-16-5p MRPS35 mitochondrial ribosomal protein S35 HGNC:16635 details
hsa-miR-16-5p GEMIN4 gem nuclear organelle associated protein 4 HGNC:15717 details
hsa-miR-16-5p details
hsa-miR-16-5p TTF2 transcription termination factor 2 HGNC:12398 details
hsa-miR-16-5p NACA nascent polypeptide associated complex subunit alpha HGNC:7629 details
hsa-miR-16-5p ZRANB2 zinc finger RANBP2-type containing 2 HGNC:13058 details
hsa-miR-16-5p PDLIM5 PDZ and LIM domain 5 HGNC:17468 details
hsa-miR-16-5p L1CAM L1 cell adhesion molecule HGNC:6470 details
hsa-miR-16-5p TELO2 telomere maintenance 2 HGNC:29099 details
hsa-miR-16-5p KIF14 kinesin family member 14 HGNC:19181 details
hsa-miR-16-5p MORF4L1 mortality factor 4 like 1 HGNC:16989 details
hsa-miR-16-5p PDHX pyruvate dehydrogenase complex component X HGNC:21350 details
hsa-miR-16-5p SCAMP3 secretory carrier membrane protein 3 HGNC:10565 details
hsa-miR-16-5p details
hsa-miR-16-5p PLEC plectin HGNC:9069 details
hsa-miR-16-5p RPRD2 regulation of nuclear pre-mRNA domain containing 2 HGNC:29039 details
hsa-miR-16-5p ATP8A2 ATPase phospholipid transporting 8A2 HGNC:13533 details
hsa-miR-16-5p details
hsa-miR-16-5p DNAJA1 DnaJ heat shock protein family (Hsp40) member A1 HGNC:5229 details
hsa-miR-16-5p EFNB2 ephrin B2 HGNC:3227 details
hsa-miR-16-5p FAM189B family with sequence similarity 189 member B HGNC:1233 details
hsa-miR-16-5p LAMB1 laminin subunit beta 1 HGNC:6486 details
hsa-miR-16-5p TNPO1 transportin 1 HGNC:6401 details
hsa-miR-16-5p PDPR pyruvate dehydrogenase phosphatase regulatory subunit HGNC:30264 details
hsa-miR-16-5p CDS2 CDP-diacylglycerol synthase 2 HGNC:1801 details
hsa-miR-16-5p LMAN2L lectin, mannose binding 2 like HGNC:19263 details
hsa-miR-16-5p DDX3Y DEAD-box helicase 3 Y-linked HGNC:2699 details
hsa-miR-16-5p PAGR1 PAXIP1 associated glutamate rich protein 1 HGNC:28707 details
hsa-miR-16-5p TOX4 TOX high mobility group box family member 4 HGNC:20161 details
hsa-miR-16-5p CALU calumenin HGNC:1458 details
hsa-miR-16-5p PTPDC1 protein tyrosine phosphatase domain containing 1 HGNC:30184 details
hsa-miR-16-5p USP53 ubiquitin specific peptidase 53 HGNC:29255 details
hsa-miR-16-5p FAM168A family with sequence similarity 168 member A HGNC:28999 details
hsa-miR-16-5p CAMSAP1 calmodulin regulated spectrin associated protein 1 HGNC:19946 details
hsa-miR-16-5p VPS4A vacuolar protein sorting 4 homolog A HGNC:13488 details
hsa-miR-16-5p UBFD1 ubiquitin family domain containing 1 HGNC:30565 details
hsa-miR-16-5p PAQR3 progestin and adipoQ receptor family member 3 HGNC:30130 details
hsa-miR-16-5p C16orf72 chromosome 16 open reading frame 72 HGNC:30103 details
hsa-miR-16-5p TMEM255A transmembrane protein 255A HGNC:26086 details
hsa-miR-16-5p PHF19 PHD finger protein 19 HGNC:24566 details
hsa-miR-16-5p ATXN7L3 ataxin 7 like 3 HGNC:25416 details
hsa-miR-16-5p JARID2 jumonji and AT-rich interaction domain containing 2 HGNC:6196 details
hsa-miR-16-5p E2F7 E2F transcription factor 7 HGNC:23820 details
hsa-miR-16-5p KIF5A kinesin family member 5A HGNC:6323 details
hsa-miR-16-5p PTPN3 protein tyrosine phosphatase non-receptor type 3 HGNC:9655 details
hsa-miR-16-5p details
hsa-miR-16-5p YWHAH tyrosine 3-monooxygenase/tryptophan 5-monooxygenase activation protein eta HGNC:12853 details
hsa-miR-16-5p MOV10 Mov10 RISC complex RNA helicase HGNC:7200 details
hsa-miR-16-5p FASTKD1 FAST kinase domains 1 HGNC:26150 details
hsa-miR-16-5p UFSP2 UFM1 specific peptidase 2 HGNC:25640 details
hsa-miR-16-5p PLEKHN1 pleckstrin homology domain containing N1 HGNC:25284 details
hsa-miR-16-5p KLF14 Kruppel like factor 14 HGNC:23025 details
hsa-miR-16-5p AKAP13 A-kinase anchoring protein 13 HGNC:371 details
hsa-miR-16-5p PHEX phosphate regulating endopeptidase homolog X-linked HGNC:8918 details
hsa-miR-16-5p IL36RN interleukin 36 receptor antagonist HGNC:15561 details
hsa-miR-16-5p CACNB2 calcium voltage-gated channel auxiliary subunit beta 2 HGNC:1402 details
hsa-miR-16-5p PRPF8 pre-mRNA processing factor 8 HGNC:17340 details
hsa-miR-16-5p NAV2 neuron navigator 2 HGNC:15997 details
hsa-miR-16-5p OTUD7B OTU deubiquitinase 7B HGNC:16683 details
hsa-miR-16-5p JAK2 Janus kinase 2 HGNC:6192 details
hsa-miR-16-5p RSL1D1 ribosomal L1 domain containing 1 HGNC:24534 details
hsa-miR-16-5p TXNL1 thioredoxin like 1 HGNC:12436 details
hsa-miR-16-5p CAMKV CaM kinase like vesicle associated HGNC:28788 details
hsa-miR-16-5p FBXO3 F-box protein 3 HGNC:13582 details
hsa-miR-16-5p CPNE8 copine 8 HGNC:23498 details
hsa-miR-16-5p COL4A1 collagen type IV alpha 1 chain HGNC:2202 details
hsa-miR-16-5p SENP6 SUMO specific peptidase 6 HGNC:20944 details
hsa-miR-16-5p PRR12 proline rich 12 HGNC:29217 details
hsa-miR-16-5p SERINC5 serine incorporator 5 HGNC:18825 details
hsa-miR-16-5p AMPD1 adenosine monophosphate deaminase 1 HGNC:468 details
hsa-miR-16-5p FNBP1 formin binding protein 1 HGNC:17069 details
hsa-miR-16-5p details
hsa-miR-16-5p CYP27B1 cytochrome P450 family 27 subfamily B member 1 HGNC:2606 details
hsa-miR-16-5p CHD3 chromodomain helicase DNA binding protein 3 HGNC:1918 details
hsa-miR-16-5p LIG4 DNA ligase 4 HGNC:6601 details
hsa-miR-16-5p RPS24 ribosomal protein S24 HGNC:10411 details
hsa-miR-16-5p S100A14 S100 calcium binding protein A14 HGNC:18901 details
hsa-miR-16-5p PTPRT protein tyrosine phosphatase receptor type T HGNC:9682 details
hsa-miR-16-5p TNK1 tyrosine kinase non receptor 1 HGNC:11940 details
hsa-miR-16-5p FBXW11 F-box and WD repeat domain containing 11 HGNC:13607 details
hsa-miR-16-5p MLF2 myeloid leukemia factor 2 HGNC:7126 details
hsa-miR-16-5p HNRNPF heterogeneous nuclear ribonucleoprotein F HGNC:5039 details
hsa-miR-16-5p ZNF638 zinc finger protein 638 HGNC:17894 details
hsa-miR-16-5p TIMP3 TIMP metallopeptidase inhibitor 3 HGNC:11822 details
hsa-miR-16-5p DIXDC1 DIX domain containing 1 HGNC:23695 details
hsa-miR-16-5p EEF2K eukaryotic elongation factor 2 kinase HGNC:24615 details
hsa-miR-16-5p TMEM154 transmembrane protein 154 HGNC:26489 details
hsa-miR-16-5p ORAI2 ORAI calcium release-activated calcium modulator 2 HGNC:21667 details
hsa-miR-16-5p SLFN13 schlafen family member 13 HGNC:26481 details
hsa-miR-16-5p DDX6 DEAD-box helicase 6 HGNC:2747 details
hsa-miR-16-5p details
hsa-miR-16-5p IDS iduronate 2-sulfatase HGNC:5389 details
hsa-miR-16-5p C19orf54 chromosome 19 open reading frame 54 HGNC:24758 details
hsa-miR-16-5p PIP4K2B phosphatidylinositol-5-phosphate 4-kinase type 2 beta HGNC:8998 details
hsa-miR-16-5p OTOL1 otolin 1 HGNC:34071 details
hsa-miR-16-5p AGER advanced glycosylation end-product specific receptor HGNC:320 details
hsa-miR-16-5p PGLYRP1 peptidoglycan recognition protein 1 HGNC:8904 details
hsa-miR-16-5p ACTN4 actinin alpha 4 HGNC:166 details
hsa-miR-16-5p GLB1L3 galactosidase beta 1 like 3 HGNC:25147 details
hsa-miR-16-5p FSCN2 fascin actin-bundling protein 2, retinal HGNC:3960 details
hsa-miR-16-5p NXPH2 neurexophilin 2 HGNC:8076 details
hsa-miR-16-5p CABIN1 calcineurin binding protein 1 HGNC:24187 details
hsa-miR-16-5p MOB3C MOB kinase activator 3C HGNC:29800 details
hsa-miR-16-5p ADK adenosine kinase HGNC:257 details
hsa-miR-16-5p ARL2BP ADP ribosylation factor like GTPase 2 binding protein HGNC:17146 details
hsa-miR-16-5p RP1L1 RP1 like 1 HGNC:15946 details
hsa-miR-16-5p GPR157 G protein-coupled receptor 157 HGNC:23687 details
hsa-miR-16-5p IRS4 insulin receptor substrate 4 HGNC:6128 details
hsa-miR-16-5p KLHL34 kelch like family member 34 HGNC:26634 details
hsa-miR-16-5p HSPA8 heat shock protein family A (Hsp70) member 8 HGNC:5241 details
hsa-miR-16-5p CSGALNACT1 chondroitin sulfate N-acetylgalactosaminyltransferase 1 HGNC:24290 details
hsa-miR-16-5p FAT2 FAT atypical cadherin 2 HGNC:3596 details
hsa-miR-16-5p RPS3 ribosomal protein S3 HGNC:10420 details
hsa-miR-16-5p DHTKD1 dehydrogenase E1 and transketolase domain containing 1 HGNC:23537 details
hsa-miR-16-5p HNRNPL heterogeneous nuclear ribonucleoprotein L HGNC:5045 details
hsa-miR-16-5p SYT11 synaptotagmin 11 HGNC:19239 details
hsa-miR-16-5p VKORC1 vitamin K epoxide reductase complex subunit 1 HGNC:23663 details
hsa-miR-16-5p GPR55 G protein-coupled receptor 55 HGNC:4511 details
hsa-miR-16-5p MRC2 mannose receptor C type 2 HGNC:16875 details
hsa-miR-16-5p LSM5 LSM5 homolog, U6 small nuclear RNA and mRNA degradation associated HGNC:17162 details
hsa-miR-16-5p DDN dendrin HGNC:24458 details
hsa-miR-16-5p COL4A2 collagen type IV alpha 2 chain HGNC:2203 details
hsa-miR-16-5p UBXN2B UBX domain protein 2B HGNC:27035 details
hsa-miR-16-5p GNAL G protein subunit alpha L HGNC:4388 details
hsa-miR-16-5p ZNF644 zinc finger protein 644 HGNC:29222 details
hsa-miR-16-5p ROGDI rogdi atypical leucine zipper HGNC:29478 details
hsa-miR-16-5p MMP25 matrix metallopeptidase 25 HGNC:14246 details
hsa-miR-16-5p RIOK3 RIO kinase 3 HGNC:11451 details
hsa-miR-16-5p GSTT2B glutathione S-transferase theta 2B HGNC:33437 details
hsa-miR-16-5p APLNR apelin receptor HGNC:339 details
hsa-miR-16-5p IGSF1 immunoglobulin superfamily member 1 HGNC:5948 details
hsa-miR-16-5p CCT8 chaperonin containing TCP1 subunit 8 HGNC:1623 details
hsa-miR-16-5p details
hsa-miR-16-5p LYPD2 LY6/PLAUR domain containing 2 HGNC:25215 details
hsa-miR-16-5p YIPF2 Yip1 domain family member 2 HGNC:28476 details
hsa-miR-16-5p KCND3 potassium voltage-gated channel subfamily D member 3 HGNC:6239 details
hsa-miR-16-5p details
hsa-miR-16-5p SF3B3 splicing factor 3b subunit 3 HGNC:10770 details
hsa-miR-16-5p RPH3AL rabphilin 3A like (without C2 domains) HGNC:10296 details
hsa-miR-16-5p LONRF2 LON peptidase N-terminal domain and ring finger 2 HGNC:24788 details
hsa-miR-16-5p SUPT5H SPT5 homolog, DSIF elongation factor subunit HGNC:11469 details
hsa-miR-16-5p SOCS5 suppressor of cytokine signaling 5 HGNC:16852 details
hsa-miR-16-5p POLB DNA polymerase beta HGNC:9174 details
hsa-miR-16-5p details
hsa-miR-16-5p ADAD2 adenosine deaminase domain containing 2 HGNC:30714 details
hsa-miR-16-5p CLIP2 CAP-Gly domain containing linker protein 2 HGNC:2586 details
hsa-miR-16-5p IPO5 importin 5 HGNC:6402 details
hsa-miR-16-5p POTEF POTE ankyrin domain family member F HGNC:33905 details
hsa-miR-16-5p LIMA1 LIM domain and actin binding 1 HGNC:24636 details
hsa-miR-16-5p ACTN1 actinin alpha 1 HGNC:163 details
hsa-miR-16-5p details
hsa-miR-16-5p IRAK3 interleukin 1 receptor associated kinase 3 HGNC:17020 details
hsa-miR-16-5p details
hsa-miR-16-5p TMED1 transmembrane p24 trafficking protein 1 HGNC:17291 details
hsa-miR-16-5p BNC2 basonuclin 2 HGNC:30988 details
hsa-miR-16-5p WDR5B WD repeat domain 5B HGNC:17826 details
hsa-miR-16-5p INO80D INO80 complex subunit D HGNC:25997 details
hsa-miR-16-5p USP8 ubiquitin specific peptidase 8 HGNC:12631 details
hsa-miR-16-5p RPS17 ribosomal protein S17 HGNC:10397 details
hsa-miR-16-5p ATP6V0E1 ATPase H+ transporting V0 subunit e1 HGNC:863 details
hsa-miR-16-5p AMOT angiomotin HGNC:17810 details
hsa-miR-16-5p AMER1 APC membrane recruitment protein 1 HGNC:26837 details
hsa-miR-16-5p NEURL4 neuralized E3 ubiquitin protein ligase 4 HGNC:34410 details
hsa-miR-16-5p details
hsa-miR-16-5p UBE2Z ubiquitin conjugating enzyme E2 Z HGNC:25847 details
hsa-miR-16-5p RAN RAN, member RAS oncogene family HGNC:9846 details
hsa-miR-16-5p details
hsa-miR-16-5p FBXO41 F-box protein 41 HGNC:29409 details
hsa-miR-16-5p XYLT1 xylosyltransferase 1 HGNC:15516 details
hsa-miR-16-5p DOCK9 dedicator of cytokinesis 9 HGNC:14132 details
hsa-miR-16-5p LONP1 lon peptidase 1, mitochondrial HGNC:9479 details
hsa-miR-16-5p ARL10 ADP ribosylation factor like GTPase 10 HGNC:22042 details
hsa-miR-16-5p GPAA1 glycosylphosphatidylinositol anchor attachment 1 HGNC:4446 details
hsa-miR-16-5p VCL vinculin HGNC:12665 details
hsa-miR-16-5p TIGD3 tigger transposable element derived 3 HGNC:18334 details
hsa-miR-16-5p MSL3 MSL complex subunit 3 HGNC:7370 details
hsa-miR-16-5p KANSL3 KAT8 regulatory NSL complex subunit 3 HGNC:25473 details
hsa-miR-16-5p ZNF280C zinc finger protein 280C HGNC:25955 details
hsa-miR-16-5p RUNDC3B RUN domain containing 3B HGNC:30286 details
hsa-miR-16-5p E2F3 E2F transcription factor 3 HGNC:3115 details
hsa-miR-16-5p details
hsa-miR-16-5p TDRD3 tudor domain containing 3 HGNC:20612 details
hsa-miR-16-5p IKZF4 IKAROS family zinc finger 4 HGNC:13179 details
hsa-miR-16-5p TES testin LIM domain protein HGNC:14620 details
hsa-miR-16-5p KCNS2 potassium voltage-gated channel modifier subfamily S member 2 HGNC:6301 details
hsa-miR-16-5p SLC9A2 solute carrier family 9 member A2 HGNC:11072 details
hsa-miR-16-5p MEGF8 multiple EGF like domains 8 HGNC:3233 details
hsa-miR-16-5p HMGN1 high mobility group nucleosome binding domain 1 HGNC:4984 details
hsa-miR-16-5p THAP7 THAP domain containing 7 HGNC:23190 details
hsa-miR-16-5p GNB2 G protein subunit beta 2 HGNC:4398 details
hsa-miR-16-5p ZNF827 zinc finger protein 827 HGNC:27193 details
hsa-miR-16-5p SART1 spliceosome associated factor 1, recruiter of U4/U6.U5 tri-snRNP HGNC:10538 details
hsa-miR-16-5p AQP12B aquaporin 12B HGNC:6096 details
hsa-miR-16-5p CLTC clathrin heavy chain HGNC:2092 details
hsa-miR-16-5p ABCB7 ATP binding cassette subfamily B member 7 HGNC:48 details
hsa-miR-16-5p PSMC1 proteasome 26S subunit, ATPase 1 HGNC:9547 details
hsa-miR-16-5p BTBD2 BTB domain containing 2 HGNC:15504 details
hsa-miR-16-5p PLD3 phospholipase D family member 3 HGNC:17158 details
hsa-miR-16-5p EGLN2 egl-9 family hypoxia inducible factor 2 HGNC:14660 details
hsa-miR-16-5p ZZEF1 zinc finger ZZ-type and EF-hand domain containing 1 HGNC:29027 details
hsa-miR-16-5p GOT2 glutamic-oxaloacetic transaminase 2 HGNC:4433 details
hsa-miR-16-5p SBF1 SET binding factor 1 HGNC:10542 details
hsa-miR-16-5p XPO4 exportin 4 HGNC:17796 details
hsa-miR-16-5p SOCS2 suppressor of cytokine signaling 2 HGNC:19382 details
hsa-miR-16-5p HM13 histocompatibility minor 13 HGNC:16435 details
hsa-miR-16-5p ARMCX2 armadillo repeat containing X-linked 2 HGNC:16869 details
hsa-miR-16-5p details
hsa-miR-16-5p CYB5R1 cytochrome b5 reductase 1 HGNC:13397 details
hsa-miR-16-5p TUBA1A tubulin alpha 1a HGNC:20766 details
hsa-miR-16-5p NSUN2 NOP2/Sun RNA methyltransferase 2 HGNC:25994 details
hsa-miR-16-5p details
hsa-miR-16-5p FECH ferrochelatase HGNC:3647 details
hsa-miR-16-5p CNN3 calponin 3 HGNC:2157 details
hsa-miR-16-5p DHX35 DEAH-box helicase 35 HGNC:15861 details
hsa-miR-16-5p HOXD13 homeobox D13 HGNC:5136 details
hsa-miR-16-5p TRIM4 tripartite motif containing 4 HGNC:16275 details
hsa-miR-16-5p ABCC1 ATP binding cassette subfamily C member 1 HGNC:51 details
hsa-miR-16-5p TXLNG taxilin gamma HGNC:18578 details
hsa-miR-16-5p NR1I2 nuclear receptor subfamily 1 group I member 2 HGNC:7968 details
hsa-miR-16-5p ZFPL1 zinc finger protein like 1 HGNC:12868 details
hsa-miR-16-5p TMED7 transmembrane p24 trafficking protein 7 HGNC:24253 details
hsa-miR-16-5p STT3B STT3 oligosaccharyltransferase complex catalytic subunit B HGNC:30611 details
hsa-miR-16-5p SEC24B SEC24 homolog B, COPII coat complex component HGNC:10704 details
hsa-miR-16-5p TUBGCP2 tubulin gamma complex associated protein 2 HGNC:18599 details
hsa-miR-16-5p details
hsa-miR-16-5p NRXN1 neurexin 1 HGNC:8008 details
hsa-miR-16-5p TCP1 t-complex 1 HGNC:11655 details
hsa-miR-16-5p MAP3K7 mitogen-activated protein kinase kinase kinase 7 HGNC:6859 details
hsa-miR-16-5p PLEKHM2 pleckstrin homology and RUN domain containing M2 HGNC:29131 details
hsa-miR-16-5p details
hsa-miR-16-5p PDE3B phosphodiesterase 3B HGNC:8779 details
hsa-miR-16-5p details
hsa-miR-16-5p SETD5 SET domain containing 5 HGNC:25566 details
hsa-miR-16-5p CREB3L2 cAMP responsive element binding protein 3 like 2 HGNC:23720 details
hsa-miR-16-5p ZNF791 zinc finger protein 791 HGNC:26895 details
hsa-miR-16-5p NMD3 NMD3 ribosome export adaptor HGNC:24250 details
hsa-miR-16-5p PCDHGB4 protocadherin gamma subfamily B, 4 HGNC:8711 details
hsa-miR-16-5p DICER1 dicer 1, ribonuclease III HGNC:17098 details
hsa-miR-16-5p KIAA2013 KIAA2013 HGNC:28513 details
hsa-miR-16-5p XPO6 exportin 6 HGNC:19733 details
hsa-miR-16-5p BTAF1 B-TFIID TATA-box binding protein associated factor 1 HGNC:17307 details
hsa-miR-16-5p TEP1 telomerase associated protein 1 HGNC:11726 details
hsa-miR-16-5p ULK1 unc-51 like autophagy activating kinase 1 HGNC:12558 details
hsa-miR-16-5p ACTB actin beta HGNC:132 details
hsa-miR-16-5p TRAF4 TNF receptor associated factor 4 HGNC:12034 details
hsa-miR-16-5p TFRC transferrin receptor HGNC:11763 details
hsa-miR-16-5p NUP155 nucleoporin 155 HGNC:8063 details
hsa-miR-16-5p CNP 2',3'-cyclic nucleotide 3' phosphodiesterase HGNC:2158 details
hsa-miR-16-5p TOR1A torsin family 1 member A HGNC:3098 details
hsa-miR-16-5p HTT huntingtin HGNC:4851 details
hsa-miR-16-5p ZBTB2 zinc finger and BTB domain containing 2 HGNC:20868 details
hsa-miR-16-5p details
hsa-miR-16-5p TSR1 TSR1 ribosome maturation factor HGNC:25542 details
hsa-miR-16-5p GTPBP4 GTP binding protein 4 HGNC:21535 details
hsa-miR-16-5p details
hsa-miR-16-5p details
hsa-miR-16-5p POLR2A RNA polymerase II subunit A HGNC:9187 details
hsa-miR-16-5p MIS12 MIS12 kinetochore complex component HGNC:24967 details
hsa-miR-16-5p PDXK pyridoxal kinase HGNC:8819 details
hsa-miR-16-5p NUP98 nucleoporin 98 and 96 precursor HGNC:8068 details
hsa-miR-16-5p SLC25A38 solute carrier family 25 member 38 HGNC:26054 details
hsa-miR-16-5p details
hsa-miR-16-5p COQ3 coenzyme Q3, methyltransferase HGNC:18175 details
hsa-miR-16-5p TCFL5 transcription factor like 5 HGNC:11646 details
hsa-miR-16-5p MYO19 myosin XIX HGNC:26234 details
hsa-miR-16-5p details
hsa-miR-16-5p DHX30 DExH-box helicase 30 HGNC:16716 details
hsa-miR-16-5p NPRL3 NPR3 like, GATOR1 complex subunit HGNC:14124 details
hsa-miR-16-5p LMTK3 lemur tyrosine kinase 3 HGNC:19295 details
hsa-miR-16-5p CTSD cathepsin D HGNC:2529 details
hsa-miR-16-5p SND1 staphylococcal nuclease and tudor domain containing 1 HGNC:30646 details
hsa-miR-16-5p CHERP calcium homeostasis endoplasmic reticulum protein HGNC:16930 details
hsa-miR-16-5p CAMSAP3 calmodulin regulated spectrin associated protein family member 3 HGNC:29307 details
hsa-miR-16-5p LAPTM4B lysosomal protein transmembrane 4 beta HGNC:13646 details
hsa-miR-16-5p ABHD2 abhydrolase domain containing 2, acylglycerol lipase HGNC:18717 details
hsa-miR-16-5p IER3IP1 immediate early response 3 interacting protein 1 HGNC:18550 details
hsa-miR-16-5p SLC19A1 solute carrier family 19 member 1 HGNC:10937 details
hsa-miR-16-5p NUDT3 nudix hydrolase 3 HGNC:8050 details
hsa-miR-16-5p TBP TATA-box binding protein HGNC:11588 details
hsa-miR-16-5p NISCH nischarin HGNC:18006 details
hsa-miR-16-5p FLNA filamin A HGNC:3754 details
hsa-miR-16-5p BRAT1 BRCA1 associated ATM activator 1 HGNC:21701 details
hsa-miR-16-5p PTPN18 protein tyrosine phosphatase non-receptor type 18 HGNC:9649 details
hsa-miR-16-5p NT5DC2 5'-nucleotidase domain containing 2 HGNC:25717 details
hsa-miR-16-5p IBTK inhibitor of Bruton tyrosine kinase HGNC:17853 details
hsa-miR-16-5p SPEN spen family transcriptional repressor HGNC:17575 details
hsa-miR-16-5p BAZ1B bromodomain adjacent to zinc finger domain 1B HGNC:961 details
hsa-miR-16-5p MED24 mediator complex subunit 24 HGNC:22963 details
hsa-miR-16-5p TGOLN2 trans-golgi network protein 2 HGNC:15450 details
hsa-miR-16-5p GOLGA7 golgin A7 HGNC:24876 details
hsa-miR-16-5p BAMBI BMP and activin membrane bound inhibitor HGNC:30251 details
hsa-miR-16-5p details
hsa-miR-16-5p SLC4A2 solute carrier family 4 member 2 HGNC:11028 details
hsa-miR-16-5p SEC61A2 SEC61 translocon subunit alpha 2 HGNC:17702 details
hsa-miR-16-5p HEATR3 HEAT repeat containing 3 HGNC:26087 details
hsa-miR-16-5p DHX38 DEAH-box helicase 38 HGNC:17211 details
hsa-miR-16-5p BTRC beta-transducin repeat containing E3 ubiquitin protein ligase HGNC:1144 details
hsa-miR-16-5p PPP2R1B protein phosphatase 2 scaffold subunit Abeta HGNC:9303 details
hsa-miR-16-5p CCDC59 coiled-coil domain containing 59 HGNC:25005 details
hsa-miR-16-5p SEMA4C semaphorin 4C HGNC:10731 details
hsa-miR-16-5p NAT8L N-acetyltransferase 8 like HGNC:26742 details
hsa-miR-16-5p SMARCA4 SWI/SNF related, matrix associated, actin dependent regulator of chromatin, subfamily a, member 4 HGNC:11100 details
hsa-miR-16-5p MED12 mediator complex subunit 12 HGNC:11957 details
hsa-miR-16-5p SOX6 SRY-box transcription factor 6 HGNC:16421 details
hsa-miR-16-5p IGF1R insulin like growth factor 1 receptor HGNC:5465 details
hsa-miR-16-5p RAF1 Raf-1 proto-oncogene, serine/threonine kinase HGNC:9829 details
hsa-miR-16-5p KRAS KRAS proto-oncogene, GTPase HGNC:6407 details
hsa-miR-16-5p SLC6A4 solute carrier family 6 member 4 HGNC:11050 details
hsa-miR-16-5p