CircNet

miRNA General Information

Basic
Network

miRNA ID	hsa-miR-181a-5p
Description	Homo sapiens miR-181a-2 stem-loop
Comment	This human miRNA was predicted by computational methods using conservation with mouse and Fugu rubripes sequences [1]. Expression of the excised miR has been validated in zebrafish, and the ends mapped by cloning. Landgraf et al. and Lui et al. later verify expression in human [4-5].
Experiment	cloned [2,4-6]
Sequence	AACAUUCAACGCUGUCGGUGAGU

miRNA Expression in different cancers

circRNA-miRNA-gene regulatory network

Note about Netwrok:
This is a network diagram with miRNA (purple circle) as the center.
We used three tools(PITA, miRanda, targetScan) to predict the binding sites of circrna (green circle) and miRNA. Accordingly, for this miRNA that binds to circrna, we have three confidence levels, namely confident 1, confident 2 and confident 3. Confidence value indicates how many tools can deduce these results. For each confidence, we use different kinds of dashed lines.

Target circRNA with confidence

Confidence 3 (3 of 3 tools predicted)

CircID	miRNA	PITA	miRanda	targetScan
chr6:38061593\|38082457	hsa-miR-181a-5p	1	1	1
chr7:86925528\|86947922	hsa-miR-181a-5p	1	1	1
chr8:94756036\|94766685	hsa-miR-181a-5p	1	1	1
chr2:24665749\|24693347	hsa-miR-181a-5p	1	1	1

Confidence 2 (2 of 3 tools predicted)

CircID	miRNA	PITA	miRanda
chr17:4968300\|4968595	hsa-miR-181a-5p	1	1
chr2:43977001\|43977276	hsa-miR-181a-5p	1	1
chr12:48922567\|48922713	hsa-miR-181a-5p	1	1
chr1:207227070\|207227310	hsa-miR-181a-5p	1	1
chr17:81665983\|81666110	hsa-miR-181a-5p	1	1
chr9:95506429\|95506561	hsa-miR-181a-5p	1	1

Confidence 1 (1 of 3 tools predicted)

CircID	miRNA	PITA	miRanda
chr19:814720\|814950	hsa-miR-181a-5p	1	0
chr1:161038195\|161038333	hsa-miR-181a-5p	0	1
chr19:52907097\|52907432	hsa-miR-181a-5p	0	1
chr1:43990846\|43991037	hsa-miR-181a-5p	0	1
chr4:17800823\|17800978	hsa-miR-181a-5p	0	1
chr16:18815186\|18815469	hsa-miR-181a-5p	0	1
chr13:38691744\|38691874	hsa-miR-181a-5p	0	1
chr5:35060846\|35060925	hsa-miR-181a-5p	0	1
chr7:128770754\|128770890	hsa-miR-181a-5p	0	1
chr16:1772173\|1772342	hsa-miR-181a-5p	0	1
chr6:30493413\|30493589	hsa-miR-181a-5p	0	1
chr3:113721230\|113721413	hsa-miR-181a-5p	0	1
chr12:113191573\|113191764	hsa-miR-181a-5p	0	1
chr14:94380895\|94381079	hsa-miR-181a-5p	0	1
chr9:128178905\|128179072	hsa-miR-181a-5p	0	1
chr17:42857423\|42857605	hsa-miR-181a-5p	0	1
chr1:169477375\|169477499	hsa-miR-181a-5p	0	1
chr2:131048872\|131049055	hsa-miR-181a-5p	0	1
chr8:144930961\|144931128	hsa-miR-181a-5p	0	1
chr1:45004656\|45004770	hsa-miR-181a-5p	0	1
chrX:103253642\|103253747	hsa-miR-181a-5p	0	1
chr14:74551271\|74552248	hsa-miR-181a-5p	0	1
chr10:95643028\|95643140	hsa-miR-181a-5p	0	1
chr15:41909699\|41909830	hsa-miR-181a-5p	0	1
chr11:34661698\|34661850	hsa-miR-181a-5p	0	1
chr11:34661681\|34661848	hsa-miR-181a-5p	0	1
chr11:62525888\|62526049	hsa-miR-181a-5p	0	1
chr5:142600771\|142614032	hsa-miR-181a-5p	0	1
chr2:131048872\|131048973	hsa-miR-181a-5p	0	1
chr19:53140743\|53140826	hsa-miR-181a-5p	0	1
chr10:87753940\|87754059	hsa-miR-181a-5p	0	1
chr17:48121841\|48122122	hsa-miR-181a-5p	0	1
chr17:78973047\|78973136	hsa-miR-181a-5p	0	1
chr8:144142983\|144143076	hsa-miR-181a-5p	1	0
chr6:29944578\|29945281	hsa-miR-181a-5p	1	0
chr17:46030476\|46030804	hsa-miR-181a-5p	1	0
chr19:34400327\|34400528	hsa-miR-181a-5p	1	0
chr12:69271617\|69271772	hsa-miR-181a-5p	0	1
chr19:43586192\|43586408	hsa-miR-181a-5p	0	1
chr3:125987184\|125987356	hsa-miR-181a-5p	0	1
chr1:6223724\|6223879	hsa-miR-181a-5p	0	1
chr3:49123285\|49123517	hsa-miR-181a-5p	0	1
chr2:38826005\|38826604	hsa-miR-181a-5p	0	1
chr3:49727182\|49727317	hsa-miR-181a-5p	0	1
chr17:35259050\|35259168	hsa-miR-181a-5p	0	1
chr8:23020965\|23021095	hsa-miR-181a-5p	0	1
chr16:1772173\|1772326	hsa-miR-181a-5p	0	1
chr8:101719319\|101719417	hsa-miR-181a-5p	0	1
chr2:215406309\|215406452	hsa-miR-181a-5p	0	1
chr9:128178929\|128179105	hsa-miR-181a-5p	0	1
chr6:30740496\|30740786	hsa-miR-181a-5p	0	1
chr16:1772173\|1772328	hsa-miR-181a-5p	0	1
chr3:180951347\|180951468	hsa-miR-181a-5p	0	1
chr16:1772173\|1772345	hsa-miR-181a-5p	0	1
chr17:42857442\|42857605	hsa-miR-181a-5p	0	1
chr3:128625633\|128625963	hsa-miR-181a-5p	0	1
chr16:64947788\|64947977	hsa-miR-181a-5p	0	1
chr3:172328952\|172329076	hsa-miR-181a-5p	0	1
chr2:131048872\|131049090	hsa-miR-181a-5p	0	1
chr20:37225702\|37225802	hsa-miR-181a-5p	0	1
chr1:45004705\|45004806	hsa-miR-181a-5p	0	1
chr11:62525977\|62526127	hsa-miR-181a-5p	0	1
chr5:173317322\|173317483	hsa-miR-181a-5p	0	1
chr1:54205049\|54205195	hsa-miR-181a-5p	0	1
chr19:12876229\|12876361	hsa-miR-181a-5p	0	1
chr19:40804784\|40805022	hsa-miR-181a-5p	0	1
chr12:56159691\|56160053	hsa-miR-181a-5p	0	1
chr1:51790596\|51790959	hsa-miR-181a-5p	0	1
chr17:68515430\|68515566	hsa-miR-181a-5p	0	1
chr10:123157745\|123157861	hsa-miR-181a-5p	0	1
chr19:58262125\|58262292	hsa-miR-181a-5p	0	1
chr12:56159687\|56160053	hsa-miR-181a-5p	0	1
chr19:52384716\|52385051	hsa-miR-181a-5p	0	1
chr2:131048872\|131049169	hsa-miR-181a-5p	0	1
chr7:146095~146195	hsa-miR-181a-5p	0	1
chr9:128178797~128179014	hsa-miR-181a-5p	0	1
chr8:144930961~144931128	hsa-miR-181a-5p	0	1
chr10:72275700~72275879	hsa-miR-181a-5p	0	1
chr5:136063240~136063365	hsa-miR-181a-5p	0	1
chr10:26724014~26724112	hsa-miR-181a-5p	0	1
chr11:85696342~85696518	hsa-miR-181a-5p	0	1
chr19:53140743~53140826	hsa-miR-181a-5p	0	1
chr2:95274695~95274829	hsa-miR-181a-5p	0	1
chr16:1772173~1772326	hsa-miR-181a-5p	0	1
chr16:1772191~1772345	hsa-miR-181a-5p	0	1
chr1:32190091~32190249	hsa-miR-181a-5p	0	1
chr6:152077500~152077761	hsa-miR-181a-5p	0	1
chr6:31640199~31640282	hsa-miR-181a-5p	0	1
chr17:46030476~46030804	hsa-miR-181a-5p	0	1
chr20:37225702~37225802	hsa-miR-181a-5p	0	1
chr2:131048872~131048983	hsa-miR-181a-5p	0	1
chr5:35060846~35060925	hsa-miR-181a-5p	0	1
chr1:43990846~43991037	hsa-miR-181a-5p	0	1
chr15:63071402~63071497	hsa-miR-181a-5p	0	1
chr15:41826156~41826486	hsa-miR-181a-5p	0	1
chr16:1772173~1772328	hsa-miR-181a-5p	0	1
chr1:32190085~32190249	hsa-miR-181a-5p	0	1
chr19:52384716~52385051	hsa-miR-181a-5p	0	1
chr17:12141586~12141696	hsa-miR-181a-5p	0	1
chr15:63071455~63071678	hsa-miR-181a-5p	0	1
chr1:32280112~32280210	hsa-miR-181a-5p	0	1
chr18:74260915~74263437	hsa-miR-181a-5p	0	1
chr1:46193564~46194306	hsa-miR-181a-5p	0	1
chr14:61539922\|61540096	hsa-miR-181a-5p	1	0
chr9:128178953\|128179098	hsa-miR-181a-5p	0	1
chr17:58279340\|58279908	hsa-miR-181a-5p	0	1
chr7:92662114\|92662371	hsa-miR-181a-5p	0	1
chr2:63454612\|63454740	hsa-miR-181a-5p	0	1
chr18:58689607\|58689696	hsa-miR-181a-5p	0	1
chr2:20035003\|20041011	hsa-miR-181a-5p	0	1
chr3:16414875\|16414990	hsa-miR-181a-5p	0	1
chr5:172854962\|172855148	hsa-miR-181a-5p	0	1
chr18:13614799\|13615026	hsa-miR-181a-5p	0	1
chr19:57473736\|57473922	hsa-miR-181a-5p	0	1
chr9:128178905\|128178988	hsa-miR-181a-5p	0	1
chr17:43218206\|43218373	hsa-miR-181a-5p	0	1
chr19:7217426\|7217533	hsa-miR-181a-5p	0	1
chr17:75842398\|75842568	hsa-miR-181a-5p	0	1
chr6:31640262\|31640488	hsa-miR-181a-5p	0	1
chr7:5064851\|5065012	hsa-miR-181a-5p	1	0
chr1:12311566\|12311909	hsa-miR-181a-5p	0	1
chr13:102861591\|102861714	hsa-miR-181a-5p	0	1
chr19:56423374\|56423541	hsa-miR-181a-5p	0	1
chr15:63280683\|63280787	hsa-miR-181a-5p	0	1
chr3:148986234\|148986431	hsa-miR-181a-5p	0	1
chr17:72646062\|72646275	hsa-miR-181a-5p	0	1
chr19:4658559\|4658695	hsa-miR-181a-5p	0	1
chr16:8689863\|8690001	hsa-miR-181a-5p	0	1
chr19:1422397\|1422585	hsa-miR-181a-5p	0	1
chr14:105187897\|105187998	hsa-miR-181a-5p	0	1
chr6:29945068\|29945349	hsa-miR-181a-5p	1	0
chrX:53614534\|53615835	hsa-miR-181a-5p	1	0
chr6:30493465\|30493703	hsa-miR-181a-5p	0	1
chr7:150626153\|150626287	hsa-miR-181a-5p	0	1
chr20:35177105\|35177252	hsa-miR-181a-5p	0	1
chr11:44244234\|44244344	hsa-miR-181a-5p	0	1
chr12:56159682\|56160053	hsa-miR-181a-5p	0	1
chr5:136063253\|136063419	hsa-miR-181a-5p	0	1
chr8:22161789\|22162611	hsa-miR-181a-5p	0	1
chr20:64260067\|64260178	hsa-miR-181a-5p	0	1
chr5:179113003\|179113118	hsa-miR-181a-5p	0	1
chr1:171541495\|171541659	hsa-miR-181a-5p	0	1
chr11:68933095\|68933385	hsa-miR-181a-5p	0	1
chr7:149255169\|149255522	hsa-miR-181a-5p	0	1
chr17:4968392\|4968501	hsa-miR-181a-5p	0	1
chr1:43273642\|43273788	hsa-miR-181a-5p	0	1
chr1:22913550\|22913704	hsa-miR-181a-5p	0	1
chr2:215406389\|215407316	hsa-miR-181a-5p	0	1
chr12:69271700\|69271794	hsa-miR-181a-5p	0	1
chr5:136063240\|136063365	hsa-miR-181a-5p	0	1
chr5:136063256\|136063365	hsa-miR-181a-5p	0	1
chr17:50090091\|50090201	hsa-miR-181a-5p	0	1
chr1:44218395\|44218731	hsa-miR-181a-5p	0	1
chr17:72646103\|72646237	hsa-miR-181a-5p	0	1
chr3:143265295\|143265495	hsa-miR-181a-5p	0	1
chr11:44244222\|44244319	hsa-miR-181a-5p	0	1
chr1:26882723\|26882885	hsa-miR-181a-5p	0	1
chr6:154832522\|154832721	hsa-miR-181a-5p	0	1
chr2:215406365\|215406487	hsa-miR-181a-5p	0	1
chr10:7560241\|7560446	hsa-miR-181a-5p	0	1
chr3:24487971\|24488104	hsa-miR-181a-5p	0	1
chrX:140783176\|140784660	hsa-miR-181a-5p	0	1
chr9:33113430\|33113799	hsa-miR-181a-5p	0	1
chr10:72275645\|72275849	hsa-miR-181a-5p	0	1
chr16:58707973\|58708105	hsa-miR-181a-5p	0	1
chr8:22161789\|22161852	hsa-miR-181a-5p	0	1
chr17:50090091\|50090249	hsa-miR-181a-5p	0	1
chr1:155186923\|155187042	hsa-miR-181a-5p	0	1
chr6:30740285\|30740781	hsa-miR-181a-5p	0	1
chr8:22161789\|22162627	hsa-miR-181a-5p	0	1
chr16:57664560\|57664780	hsa-miR-181a-5p	0	1
chr14:75963461\|75965695	hsa-miR-181a-5p	0	1
chr12:26065244\|26065326	hsa-miR-181a-5p	0	1
chr3:48469514\|48469843	hsa-miR-181a-5p	0	1
chr17:50090060\|50090201	hsa-miR-181a-5p	0	1
chr8:81758260\|81758630	hsa-miR-181a-5p	0	1
chr5:67168969\|67169136	hsa-miR-181a-5p	0	1
chr5:136063253\|136063365	hsa-miR-181a-5p	0	1
chr11:12942699\|12942909	hsa-miR-181a-5p	0	1
chr15:63071455\|63071678	hsa-miR-181a-5p	0	1
chr19:40377849\|40378065	hsa-miR-181a-5p	0	1
chr9:137102499\|137102739	hsa-miR-181a-5p	0	1
chr15:41826364\|41826523	hsa-miR-181a-5p	0	1
chr12:64714724\|64714953	hsa-miR-181a-5p	0	1
chr7:4249183\|4249373	hsa-miR-181a-5p	0	1
chr14:24305885\|24306062	hsa-miR-181a-5p	0	1
chr14:81476663\|81476895	hsa-miR-181a-5p	0	1
chr17:5443701\|5443820	hsa-miR-181a-5p	0	1
chr5:150691594\|150691747	hsa-miR-181a-5p	0	1
chr3:114085705\|114085870	hsa-miR-181a-5p	0	1
chr14:69354212\|69354294	hsa-miR-181a-5p	0	1
chr15:89908280\|89910819	hsa-miR-181a-5p	0	1
chr14:49832051\|49834449	hsa-miR-181a-5p	0	1
chr2:72718103\|72733118	hsa-miR-181a-5p	0	1
chr8:22161789\|22162614	hsa-miR-181a-5p	0	1
chr10:72275697\|72275879	hsa-miR-181a-5p	0	1
chr15:41909699\|41909777	hsa-miR-181a-5p	0	1
chr1:32190091\|32190249	hsa-miR-181a-5p	0	1
chr10:17704431\|17705741	hsa-miR-181a-5p	0	1
chr15:41909699\|41909806	hsa-miR-181a-5p	0	1
chr2:33257391\|33257511	hsa-miR-181a-5p	0	1
chr1:155186836\|155187074	hsa-miR-181a-5p	0	1
chr15:89908311\|89908412	hsa-miR-181a-5p	0	1
chr17:50090133\|50090295	hsa-miR-181a-5p	0	1
chr10:72275704\|72275879	hsa-miR-181a-5p	0	1
chr3:49012572\|49012735	hsa-miR-181a-5p	0	1
chr2:187464911\|187465064	hsa-miR-181a-5p	0	1
chr21:44889336\|44889457	hsa-miR-181a-5p	0	1
chr19:17212981\|17213100	hsa-miR-181a-5p	0	1
chr6:30493401\|30493589	hsa-miR-181a-5p	0	1
chr1:65433437\|65433605	hsa-miR-181a-5p	0	1
chr6:30740287\|30740781	hsa-miR-181a-5p	0	1
chr6:30493468\|30493589	hsa-miR-181a-5p	0	1
chr1:51790596\|51790968	hsa-miR-181a-5p	0	1
chr17:50090085\|50090249	hsa-miR-181a-5p	0	1
chr1:32279671\|32280210	hsa-miR-181a-5p	0	1
chr2:131048872\|131049049	hsa-miR-181a-5p	0	1
chr14:105854972\|105855228	hsa-miR-181a-5p	0	1
chr17:48121995\|48122101	hsa-miR-181a-5p	0	1
chr4:89249771\|89249909	hsa-miR-181a-5p	-11	1
chr20:35176983\|35177252	hsa-miR-181a-5p	-11	1
chr16:58707224\|58707342	hsa-miR-181a-5p	0	1
chr7:150572577\|150572681	hsa-miR-181a-5p	1	0
chr18:12329650\|12329713	hsa-miR-181a-5p	1	0
chr6:31640199\|31640432	hsa-miR-181a-5p	0	1
chr11:44244213\|44244344	hsa-miR-181a-5p	0	1
chr11:44244222\|44244344	hsa-miR-181a-5p	0	1
chr19:17808725\|17808924	hsa-miR-181a-5p	0	1
chr19:1038110\|1038351	hsa-miR-181a-5p	0	1
chr12:56159682\|56160075	hsa-miR-181a-5p	0	1
chr5:136063237\|136063365	hsa-miR-181a-5p	0	1
chr5:136063253\|136063429	hsa-miR-181a-5p	0	1
chr19:1038139\|1038342	hsa-miR-181a-5p	0	1
chr17:31531795\|31531902	hsa-miR-181a-5p	0	1
chr9:133257401\|133257491	hsa-miR-181a-5p	0	1
chr9:128178851\|128179198	hsa-miR-181a-5p	0	1
chr8:9136509\|9136653	hsa-miR-181a-5p	0	1
chr12:56159691\|56160075	hsa-miR-181a-5p	0	1
chr1:16206180\|16206340	hsa-miR-181a-5p	0	1
chrX:103253565\|103253747	hsa-miR-181a-5p	0	1
chr9:128178953\|128179084	hsa-miR-181a-5p	0	1
chr2:128266230\|128266318	hsa-miR-181a-5p	0	1
chr1:43990901\|43991037	hsa-miR-181a-5p	0	1
chr16:1772173\|1772442	hsa-miR-181a-5p	0	1
chr9:130862805\|130862978	hsa-miR-181a-5p	0	1
chr20:44432578\|44432732	hsa-miR-181a-5p	0	1
chr11:12237132\|12237218	hsa-miR-181a-5p	0	1
chr5:109378509\|109378661	hsa-miR-181a-5p	0	1
chr9:745218\|745371	hsa-miR-181a-5p	0	1
chr1:25829622\|25829792	hsa-miR-181a-5p	0	1
chr1:15583237\|15583350	hsa-miR-181a-5p	0	1
chr13:100077128\|100077335	hsa-miR-181a-5p	0	1
chr20:25007023\|25007146	hsa-miR-181a-5p	0	1
chr3:50358677\|50358910	hsa-miR-181a-5p	0	1
chr15:78265876\|78266033	hsa-miR-181a-5p	0	1
chr2:95148477\|95148643	hsa-miR-181a-5p	0	1
chr4:24576424\|24576610	hsa-miR-181a-5p	0	1
chr9:128178953\|128179072	hsa-miR-181a-5p	0	1
chr11:85696342\|85696518	hsa-miR-181a-5p	0	1
chr2:101002702\|101002806	hsa-miR-181a-5p	0	1
chr1:209652369\|209652483	hsa-miR-181a-5p	0	1
chrX:41349588\|41349696	hsa-miR-181a-5p	0	1
chr17:63592598\|63592801	hsa-miR-181a-5p	0	1
chr22:41867083\|41867280	hsa-miR-181a-5p	0	1
chr2:131048872\|131048983	hsa-miR-181a-5p	0	1
chr8:22127250\|22127352	hsa-miR-181a-5p	0	1
chr17:75499443\|75499626	hsa-miR-181a-5p	0	1
chr9:132648432\|132648540	hsa-miR-181a-5p	0	1
chr5:14710427\|14710584	hsa-miR-181a-5p	0	1
chr3:172328966\|172329076	hsa-miR-181a-5p	0	1
chr20:64260054\|64260178	hsa-miR-181a-5p	0	1
chr5:14710427\|14710587	hsa-miR-181a-5p	0	1
chr11:44244147\|44244344	hsa-miR-181a-5p	0	1
chr18:21612337\|21612443	hsa-miR-181a-5p	0	1
chr17:78973062\|78973136	hsa-miR-181a-5p	0	1
chr17:48121886\|48122129	hsa-miR-181a-5p	0	1
chr5:150375098\|150375441	hsa-miR-181a-5p	0	1
chr11:62626898\|62627328	hsa-miR-181a-5p	1	0
chr19:18175362\|18175686	hsa-miR-181a-5p	1	0
chr1:43990821\|43990941	hsa-miR-181a-5p	1	0

Target genes

miRNA	Gene	Gene Description	HGNC ID	details
hsa-miR-181a-5p	KAT2B	lysine acetyltransferase 2B	HGNC:8638	details
hsa-miR-181a-5p	PLAG1	PLAG1 zinc finger	HGNC:9045	details
hsa-miR-181a-5p	CDX2	caudal type homeobox 2	HGNC:1806	details
hsa-miR-181a-5p	GATA6	GATA binding protein 6	HGNC:4174	details
hsa-miR-181a-5p	NLK	nemo like kinase	HGNC:29858	details
hsa-miR-181a-5p	CDKN1B	cyclin dependent kinase inhibitor 1B	HGNC:1785	details
hsa-miR-181a-5p	PROX1	prospero homeobox 1	HGNC:9459	details
hsa-miR-181a-5p	BCL2	BCL2 apoptosis regulator	HGNC:990	details
hsa-miR-181a-5p	ZNF763	zinc finger protein 763	HGNC:27614	details
hsa-miR-181a-5p	DDIT4	DNA damage inducible transcript 4	HGNC:24944	details
hsa-miR-181a-5p	ATM	ATM serine/threonine kinase	HGNC:795	details
hsa-miR-181a-5p	HIPK2	homeodomain interacting protein kinase 2	HGNC:14402	details
hsa-miR-181a-5p	BCL2L11	BCL2 like 11	HGNC:994	details
hsa-miR-181a-5p	HRAS	HRas proto-oncogene, GTPase	HGNC:5173	details
hsa-miR-181a-5p	RNF2	ring finger protein 2	HGNC:10061	details
hsa-miR-181a-5p	RALA	RAS like proto-oncogene A	HGNC:9839	details
hsa-miR-181a-5p	SIRT1	sirtuin 1	HGNC:14929	details
hsa-miR-181a-5p	PRAP1	proline rich acidic protein 1	HGNC:23304	details
hsa-miR-181a-5p	DUSP6	dual specificity phosphatase 6	HGNC:3072	details
hsa-miR-181a-5p	PTPN11	protein tyrosine phosphatase non-receptor type 11	HGNC:9644	details
hsa-miR-181a-5p	DUSP5	dual specificity phosphatase 5	HGNC:3071	details
hsa-miR-181a-5p	PTPN22	protein tyrosine phosphatase non-receptor type 22	HGNC:9652	details
hsa-miR-181a-5p	FOS	Fos proto-oncogene, AP-1 transcription factor subunit	HGNC:3796	details
hsa-miR-181a-5p	MTMR3	myotubularin related protein 3	HGNC:7451	details
hsa-miR-181a-5p	KLF6	Kruppel like factor 6	HGNC:2235	details
hsa-miR-181a-5p	MCL1	MCL1 apoptosis regulator, BCL2 family member	HGNC:6943	details
hsa-miR-181a-5p	XIAP	X-linked inhibitor of apoptosis	HGNC:592	details
hsa-miR-181a-5p	GPR78	G protein-coupled receptor 78	HGNC:4528	details
hsa-miR-181a-5p				details
hsa-miR-181a-5p	LFNG	LFNG O-fucosylpeptide 3-beta-N-acetylglucosaminyltransferase	HGNC:6560	details
hsa-miR-181a-5p	LRRC17	leucine rich repeat containing 17	HGNC:16895	details
hsa-miR-181a-5p	CHRFAM7A	CHRNA7 (exons 5-10) and FAM7A (exons A-E) fusion	HGNC:15781	details
hsa-miR-181a-5p	CD46	CD46 molecule	HGNC:6953	details
hsa-miR-181a-5p	RASSF6	Ras association domain family member 6	HGNC:20796	details
hsa-miR-181a-5p	FXYD6	FXYD domain containing ion transport regulator 6	HGNC:4030	details
hsa-miR-181a-5p	KCTD3	potassium channel tetramerization domain containing 3	HGNC:21305	details
hsa-miR-181a-5p	TSHR	thyroid stimulating hormone receptor	HGNC:12373	details
hsa-miR-181a-5p	ZNF558	zinc finger protein 558	HGNC:26422	details
hsa-miR-181a-5p	C8A	complement C8 alpha chain	HGNC:1352	details
hsa-miR-181a-5p	ARL6IP6	ADP ribosylation factor like GTPase 6 interacting protein 6	HGNC:24048	details
hsa-miR-181a-5p	ZNF426	zinc finger protein 426	HGNC:20725	details
hsa-miR-181a-5p	ESR1	estrogen receptor 1	HGNC:3467	details
hsa-miR-181a-5p	ATF7IP2	activating transcription factor 7 interacting protein 2	HGNC:20397	details
hsa-miR-181a-5p	PRR4	proline rich 4	HGNC:18020	details
hsa-miR-181a-5p	TCF21	transcription factor 21	HGNC:11632	details
hsa-miR-181a-5p	PHOX2A	paired like homeobox 2A	HGNC:691	details
hsa-miR-181a-5p				details
hsa-miR-181a-5p				details
hsa-miR-181a-5p	GSTM2	glutathione S-transferase mu 2	HGNC:4634	details
hsa-miR-181a-5p	FSIP1	fibrous sheath interacting protein 1	HGNC:21674	details
hsa-miR-181a-5p	KBTBD3	kelch repeat and BTB domain containing 3	HGNC:22934	details
hsa-miR-181a-5p	PTPRZ1	protein tyrosine phosphatase receptor type Z1	HGNC:9685	details
hsa-miR-181a-5p	WNT3A	Wnt family member 3A	HGNC:15983	details
hsa-miR-181a-5p	TUSC1	tumor suppressor candidate 1	HGNC:31010	details
hsa-miR-181a-5p	LRRN3	leucine rich repeat neuronal 3	HGNC:17200	details
hsa-miR-181a-5p	TMEM45A	transmembrane protein 45A	HGNC:25480	details
hsa-miR-181a-5p	ARF6	ADP ribosylation factor 6	HGNC:659	details
hsa-miR-181a-5p	C1orf109	chromosome 1 open reading frame 109	HGNC:26039	details
hsa-miR-181a-5p	TAF15	TATA-box binding protein associated factor 15	HGNC:11547	details
hsa-miR-181a-5p	PLXDC2	plexin domain containing 2	HGNC:21013	details
hsa-miR-181a-5p	NMRK2	nicotinamide riboside kinase 2	HGNC:17871	details
hsa-miR-181a-5p	WNT2	Wnt family member 2	HGNC:12780	details
hsa-miR-181a-5p	ATG10	autophagy related 10	HGNC:20315	details
hsa-miR-181a-5p	PRDX3	peroxiredoxin 3	HGNC:9354	details
hsa-miR-181a-5p	HOXA11	homeobox A11	HGNC:5101	details
hsa-miR-181a-5p	ZNF652	zinc finger protein 652	HGNC:29147	details
hsa-miR-181a-5p	RTEL1-TNFRSF6B	RTEL1-TNFRSF6B readthrough (NMD candidate)	HGNC:44095	details
hsa-miR-181a-5p	GCNT1	glucosaminyl (N-acetyl) transferase 1	HGNC:4203	details
hsa-miR-181a-5p	PCDHB8	protocadherin beta 8	HGNC:8693	details
hsa-miR-181a-5p	ENAH	ENAH actin regulator	HGNC:18271	details
hsa-miR-181a-5p	ZNF25	zinc finger protein 25	HGNC:13043	details
hsa-miR-181a-5p	TAF6L	TATA-box binding protein associated factor 6 like	HGNC:17305	details
hsa-miR-181a-5p	S100A1	S100 calcium binding protein A1	HGNC:10486	details
hsa-miR-181a-5p	PLA2G4C	phospholipase A2 group IVC	HGNC:9037	details
hsa-miR-181a-5p	NOL4	nucleolar protein 4	HGNC:7870	details
hsa-miR-181a-5p	SIX6	SIX homeobox 6	HGNC:10892	details
hsa-miR-181a-5p	FKBP10	FKBP prolyl isomerase 10	HGNC:18169	details
hsa-miR-181a-5p	SMCHD1	structural maintenance of chromosomes flexible hinge domain containing 1	HGNC:29090	details
hsa-miR-181a-5p	OR11A1	olfactory receptor family 11 subfamily A member 1	HGNC:8176	details
hsa-miR-181a-5p	INCENP	inner centromere protein	HGNC:6058	details
hsa-miR-181a-5p	LPGAT1	lysophosphatidylglycerol acyltransferase 1	HGNC:28985	details
hsa-miR-181a-5p	CLUAP1	clusterin associated protein 1	HGNC:19009	details
hsa-miR-181a-5p	LYSMD3	LysM domain containing 3	HGNC:26969	details
hsa-miR-181a-5p	CCDC6	coiled-coil domain containing 6	HGNC:18782	details
hsa-miR-181a-5p	BAG2	BAG cochaperone 2	HGNC:938	details
hsa-miR-181a-5p	GPR83	G protein-coupled receptor 83	HGNC:4523	details
hsa-miR-181a-5p	PTGS2	prostaglandin-endoperoxide synthase 2	HGNC:9605	details
hsa-miR-181a-5p	ANKRD13C	ankyrin repeat domain 13C	HGNC:25374	details
hsa-miR-181a-5p	RLF	RLF zinc finger	HGNC:10025	details
hsa-miR-181a-5p	FBXO28	F-box protein 28	HGNC:29046	details
hsa-miR-181a-5p	ZNF350	zinc finger protein 350	HGNC:16656	details
hsa-miR-181a-5p	TIAL1	TIA1 cytotoxic granule associated RNA binding protein like 1	HGNC:11804	details
hsa-miR-181a-5p	RNF34	ring finger protein 34	HGNC:17297	details
hsa-miR-181a-5p	LCLAT1	lysocardiolipin acyltransferase 1	HGNC:26756	details
hsa-miR-181a-5p				details
hsa-miR-181a-5p	ZNF35	zinc finger protein 35	HGNC:13099	details
hsa-miR-181a-5p	PITPNB	phosphatidylinositol transfer protein beta	HGNC:9002	details
hsa-miR-181a-5p	SCD	stearoyl-CoA desaturase	HGNC:10571	details
hsa-miR-181a-5p				details
hsa-miR-181a-5p	GATAD2B	GATA zinc finger domain containing 2B	HGNC:30778	details
hsa-miR-181a-5p	LGALSL	galectin like	HGNC:25012	details
hsa-miR-181a-5p	TGIF2	TGFB induced factor homeobox 2	HGNC:15764	details
hsa-miR-181a-5p	MOB1A	MOB kinase activator 1A	HGNC:16015	details
hsa-miR-181a-5p	SLC35B4	solute carrier family 35 member B4	HGNC:20584	details
hsa-miR-181a-5p				details
hsa-miR-181a-5p				details
hsa-miR-181a-5p	GPRIN3	GPRIN family member 3	HGNC:27733	details
hsa-miR-181a-5p				details
hsa-miR-181a-5p	ARHGAP12	Rho GTPase activating protein 12	HGNC:16348	details
hsa-miR-181a-5p	SPRY2	sprouty RTK signaling antagonist 2	HGNC:11270	details
hsa-miR-181a-5p	TGFBR3	transforming growth factor beta receptor 3	HGNC:11774	details
hsa-miR-181a-5p	TMED4	transmembrane p24 trafficking protein 4	HGNC:22301	details
hsa-miR-181a-5p	MAP2K1	mitogen-activated protein kinase kinase 1	HGNC:6840	details
hsa-miR-181a-5p	PUM1	pumilio RNA binding family member 1	HGNC:14957	details
hsa-miR-181a-5p	TRIM2	tripartite motif containing 2	HGNC:15974	details
hsa-miR-181a-5p	FBXO33	F-box protein 33	HGNC:19833	details
hsa-miR-181a-5p	NRP1	neuropilin 1	HGNC:8004	details
hsa-miR-181a-5p	FAM47B	family with sequence similarity 47 member B	HGNC:26659	details
hsa-miR-181a-5p	CCNG1	cyclin G1	HGNC:1592	details
hsa-miR-181a-5p	BRMS1L	BRMS1 like transcriptional repressor	HGNC:20512	details
hsa-miR-181a-5p	OTUD1	OTU deubiquitinase 1	HGNC:27346	details
hsa-miR-181a-5p	ATP6V0E1	ATPase H+ transporting V0 subunit e1	HGNC:863	details
hsa-miR-181a-5p	WNT16	Wnt family member 16	HGNC:16267	details
hsa-miR-181a-5p	CST5	cystatin D	HGNC:2477	details
hsa-miR-181a-5p	SH3BGRL	SH3 domain binding glutamate rich protein like	HGNC:10823	details
hsa-miR-181a-5p	GPR137B	G protein-coupled receptor 137B	HGNC:11862	details
hsa-miR-181a-5p	OFCC1	orofacial cleft 1 candidate 1	HGNC:21017	details
hsa-miR-181a-5p	IQCG	IQ motif containing G	HGNC:25251	details
hsa-miR-181a-5p	NKX3-2	NK3 homeobox 2	HGNC:951	details
hsa-miR-181a-5p	OTX2	orthodenticle homeobox 2	HGNC:8522	details
hsa-miR-181a-5p	ROPN1L	rhophilin associated tail protein 1 like	HGNC:24060	details
hsa-miR-181a-5p	TMEM14A	transmembrane protein 14A	HGNC:21076	details
hsa-miR-181a-5p	TAF2	TATA-box binding protein associated factor 2	HGNC:11536	details
hsa-miR-181a-5p	IDS	iduronate 2-sulfatase	HGNC:5389	details
hsa-miR-181a-5p	FRA10AC1	FRA10A associated CGG repeat 1	HGNC:1162	details
hsa-miR-181a-5p	COL27A1	collagen type XXVII alpha 1 chain	HGNC:22986	details
hsa-miR-181a-5p	EPHA5	EPH receptor A5	HGNC:3389	details
hsa-miR-181a-5p	DCST1	DC-STAMP domain containing 1	HGNC:26539	details
hsa-miR-181a-5p	ZNF562	zinc finger protein 562	HGNC:25950	details
hsa-miR-181a-5p	EYA4	EYA transcriptional coactivator and phosphatase 4	HGNC:3522	details
hsa-miR-181a-5p	CHL1	cell adhesion molecule L1 like	HGNC:1939	details
hsa-miR-181a-5p	TAAR6	trace amine associated receptor 6	HGNC:20978	details
hsa-miR-181a-5p	SLCO2A1	solute carrier organic anion transporter family member 2A1	HGNC:10955	details
hsa-miR-181a-5p				details
hsa-miR-181a-5p	HMGB2	high mobility group box 2	HGNC:5000	details
hsa-miR-181a-5p	HERC3	HECT and RLD domain containing E3 ubiquitin protein ligase 3	HGNC:4876	details
hsa-miR-181a-5p	BTBD3	BTB domain containing 3	HGNC:15854	details
hsa-miR-181a-5p	SRPK2	SRSF protein kinase 2	HGNC:11306	details
hsa-miR-181a-5p	DNAJC7	DnaJ heat shock protein family (Hsp40) member C7	HGNC:12392	details
hsa-miR-181a-5p	ANKRD1	ankyrin repeat domain 1	HGNC:15819	details
hsa-miR-181a-5p	CFI	complement factor I	HGNC:5394	details
hsa-miR-181a-5p	MRPS14	mitochondrial ribosomal protein S14	HGNC:14049	details
hsa-miR-181a-5p	HEY2	hes related family bHLH transcription factor with YRPW motif 2	HGNC:4881	details
hsa-miR-181a-5p	BDNF	brain derived neurotrophic factor	HGNC:1033	details
hsa-miR-181a-5p	MTMR12	myotubularin related protein 12	HGNC:18191	details
hsa-miR-181a-5p	ACOT12	acyl-CoA thioesterase 12	HGNC:24436	details
hsa-miR-181a-5p				details
hsa-miR-181a-5p	USP28	ubiquitin specific peptidase 28	HGNC:12625	details
hsa-miR-181a-5p	AMMECR1	AMMECR nuclear protein 1	HGNC:467	details
hsa-miR-181a-5p	BPGM	bisphosphoglycerate mutase	HGNC:1093	details
hsa-miR-181a-5p	DSCR8	Down syndrome critical region 8	HGNC:16707	details
hsa-miR-181a-5p	UGT3A1	UDP glycosyltransferase family 3 member A1	HGNC:26625	details
hsa-miR-181a-5p	HSD17B3	hydroxysteroid 17-beta dehydrogenase 3	HGNC:5212	details
hsa-miR-181a-5p	GADD45G	growth arrest and DNA damage inducible gamma	HGNC:4097	details
hsa-miR-181a-5p	FBXO34	F-box protein 34	HGNC:20201	details
hsa-miR-181a-5p	C1QTNF9	C1q and TNF related 9	HGNC:28732	details
hsa-miR-181a-5p	KLRC4	killer cell lectin like receptor C4	HGNC:6377	details
hsa-miR-181a-5p	MOB3B	MOB kinase activator 3B	HGNC:23825	details
hsa-miR-181a-5p	FKBP7	FKBP prolyl isomerase 7	HGNC:3723	details
hsa-miR-181a-5p	TBX4	T-box transcription factor 4	HGNC:11603	details
hsa-miR-181a-5p	TMPRSS11A	transmembrane serine protease 11A	HGNC:27954	details
hsa-miR-181a-5p	SNAI2	snail family transcriptional repressor 2	HGNC:11094	details
hsa-miR-181a-5p	SLC7A11	solute carrier family 7 member 11	HGNC:11059	details
hsa-miR-181a-5p	NUDT12	nudix hydrolase 12	HGNC:18826	details
hsa-miR-181a-5p	COPS2	COP9 signalosome subunit 2	HGNC:30747	details
hsa-miR-181a-5p	ZNF12	zinc finger protein 12	HGNC:12902	details
hsa-miR-181a-5p	PRLR	prolactin receptor	HGNC:9446	details
hsa-miR-181a-5p	PLCL2	phospholipase C like 2	HGNC:9064	details
hsa-miR-181a-5p	ZNF594	zinc finger protein 594	HGNC:29392	details
hsa-miR-181a-5p	METAP1	methionyl aminopeptidase 1	HGNC:15789	details
hsa-miR-181a-5p	HSPA13	heat shock protein family A (Hsp70) member 13	HGNC:11375	details
hsa-miR-181a-5p	NR6A1	nuclear receptor subfamily 6 group A member 1	HGNC:7985	details
hsa-miR-181a-5p	YOD1	YOD1 deubiquitinase	HGNC:25035	details
hsa-miR-181a-5p	SLC37A3	solute carrier family 37 member 3	HGNC:20651	details
hsa-miR-181a-5p	FBXO11	F-box protein 11	HGNC:13590	details
hsa-miR-181a-5p	ZNF445	zinc finger protein 445	HGNC:21018	details
hsa-miR-181a-5p	TM9SF3	transmembrane 9 superfamily member 3	HGNC:21529	details
hsa-miR-181a-5p	ATP8A1	ATPase phospholipid transporting 8A1	HGNC:13531	details
hsa-miR-181a-5p	TMEM64	transmembrane protein 64	HGNC:25441	details
hsa-miR-181a-5p	MOB1B	MOB kinase activator 1B	HGNC:29801	details
hsa-miR-181a-5p	GNAI3	G protein subunit alpha i3	HGNC:4387	details
hsa-miR-181a-5p	TAB2	TGF-beta activated kinase 1 (MAP3K7) binding protein 2	HGNC:17075	details
hsa-miR-181a-5p	SRSF7	serine and arginine rich splicing factor 7	HGNC:10789	details
hsa-miR-181a-5p	DDX3X	DEAD-box helicase 3 X-linked	HGNC:2745	details
hsa-miR-181a-5p	KRAS	KRAS proto-oncogene, GTPase	HGNC:6407	details
hsa-miR-181a-5p	LBR	lamin B receptor	HGNC:6518	details
hsa-miR-181a-5p	GIGYF1	GRB10 interacting GYF protein 1	HGNC:9126	details
hsa-miR-181a-5p	KLHL42	kelch like family member 42	HGNC:29252	details
hsa-miR-181a-5p	TMEM132B	transmembrane protein 132B	HGNC:29397	details
hsa-miR-181a-5p	AFTPH	aftiphilin	HGNC:25951	details
hsa-miR-181a-5p	ZNF148	zinc finger protein 148	HGNC:12933	details
hsa-miR-181a-5p	NOTCH2	notch receptor 2	HGNC:7882	details
hsa-miR-181a-5p	NFYB	nuclear transcription factor Y subunit beta	HGNC:7805	details
hsa-miR-181a-5p	NOTCH1	notch receptor 1	HGNC:7881	details
hsa-miR-181a-5p	SIK2	salt inducible kinase 2	HGNC:21680	details
hsa-miR-181a-5p	HOOK3	hook microtubule tethering protein 3	HGNC:23576	details
hsa-miR-181a-5p	FAM222B	family with sequence similarity 222 member B	HGNC:25563	details
hsa-miR-181a-5p	RPS8	ribosomal protein S8	HGNC:10441	details
hsa-miR-181a-5p	STAG2	stromal antigen 2	HGNC:11355	details
hsa-miR-181a-5p	SMG1	SMG1 nonsense mediated mRNA decay associated PI3K related kinase	HGNC:30045	details
hsa-miR-181a-5p	PFKFB2	6-phosphofructo-2-kinase/fructose-2,6-biphosphatase 2	HGNC:8873	details
hsa-miR-181a-5p	ZEB2	zinc finger E-box binding homeobox 2	HGNC:14881	details
hsa-miR-181a-5p	MAZ	MYC associated zinc finger protein	HGNC:6914	details
hsa-miR-181a-5p	RPL14	ribosomal protein L14	HGNC:10305	details
hsa-miR-181a-5p	KCTD2	potassium channel tetramerization domain containing 2	HGNC:21294	details
hsa-miR-181a-5p	UBA2	ubiquitin like modifier activating enzyme 2	HGNC:30661	details
hsa-miR-181a-5p	DDX27	DEAD-box helicase 27	HGNC:15837	details
hsa-miR-181a-5p	FAT1	FAT atypical cadherin 1	HGNC:3595	details
hsa-miR-181a-5p	HDAC6	histone deacetylase 6	HGNC:14064	details
hsa-miR-181a-5p	TMEM192	transmembrane protein 192	HGNC:26775	details
hsa-miR-181a-5p	LAMA3	laminin subunit alpha 3	HGNC:6483	details
hsa-miR-181a-5p	HUWE1	HECT, UBA and WWE domain containing E3 ubiquitin protein ligase 1	HGNC:30892	details
hsa-miR-181a-5p				details
hsa-miR-181a-5p	HNRNPAB	heterogeneous nuclear ribonucleoprotein A/B	HGNC:5034	details
hsa-miR-181a-5p	OCA2	OCA2 melanosomal transmembrane protein	HGNC:8101	details
hsa-miR-181a-5p	AP1M1	adaptor related protein complex 1 subunit mu 1	HGNC:13667	details
hsa-miR-181a-5p	UCHL1	ubiquitin C-terminal hydrolase L1	HGNC:12513	details
hsa-miR-181a-5p	PGD	phosphogluconate dehydrogenase	HGNC:8891	details
hsa-miR-181a-5p	ZFP36L2	ZFP36 ring finger protein like 2	HGNC:1108	details
hsa-miR-181a-5p	AKAP12	A-kinase anchoring protein 12	HGNC:370	details
hsa-miR-181a-5p	PABPC1	poly(A) binding protein cytoplasmic 1	HGNC:8554	details
hsa-miR-181a-5p	GANAB	glucosidase II alpha subunit	HGNC:4138	details
hsa-miR-181a-5p	PHPT1	phosphohistidine phosphatase 1	HGNC:30033	details
hsa-miR-181a-5p				details
hsa-miR-181a-5p	TEAD4	TEA domain transcription factor 4	HGNC:11717	details
hsa-miR-181a-5p	KLHL15	kelch like family member 15	HGNC:29347	details
hsa-miR-181a-5p	PRRC2B	proline rich coiled-coil 2B	HGNC:28121	details
hsa-miR-181a-5p	BRCA1	BRCA1 DNA repair associated	HGNC:1100	details
hsa-miR-181a-5p				details
hsa-miR-181a-5p	KIAA0100	KIAA0100	HGNC:28960	details
hsa-miR-181a-5p	PPP1R9A	protein phosphatase 1 regulatory subunit 9A	HGNC:14946	details
hsa-miR-181a-5p	MGAT5	alpha-1,6-mannosylglycoprotein 6-beta-N-acetylglucosaminyltransferase	HGNC:7049	details
hsa-miR-181a-5p	TNIP1	TNFAIP3 interacting protein 1	HGNC:16903	details
hsa-miR-181a-5p	PBX3	PBX homeobox 3	HGNC:8634	details
hsa-miR-181a-5p	TIMP1	TIMP metallopeptidase inhibitor 1	HGNC:11820	details
hsa-miR-181a-5p	PGR	progesterone receptor	HGNC:8910	details
hsa-miR-181a-5p	COL16A1	collagen type XVI alpha 1 chain	HGNC:2193	details
hsa-miR-181a-5p	PPP3CA	protein phosphatase 3 catalytic subunit alpha	HGNC:9314	details
hsa-miR-181a-5p	ATG5	autophagy related 5	HGNC:589	details
hsa-miR-181a-5p	CD4	CD4 molecule	HGNC:1678	details
hsa-miR-181a-5p	TGFBRAP1	transforming growth factor beta receptor associated protein 1	HGNC:16836	details
hsa-miR-181a-5p	TGFBR1	transforming growth factor beta receptor 1	HGNC:11772	details
hsa-miR-181a-5p	TNFRSF11B	TNF receptor superfamily member 11b	HGNC:11909	details
hsa-miR-181a-5p	PCDHAC1	protocadherin alpha subfamily C, 1	HGNC:8676	details
hsa-miR-181a-5p	PCDHAC2	protocadherin alpha subfamily C, 2	HGNC:8677	details
hsa-miR-181a-5p	PCDHA1	protocadherin alpha 1	HGNC:8663	details
hsa-miR-181a-5p	PCDHA10	protocadherin alpha 10	HGNC:8664	details
hsa-miR-181a-5p	PCDHA11	protocadherin alpha 11	HGNC:8665	details
hsa-miR-181a-5p	PCDHA12	protocadherin alpha 12	HGNC:8666	details
hsa-miR-181a-5p	PCDHA13	protocadherin alpha 13	HGNC:8667	details
hsa-miR-181a-5p	PCDHA2	protocadherin alpha 2	HGNC:8668	details
hsa-miR-181a-5p	PCDHA3	protocadherin alpha 3	HGNC:8669	details
hsa-miR-181a-5p	PCDHA4	protocadherin alpha 4	HGNC:8670	details
hsa-miR-181a-5p	PCDHA5	protocadherin alpha 5	HGNC:8671	details
hsa-miR-181a-5p	PCDHA6	protocadherin alpha 6	HGNC:8672	details
hsa-miR-181a-5p	PCDHA7	protocadherin alpha 7	HGNC:8673	details
hsa-miR-181a-5p	PCDHA8	protocadherin alpha 8	HGNC:8674	details
hsa-miR-181a-5p	PDGFRA	platelet derived growth factor receptor alpha	HGNC:8803	details
hsa-miR-181a-5p	BMP3	bone morphogenetic protein 3	HGNC:1070	details
hsa-miR-181a-5p	SOX5	SRY-box transcription factor 5	HGNC:11201	details
hsa-miR-181a-5p	MAP3K3	mitogen-activated protein kinase kinase kinase 3	HGNC:6855	details
hsa-miR-181a-5p	TAB3	TGF-beta activated kinase 1 (MAP3K7) binding protein 3	HGNC:30681	details
hsa-miR-181a-5p	PDAP1	PDGFA associated protein 1	HGNC:14634	details
hsa-miR-181a-5p	MAPK1IP1L	mitogen-activated protein kinase 1 interacting protein 1 like	HGNC:19840	details
hsa-miR-181a-5p	BMPR2	bone morphogenetic protein receptor type 2	HGNC:1078	details
hsa-miR-181a-5p	SMAD2	SMAD family member 2	HGNC:6768	details
hsa-miR-181a-5p	MADD	MAP kinase activating death domain	HGNC:6766	details
hsa-miR-181a-5p	CDH13	cadherin 13	HGNC:1753	details
hsa-miR-181a-5p	ACAN	aggrecan	HGNC:319	details
hsa-miR-181a-5p	MAP3K10	mitogen-activated protein kinase kinase kinase 10	HGNC:6849	details
hsa-miR-181a-5p	PCDHB6	protocadherin beta 6	HGNC:8691	details
hsa-miR-181a-5p	MAP4K4	mitogen-activated protein kinase kinase kinase kinase 4	HGNC:6866	details
hsa-miR-181a-5p	MMP14	matrix metallopeptidase 14	HGNC:7160	details
hsa-miR-181a-5p	E2F5	E2F transcription factor 5	HGNC:3119	details
hsa-miR-181a-5p	RAP1B	RAP1B, member of RAS oncogene family	HGNC:9857	details
hsa-miR-181a-5p	ZNF664	zinc finger protein 664	HGNC:25406	details
hsa-miR-181a-5p	ZNF136	zinc finger protein 136	HGNC:12920	details
hsa-miR-181a-5p	ZNF121	zinc finger protein 121	HGNC:12904	details
hsa-miR-181a-5p	ZFP36L1	ZFP36 ring finger protein like 1	HGNC:1107	details
hsa-miR-181a-5p	ZBTB4	zinc finger and BTB domain containing 4	HGNC:23847	details
hsa-miR-181a-5p	ZBTB33	zinc finger and BTB domain containing 33	HGNC:16682	details
hsa-miR-181a-5p	ULK1	unc-51 like autophagy activating kinase 1	HGNC:12558	details
hsa-miR-181a-5p	TUBB	tubulin beta class I	HGNC:20778	details
hsa-miR-181a-5p	TTPAL	alpha tocopherol transfer protein like	HGNC:16114	details
hsa-miR-181a-5p	TSG101	tumor susceptibility 101	HGNC:15971	details
hsa-miR-181a-5p	TNRC6B	trinucleotide repeat containing adaptor 6B	HGNC:29190	details
hsa-miR-181a-5p	TMF1	TATA element modulatory factor 1	HGNC:11870	details
hsa-miR-181a-5p	TMEM30A	transmembrane protein 30A	HGNC:16667	details
hsa-miR-181a-5p	TFRC	transferrin receptor	HGNC:11763	details
hsa-miR-181a-5p	TBL1XR1	TBL1X receptor 1	HGNC:29529	details
hsa-miR-181a-5p	TBC1D7	TBC1 domain family member 7	HGNC:21066	details
hsa-miR-181a-5p	TBC1D13	TBC1 domain family member 13	HGNC:25571	details
hsa-miR-181a-5p	STX2	syntaxin 2	HGNC:3403	details
hsa-miR-181a-5p	STAG1	stromal antigen 1	HGNC:11354	details
hsa-miR-181a-5p	SSX2IP	SSX family member 2 interacting protein	HGNC:16509	details
hsa-miR-181a-5p	SRGN	serglycin	HGNC:9361	details
hsa-miR-181a-5p	SORT1	sortilin 1	HGNC:11186	details
hsa-miR-181a-5p	SMCR8	SMCR8-C9orf72 complex subunit	HGNC:17921	details
hsa-miR-181a-5p	SLC7A1	solute carrier family 7 member 1	HGNC:11057	details
hsa-miR-181a-5p	SLC38A2	solute carrier family 38 member 2	HGNC:13448	details
hsa-miR-181a-5p	SLC25A37	solute carrier family 25 member 37	HGNC:29786	details
hsa-miR-181a-5p	SLC19A2	solute carrier family 19 member 2	HGNC:10938	details
hsa-miR-181a-5p	SLC10A7	solute carrier family 10 member 7	HGNC:23088	details
hsa-miR-181a-5p	SIPA1L1	signal induced proliferation associated 1 like 1	HGNC:20284	details
hsa-miR-181a-5p	SHOC2	SHOC2 leucine rich repeat scaffold protein	HGNC:15454	details
hsa-miR-181a-5p	RP2	RP2 activator of ARL3 GTPase	HGNC:10274	details
hsa-miR-181a-5p	RHOG	ras homolog family member G	HGNC:672	details
hsa-miR-181a-5p	RGS16	regulator of G protein signaling 16	HGNC:9997	details
hsa-miR-181a-5p	RCOR1	REST corepressor 1	HGNC:17441	details
hsa-miR-181a-5p	RAN	RAN, member RAS oncogene family	HGNC:9846	details
hsa-miR-181a-5p	RAB2B	RAB2B, member RAS oncogene family	HGNC:20246	details
hsa-miR-181a-5p	PURB	purine rich element binding protein B	HGNC:9702	details
hsa-miR-181a-5p	PRKCD	protein kinase C delta	HGNC:9399	details
hsa-miR-181a-5p	PNRC2	proline rich nuclear receptor coactivator 2	HGNC:23158	details
hsa-miR-181a-5p	PMAIP1	phorbol-12-myristate-13-acetate-induced protein 1	HGNC:9108	details
hsa-miR-181a-5p	PHC3	polyhomeotic homolog 3	HGNC:15682	details
hsa-miR-181a-5p	PGAP1	post-GPI attachment to proteins inositol deacylase 1	HGNC:25712	details
hsa-miR-181a-5p	PER2	period circadian regulator 2	HGNC:8846	details
hsa-miR-181a-5p	PEBP1	phosphatidylethanolamine binding protein 1	HGNC:8630	details
hsa-miR-181a-5p	PBRM1	polybromo 1	HGNC:30064	details
hsa-miR-181a-5p				details
hsa-miR-181a-5p	OSBPL3	oxysterol binding protein like 3	HGNC:16370	details
hsa-miR-181a-5p	NMT2	N-myristoyltransferase 2	HGNC:7858	details
hsa-miR-181a-5p				details
hsa-miR-181a-5p	NIN	ninein	HGNC:14906	details
hsa-miR-181a-5p	NHLRC3	NHL repeat containing 3	HGNC:33751	details
hsa-miR-181a-5p	NCOA3	nuclear receptor coactivator 3	HGNC:7670	details
hsa-miR-181a-5p	NCAPG	non-SMC condensin I complex subunit G	HGNC:24304	details
hsa-miR-181a-5p	NAA50	N-alpha-acetyltransferase 50, NatE catalytic subunit	HGNC:29533	details
hsa-miR-181a-5p	MTX3	metaxin 3	HGNC:24812	details
hsa-miR-181a-5p	MTUS1	microtubule associated scaffold protein 1	HGNC:29789	details
hsa-miR-181a-5p				details
hsa-miR-181a-5p	KMT2E	lysine methyltransferase 2E (inactive)	HGNC:18541	details
hsa-miR-181a-5p	LRRC8D	leucine rich repeat containing 8 VRAC subunit D	HGNC:16992	details
hsa-miR-181a-5p	LPCAT1	lysophosphatidylcholine acyltransferase 1	HGNC:25718	details
hsa-miR-181a-5p	LONRF1	LON peptidase N-terminal domain and ring finger 1	HGNC:26302	details
hsa-miR-181a-5p	LMAN1	lectin, mannose binding 1	HGNC:6631	details
hsa-miR-181a-5p	KPNA1	karyopherin subunit alpha 1	HGNC:6394	details
hsa-miR-181a-5p	KIF3B	kinesin family member 3B	HGNC:6320	details
hsa-miR-181a-5p	KIF2C	kinesin family member 2C	HGNC:6393	details
hsa-miR-181a-5p	EFCAB14	EF-hand calcium binding domain 14	HGNC:29051	details
hsa-miR-181a-5p	WASHC5	WASH complex subunit 5	HGNC:28984	details
hsa-miR-181a-5p	KDM5A	lysine demethylase 5A	HGNC:9886	details
hsa-miR-181a-5p	IPO5	importin 5	HGNC:6402	details
hsa-miR-181a-5p	INO80D	INO80 complex subunit D	HGNC:25997	details
hsa-miR-181a-5p	IL1A	interleukin 1 alpha	HGNC:5991	details
hsa-miR-181a-5p				details
hsa-miR-181a-5p	HIGD2A	HIG1 hypoxia inducible domain family member 2A	HGNC:28311	details
hsa-miR-181a-5p	HECW2	HECT, C2 and WW domain containing E3 ubiquitin protein ligase 2	HGNC:29853	details
hsa-miR-181a-5p	GOT1	glutamic-oxaloacetic transaminase 1	HGNC:4432	details
hsa-miR-181a-5p	GOLGA8B	golgin A8 family member B	HGNC:31973	details
hsa-miR-181a-5p	GOLGA1	golgin A1	HGNC:4424	details
hsa-miR-181a-5p	GNS	glucosamine (N-acetyl)-6-sulfatase	HGNC:4422	details
hsa-miR-181a-5p	GK5	glycerol kinase 5	HGNC:28635	details
hsa-miR-181a-5p	G3BP2	G3BP stress granule assembly factor 2	HGNC:30291	details
hsa-miR-181a-5p	FSD1L	fibronectin type III and SPRY domain containing 1 like	HGNC:13753	details
hsa-miR-181a-5p	FNDC3B	fibronectin type III domain containing 3B	HGNC:24670	details
hsa-miR-181a-5p	CCNQ	cyclin Q	HGNC:28434	details
hsa-miR-181a-5p	EPS15	epidermal growth factor receptor pathway substrate 15	HGNC:3419	details
hsa-miR-181a-5p	EED	embryonic ectoderm development	HGNC:3188	details
hsa-miR-181a-5p	DYNC1LI2	dynein cytoplasmic 1 light intermediate chain 2	HGNC:2966	details
hsa-miR-181a-5p	DRAM1	DNA damage regulated autophagy modulator 1	HGNC:25645	details
hsa-miR-181a-5p	DDX52	DExD-box helicase 52	HGNC:20038	details
hsa-miR-181a-5p	DAZAP2	DAZ associated protein 2	HGNC:2684	details
hsa-miR-181a-5p	CUL5	cullin 5	HGNC:2556	details
hsa-miR-181a-5p	CPOX	coproporphyrinogen oxidase	HGNC:2321	details
hsa-miR-181a-5p	CPEB4	cytoplasmic polyadenylation element binding protein 4	HGNC:21747	details
hsa-miR-181a-5p	CLCC1	chloride channel CLIC like 1	HGNC:29675	details
hsa-miR-181a-5p	CHD9	chromodomain helicase DNA binding protein 9	HGNC:25701	details
hsa-miR-181a-5p	CHCHD7	coiled-coil-helix-coiled-coil-helix domain containing 7	HGNC:28314	details
hsa-miR-181a-5p	CCNK	cyclin K	HGNC:1596	details
hsa-miR-181a-5p	CCL22	C-C motif chemokine ligand 22	HGNC:10621	details
hsa-miR-181a-5p	CCDC88C	coiled-coil domain containing 88C	HGNC:19967	details
hsa-miR-181a-5p	CARM1	coactivator associated arginine methyltransferase 1	HGNC:23393	details
hsa-miR-181a-5p	C2orf69	chromosome 2 open reading frame 69	HGNC:26799	details
hsa-miR-181a-5p				details
hsa-miR-181a-5p	GSKIP	GSK3B interacting protein	HGNC:20343	details
hsa-miR-181a-5p				details
hsa-miR-181a-5p	EMSY	EMSY transcriptional repressor, BRCA2 interacting	HGNC:18071	details
hsa-miR-181a-5p	BLOC1S2	biogenesis of lysosomal organelles complex 1 subunit 2	HGNC:20984	details
hsa-miR-181a-5p	BAZ2A	bromodomain adjacent to zinc finger domain 2A	HGNC:962	details
hsa-miR-181a-5p	PRRC2C	proline rich coiled-coil 2C	HGNC:24903	details
hsa-miR-181a-5p	ATP2B1	ATPase plasma membrane Ca2+ transporting 1	HGNC:814	details
hsa-miR-181a-5p	ATG2B	autophagy related 2B	HGNC:20187	details
hsa-miR-181a-5p	ASB1	ankyrin repeat and SOCS box containing 1	HGNC:16011	details
hsa-miR-181a-5p	ARRDC3	arrestin domain containing 3	HGNC:29263	details
hsa-miR-181a-5p	ARRB2	arrestin beta 2	HGNC:712	details
hsa-miR-181a-5p	APOL6	apolipoprotein L6	HGNC:14870	details
hsa-miR-181a-5p	ALDH9A1	aldehyde dehydrogenase 9 family member A1	HGNC:412	details
hsa-miR-181a-5p	AFF4	AF4/FMR2 family member 4	HGNC:17869	details
hsa-miR-181a-5p	GRK2	G protein-coupled receptor kinase 2	HGNC:289	details
hsa-miR-181a-5p	ACYP1	acylphosphatase 1	HGNC:179	details
hsa-miR-181a-5p	DCAF4	DDB1 and CUL4 associated factor 4	HGNC:20229	details
hsa-miR-181a-5p	RSF1	remodeling and spacing factor 1	HGNC:18118	details
hsa-miR-181a-5p				details
hsa-miR-181a-5p	NSD2	nuclear receptor binding SET domain protein 2	HGNC:12766	details
hsa-miR-181a-5p	SLC25A25	solute carrier family 25 member 25	HGNC:20663	details
hsa-miR-181a-5p	PPP2R5E	protein phosphatase 2 regulatory subunit B'epsilon	HGNC:9313	details
hsa-miR-181a-5p	MIGA2	mitoguardin 2	HGNC:23621	details
hsa-miR-181a-5p	CBX4	chromobox 4	HGNC:1554	details
hsa-miR-181a-5p	CAPRIN2	caprin family member 2	HGNC:21259	details
hsa-miR-181a-5p	TNPO1	transportin 1	HGNC:6401	details
hsa-miR-181a-5p	FKBP1C	FKBP prolyl isomerase family member 1C	HGNC:21376	details
hsa-miR-181a-5p	ZNF83	zinc finger protein 83	HGNC:13158	details
hsa-miR-181a-5p	HSPA1B	heat shock protein family A (Hsp70) member 1B	HGNC:5233	details
hsa-miR-181a-5p	ZNF669	zinc finger protein 669	HGNC:25736	details
hsa-miR-181a-5p				details
hsa-miR-181a-5p	ZNF781	zinc finger protein 781	HGNC:26745	details
hsa-miR-181a-5p	ZNF667	zinc finger protein 667	HGNC:28854	details
hsa-miR-181a-5p	ZNF487	zinc finger protein 487	HGNC:23488	details
hsa-miR-181a-5p	TMEM94	transmembrane protein 94	HGNC:28983	details
hsa-miR-181a-5p				details
hsa-miR-181a-5p	ZNF440	zinc finger protein 440	HGNC:20874	details
hsa-miR-181a-5p	EPS8	epidermal growth factor receptor pathway substrate 8	HGNC:3420	details
hsa-miR-181a-5p				details
hsa-miR-181a-5p	MAN1A2	mannosidase alpha class 1A member 2	HGNC:6822	details
hsa-miR-181a-5p	FKBP14	FKBP prolyl isomerase 14	HGNC:18625	details
hsa-miR-181a-5p	ZNF791	zinc finger protein 791	HGNC:26895	details
hsa-miR-181a-5p	ZFP69B	ZFP69 zinc finger protein B	HGNC:28053	details
hsa-miR-181a-5p	ZFAND6	zinc finger AN1-type containing 6	HGNC:30164	details
hsa-miR-181a-5p	NPM3	nucleophosmin/nucleoplasmin 3	HGNC:7931	details
hsa-miR-181a-5p	HSP90B1	heat shock protein 90 beta family member 1	HGNC:12028	details
hsa-miR-181a-5p	GJB7	gap junction protein beta 7	HGNC:16690	details
hsa-miR-181a-5p	ZDHHC15	zinc finger DHHC-type palmitoyltransferase 15	HGNC:20342	details
hsa-miR-181a-5p	XPNPEP3	X-prolyl aminopeptidase 3	HGNC:28052	details
hsa-miR-181a-5p	ZNF699	zinc finger protein 699	HGNC:24750	details
hsa-miR-181a-5p	PHOX2B	paired like homeobox 2B	HGNC:9143	details
hsa-miR-181a-5p	HEPHL1	hephaestin like 1	HGNC:30477	details
hsa-miR-181a-5p	ATP8B1	ATPase phospholipid transporting 8B1	HGNC:3706	details
hsa-miR-181a-5p	PLPP3	phospholipid phosphatase 3	HGNC:9229	details
hsa-miR-181a-5p	ZNF844	zinc finger protein 844	HGNC:25932	details
hsa-miR-181a-5p	ZNF780B	zinc finger protein 780B	HGNC:33109	details
hsa-miR-181a-5p	NCOA7	nuclear receptor coactivator 7	HGNC:21081	details
hsa-miR-181a-5p	ZNF266	zinc finger protein 266	HGNC:13059	details
hsa-miR-181a-5p	KRBOX4	KRAB box domain containing 4	HGNC:26007	details
hsa-miR-181a-5p	ZNF439	zinc finger protein 439	HGNC:20873	details
hsa-miR-181a-5p	SCAMP2	secretory carrier membrane protein 2	HGNC:10564	details
hsa-miR-181a-5p	TMCC1	transmembrane and coiled-coil domain family 1	HGNC:29116	details
hsa-miR-181a-5p	FOXL1	forkhead box L1	HGNC:3817	details
hsa-miR-181a-5p	SLC35G2	solute carrier family 35 member G2	HGNC:28480	details
hsa-miR-181a-5p	ZNF107	zinc finger protein 107	HGNC:12887	details
hsa-miR-181a-5p	MRPL34	mitochondrial ribosomal protein L34	HGNC:14488	details
hsa-miR-181a-5p	SPIRE1	spire type actin nucleation factor 1	HGNC:30622	details
hsa-miR-181a-5p	RNF6	ring finger protein 6	HGNC:10069	details
hsa-miR-181a-5p	PTPDC1	protein tyrosine phosphatase domain containing 1	HGNC:30184	details
hsa-miR-181a-5p	HMGA2	high mobility group AT-hook 2	HGNC:5009	details
hsa-miR-181a-5p	FKBP1A	FKBP prolyl isomerase 1A	HGNC:3711	details
hsa-miR-181a-5p	CSNK1A1	casein kinase 1 alpha 1	HGNC:2451	details
hsa-miR-181a-5p	CHMP2B	charged multivesicular body protein 2B	HGNC:24537	details
hsa-miR-181a-5p	ARSJ	arylsulfatase family member J	HGNC:26286	details
hsa-miR-181a-5p	ZNF415	zinc finger protein 415	HGNC:20636	details
hsa-miR-181a-5p	ZNF616	zinc finger protein 616	HGNC:28062	details
hsa-miR-181a-5p	SUV39H2	SUV39H2 histone lysine methyltransferase	HGNC:17287	details
hsa-miR-181a-5p	ID4	inhibitor of DNA binding 4, HLH protein	HGNC:5363	details
hsa-miR-181a-5p	FAM3C	FAM3 metabolism regulating signaling molecule C	HGNC:18664	details
hsa-miR-181a-5p	ZNF846	zinc finger protein 846	HGNC:27260	details
hsa-miR-181a-5p	ZNF268	zinc finger protein 268	HGNC:13061	details
hsa-miR-181a-5p	ZNF23	zinc finger protein 23	HGNC:13023	details
hsa-miR-181a-5p	TUBB2A	tubulin beta 2A class IIa	HGNC:12412	details
hsa-miR-181a-5p	GTPBP3	GTP binding protein 3, mitochondrial	HGNC:14880	details
hsa-miR-181a-5p	IRAK1BP1	interleukin 1 receptor associated kinase 1 binding protein 1	HGNC:17368	details
hsa-miR-181a-5p	UNC5B	unc-5 netrin receptor B	HGNC:12568	details
hsa-miR-181a-5p	ELK4	ETS transcription factor ELK4	HGNC:3326	details
hsa-miR-181a-5p	SLC35G3	solute carrier family 35 member G3	HGNC:26848	details
hsa-miR-181a-5p	ETS1	ETS proto-oncogene 1, transcription factor	HGNC:3488	details
hsa-miR-181a-5p	ZC3HAV1L	zinc finger CCCH-type containing, antiviral 1 like	HGNC:22423	details
hsa-miR-181a-5p	RPS6KA3	ribosomal protein S6 kinase A3	HGNC:10432	details
hsa-miR-181a-5p	AP5M1	adaptor related protein complex 5 subunit mu 1	HGNC:20192	details
hsa-miR-181a-5p	ZNF829	zinc finger protein 829	HGNC:34032	details
hsa-miR-181a-5p	WDR72	WD repeat domain 72	HGNC:26790	details
hsa-miR-181a-5p	HFM1	helicase for meiosis 1	HGNC:20193	details
hsa-miR-181a-5p	SPTLC3	serine palmitoyltransferase long chain base subunit 3	HGNC:16253	details
hsa-miR-181a-5p	SCN8A	sodium voltage-gated channel alpha subunit 8	HGNC:10596	details
hsa-miR-181a-5p	ATXN7	ataxin 7	HGNC:10560	details
hsa-miR-181a-5p				details
hsa-miR-181a-5p	RBM25	RNA binding motif protein 25	HGNC:23244	details
hsa-miR-181a-5p	ZADH2	zinc binding alcohol dehydrogenase domain containing 2	HGNC:28697	details
hsa-miR-181a-5p	AP3M2	adaptor related protein complex 3 subunit mu 2	HGNC:570	details
hsa-miR-181a-5p	PTBP3	polypyrimidine tract binding protein 3	HGNC:10253	details
hsa-miR-181a-5p	ZNF556	zinc finger protein 556	HGNC:25669	details
hsa-miR-181a-5p	ZNF253	zinc finger protein 253	HGNC:13497	details
hsa-miR-181a-5p	TOPBP1	DNA topoisomerase II binding protein 1	HGNC:17008	details
hsa-miR-181a-5p	TEF	TEF transcription factor, PAR bZIP family member	HGNC:11722	details
hsa-miR-181a-5p	PDIA6	protein disulfide isomerase family A member 6	HGNC:30168	details
hsa-miR-181a-5p	RNMT	RNA guanine-7 methyltransferase	HGNC:10075	details
hsa-miR-181a-5p	LDLR	low density lipoprotein receptor	HGNC:6547	details
hsa-miR-181a-5p	ADAM17	ADAM metallopeptidase domain 17	HGNC:195	details
hsa-miR-181a-5p	RSBN1L	round spermatid basic protein 1 like	HGNC:24765	details
hsa-miR-181a-5p	KLHL24	kelch like family member 24	HGNC:25947	details
hsa-miR-181a-5p	PDK3	pyruvate dehydrogenase kinase 3	HGNC:8811	details
hsa-miR-181a-5p	RNF187	ring finger protein 187	HGNC:27146	details
hsa-miR-181a-5p	ZNF597	zinc finger protein 597	HGNC:26573	details
hsa-miR-181a-5p	CENPO	centromere protein O	HGNC:28152	details
hsa-miR-181a-5p	FAM13A	family with sequence similarity 13 member A	HGNC:19367	details
hsa-miR-181a-5p	RLIM	ring finger protein, LIM domain interacting	HGNC:13429	details
hsa-miR-181a-5p	VCAM1	vascular cell adhesion molecule 1	HGNC:12663	details
hsa-miR-181a-5p	LAPTM4B	lysosomal protein transmembrane 4 beta	HGNC:13646	details
hsa-miR-181a-5p	ZNF449	zinc finger protein 449	HGNC:21039	details
hsa-miR-181a-5p	PNKD	PNKD metallo-beta-lactamase domain containing	HGNC:9153	details
hsa-miR-181a-5p	EN2	engrailed homeobox 2	HGNC:3343	details
hsa-miR-181a-5p	RGS5	regulator of G protein signaling 5	HGNC:10001	details
hsa-miR-181a-5p	IFNG	interferon gamma	HGNC:5438	details
hsa-miR-181a-5p	AHR	aryl hydrocarbon receptor	HGNC:348	details
hsa-miR-181a-5p	STAT3	signal transducer and activator of transcription 3	HGNC:11364	details
hsa-miR-181a-5p	WIF1	WNT inhibitory factor 1	HGNC:18081	details
hsa-miR-181a-5p	TWIST1	twist family bHLH transcription factor 1	HGNC:12428	details
hsa-miR-181a-5p	MAPK1	mitogen-activated protein kinase 1	HGNC:6871	details
hsa-miR-181a-5p	ABCG2	ATP binding cassette subfamily G member 2 (Junior blood group)	HGNC:74	details
hsa-miR-181a-5p	PHACTR2	phosphatase and actin regulator 2	HGNC:20956	details
hsa-miR-181a-5p	SASH1	SAM and SH3 domain containing 1	HGNC:19182	details
hsa-miR-181a-5p	PHLDA1	pleckstrin homology like domain family A member 1	HGNC:8933	details
hsa-miR-181a-5p	MOSPD1	motile sperm domain containing 1	HGNC:25235	details
hsa-miR-181a-5p	SRGAP1	SLIT-ROBO Rho GTPase activating protein 1	HGNC:17382	details
hsa-miR-181a-5p	C12orf29	chromosome 12 open reading frame 29	HGNC:25322	details
hsa-miR-181a-5p	UBL3	ubiquitin like 3	HGNC:12504	details
hsa-miR-181a-5p	PHACTR4	phosphatase and actin regulator 4	HGNC:25793	details
hsa-miR-181a-5p	EREG	epiregulin	HGNC:3443	details
hsa-miR-181a-5p	TERT	telomerase reverse transcriptase	HGNC:11730	details
hsa-miR-181a-5p	CTDSPL	CTD small phosphatase like	HGNC:16890	details
hsa-miR-181a-5p	TUSC3	tumor suppressor candidate 3	HGNC:30242	details
hsa-miR-181a-5p	MEG3	maternally expressed 3	HGNC:14575	details
hsa-miR-181a-5p	PHLPP2	PH domain and leucine rich repeat protein phosphatase 2	HGNC:29149	details
hsa-miR-181a-5p	GPD1L	glycerol-3-phosphate dehydrogenase 1 like	HGNC:28956	details
hsa-miR-181a-5p	PTEN	phosphatase and tensin homolog	HGNC:9588	details
hsa-miR-181a-5p	ALDH1A1	aldehyde dehydrogenase 1 family member A1	HGNC:402	details
hsa-miR-181a-5p	CDKN1A	cyclin dependent kinase inhibitor 1A	HGNC:1784	details
hsa-miR-181a-5p	BAX	BCL2 associated X, apoptosis regulator	HGNC:959	details
hsa-miR-181a-5p	RASSF1	Ras association domain family member 1	HGNC:9882	details
hsa-miR-181a-5p	INPP4B	inositol polyphosphate-4-phosphatase type II B	HGNC:6075	details
hsa-miR-181a-5p	CTNNB1	catenin beta 1	HGNC:2514	details
hsa-miR-181a-5p	TCF4	transcription factor 4	HGNC:11634	details
hsa-miR-181a-5p	VEGFA	vascular endothelial growth factor A	HGNC:12680	details
hsa-miR-181a-5p	PRKN	parkin RBR E3 ubiquitin protein ligase	HGNC:8607	details
hsa-miR-181a-5p	EGR1	early growth response 1	HGNC:3238	details
hsa-miR-181a-5p	NRAS	NRAS proto-oncogene, GTPase	HGNC:7989	details
hsa-miR-181a-5p	RUNX1	RUNX family transcription factor 1	HGNC:10471	details
hsa-miR-181a-5p	CEBPA	CCAAT enhancer binding protein alpha	HGNC:1833	details
hsa-miR-181a-5p	SAMHD1	SAM and HD domain containing deoxynucleoside triphosphate triphosphohydrolase 1	HGNC:15925	details
hsa-miR-181a-5p	ADCY9	adenylate cyclase 9	HGNC:240	details
hsa-miR-181a-5p	DCBLD2	discoidin, CUB and LCCL domain containing 2	HGNC:24627	details
hsa-miR-181a-5p	RPL13A	ribosomal protein L13a	HGNC:10304	details
hsa-miR-181a-5p	CADPS2	calcium dependent secretion activator 2	HGNC:16018	details
hsa-miR-181a-5p	PRAMEF11	PRAME family member 11	HGNC:14086	details
hsa-miR-181a-5p	PRAMEF15	PRAME family member 15	HGNC:26764	details
hsa-miR-181a-5p	PRAMEF26	PRAME family member 26	HGNC:49178	details
hsa-miR-181a-5p	PRAMEF4	PRAME family member 4	HGNC:31971	details
hsa-miR-181a-5p	PRAMEF9	PRAME family member 9	HGNC:27996	details
hsa-miR-181a-5p	HNRNPH1	heterogeneous nuclear ribonucleoprotein H1	HGNC:5041	details
hsa-miR-181a-5p	WDFY3	WD repeat and FYVE domain containing 3	HGNC:20751	details

miRNA Card

Confidence 3 (3 of 3 tools predicted)

Confidence 2 (2 of 3 tools predicted)

Confidence 1 (1 of 3 tools predicted)