miRNA Card

miRNA General Information
miRNA ID hsa-miR-181a-5p
Description Homo sapiens miR-181a-2 stem-loop
Comment This human miRNA was predicted by computational methods using conservation with mouse and Fugu rubripes sequences [1]. Expression of the excised miR has been validated in zebrafish, and the ends mapped by cloning. Landgraf et al. and Lui et al. later verify expression in human [4-5].
Experiment cloned [2,4-6]
Sequence AACAUUCAACGCUGUCGGUGAGU
miRNA Expression in different cancers



circRNA-miRNA-gene regulatory network

Note about Netwrok:
This is a network diagram with miRNA (purple circle) as the center.
We used three tools(PITA, miRanda, targetScan) to predict the binding sites of circrna (green circle) and miRNA. Accordingly, for this miRNA that binds to circrna, we have three confidence levels, namely confident 1, confident 2 and confident 3. Confidence value indicates how many tools can deduce these results. For each confidence, we use different kinds of dashed lines.

Target circRNA with confidence

Confidence 3 (3 of 3 tools predicted)

Confidence 1 (1 of 3 tools predicted)

CircID miRNA PITA miRanda targetScan
chr19:814720|814950 hsa-miR-181a-5p 1 0 0
chr1:161038195|161038333 hsa-miR-181a-5p 0 1 0
chr19:52907097|52907432 hsa-miR-181a-5p 0 1 0
chr1:43990846|43991037 hsa-miR-181a-5p 0 1 0
chr4:17800823|17800978 hsa-miR-181a-5p 0 1 0
chr16:18815186|18815469 hsa-miR-181a-5p 0 1 0
chr13:38691744|38691874 hsa-miR-181a-5p 0 1 0
chr5:35060846|35060925 hsa-miR-181a-5p 0 1 0
chr7:128770754|128770890 hsa-miR-181a-5p 0 1 0
chr16:1772173|1772342 hsa-miR-181a-5p 0 1 0
chr6:30493413|30493589 hsa-miR-181a-5p 0 1 0
chr3:113721230|113721413 hsa-miR-181a-5p 0 1 0
chr12:113191573|113191764 hsa-miR-181a-5p 0 1 0
chr14:94380895|94381079 hsa-miR-181a-5p 0 1 0
chr9:128178905|128179072 hsa-miR-181a-5p 0 1 0
chr17:42857423|42857605 hsa-miR-181a-5p 0 1 0
chr1:169477375|169477499 hsa-miR-181a-5p 0 1 0
chr2:131048872|131049055 hsa-miR-181a-5p 0 1 0
chr8:144930961|144931128 hsa-miR-181a-5p 0 1 0
chr1:45004656|45004770 hsa-miR-181a-5p 0 1 0
chrX:103253642|103253747 hsa-miR-181a-5p 0 1 0
chr14:74551271|74552248 hsa-miR-181a-5p 0 1 0
chr10:95643028|95643140 hsa-miR-181a-5p 0 1 0
chr15:41909699|41909830 hsa-miR-181a-5p 0 1 0
chr11:34661698|34661850 hsa-miR-181a-5p 0 1 0
chr11:34661681|34661848 hsa-miR-181a-5p 0 1 0
chr11:62525888|62526049 hsa-miR-181a-5p 0 1 0
chr5:142600771|142614032 hsa-miR-181a-5p 0 1 0
chr2:131048872|131048973 hsa-miR-181a-5p 0 1 0
chr19:53140743|53140826 hsa-miR-181a-5p 0 1 0
chr10:87753940|87754059 hsa-miR-181a-5p 0 1 0
chr17:48121841|48122122 hsa-miR-181a-5p 0 1 0
chr17:78973047|78973136 hsa-miR-181a-5p 0 1 0
chr8:144142983|144143076 hsa-miR-181a-5p 1 0 0
chr6:29944578|29945281 hsa-miR-181a-5p 1 0 0
chr17:46030476|46030804 hsa-miR-181a-5p 1 0 0
chr19:34400327|34400528 hsa-miR-181a-5p 1 0 0
chr12:69271617|69271772 hsa-miR-181a-5p 0 1 0
chr19:43586192|43586408 hsa-miR-181a-5p 0 1 0
chr3:125987184|125987356 hsa-miR-181a-5p 0 1 0
chr1:6223724|6223879 hsa-miR-181a-5p 0 1 0
chr3:49123285|49123517 hsa-miR-181a-5p 0 1 0
chr2:38826005|38826604 hsa-miR-181a-5p 0 1 0
chr3:49727182|49727317 hsa-miR-181a-5p 0 1 0
chr17:35259050|35259168 hsa-miR-181a-5p 0 1 0
chr8:23020965|23021095 hsa-miR-181a-5p 0 1 0
chr16:1772173|1772326 hsa-miR-181a-5p 0 1 0
chr8:101719319|101719417 hsa-miR-181a-5p 0 1 0
chr2:215406309|215406452 hsa-miR-181a-5p 0 1 0
chr9:128178929|128179105 hsa-miR-181a-5p 0 1 0
chr6:30740496|30740786 hsa-miR-181a-5p 0 1 0
chr16:1772173|1772328 hsa-miR-181a-5p 0 1 0
chr3:180951347|180951468 hsa-miR-181a-5p 0 1 0
chr16:1772173|1772345 hsa-miR-181a-5p 0 1 0
chr17:42857442|42857605 hsa-miR-181a-5p 0 1 0
chr3:128625633|128625963 hsa-miR-181a-5p 0 1 0
chr16:64947788|64947977 hsa-miR-181a-5p 0 1 0
chr3:172328952|172329076 hsa-miR-181a-5p 0 1 0
chr2:131048872|131049090 hsa-miR-181a-5p 0 1 0
chr20:37225702|37225802 hsa-miR-181a-5p 0 1 0
chr1:45004705|45004806 hsa-miR-181a-5p 0 1 0
chr11:62525977|62526127 hsa-miR-181a-5p 0 1 0
chr5:173317322|173317483 hsa-miR-181a-5p 0 1 0
chr1:54205049|54205195 hsa-miR-181a-5p 0 1 0
chr19:12876229|12876361 hsa-miR-181a-5p 0 1 0
chr19:40804784|40805022 hsa-miR-181a-5p 0 1 0
chr12:56159691|56160053 hsa-miR-181a-5p 0 1 0
chr1:51790596|51790959 hsa-miR-181a-5p 0 1 0
chr17:68515430|68515566 hsa-miR-181a-5p 0 1 0
chr10:123157745|123157861 hsa-miR-181a-5p 0 1 0
chr19:58262125|58262292 hsa-miR-181a-5p 0 1 0
chr12:56159687|56160053 hsa-miR-181a-5p 0 1 0
chr19:52384716|52385051 hsa-miR-181a-5p 0 1 0
chr2:131048872|131049169 hsa-miR-181a-5p 0 1 0
chr7:146095~146195 hsa-miR-181a-5p 0 1 0
chr9:128178797~128179014 hsa-miR-181a-5p 0 1 0
chr8:144930961~144931128 hsa-miR-181a-5p 0 1 0
chr10:72275700~72275879 hsa-miR-181a-5p 0 1 0
chr5:136063240~136063365 hsa-miR-181a-5p 0 1 0
chr10:26724014~26724112 hsa-miR-181a-5p 0 1 0
chr11:85696342~85696518 hsa-miR-181a-5p 0 1 0
chr19:53140743~53140826 hsa-miR-181a-5p 0 1 0
chr2:95274695~95274829 hsa-miR-181a-5p 0 1 0
chr16:1772173~1772326 hsa-miR-181a-5p 0 1 0
chr16:1772191~1772345 hsa-miR-181a-5p 0 1 0
chr1:32190091~32190249 hsa-miR-181a-5p 0 1 0
chr6:152077500~152077761 hsa-miR-181a-5p 0 1 0
chr6:31640199~31640282 hsa-miR-181a-5p 0 1 0
chr17:46030476~46030804 hsa-miR-181a-5p 0 1 0
chr20:37225702~37225802 hsa-miR-181a-5p 0 1 0
chr2:131048872~131048983 hsa-miR-181a-5p 0 1 0
chr5:35060846~35060925 hsa-miR-181a-5p 0 1 0
chr1:43990846~43991037 hsa-miR-181a-5p 0 1 0
chr15:63071402~63071497 hsa-miR-181a-5p 0 1 0
chr15:41826156~41826486 hsa-miR-181a-5p 0 1 0
chr16:1772173~1772328 hsa-miR-181a-5p 0 1 0
chr1:32190085~32190249 hsa-miR-181a-5p 0 1 0
chr19:52384716~52385051 hsa-miR-181a-5p 0 1 0
chr17:12141586~12141696 hsa-miR-181a-5p 0 1 0
chr15:63071455~63071678 hsa-miR-181a-5p 0 1 0
chr1:32280112~32280210 hsa-miR-181a-5p 0 1 0
chr18:74260915~74263437 hsa-miR-181a-5p 0 1 0
chr1:46193564~46194306 hsa-miR-181a-5p 0 1 0
chr14:61539922|61540096 hsa-miR-181a-5p 1 0 0
chr9:128178953|128179098 hsa-miR-181a-5p 0 1 0
chr17:58279340|58279908 hsa-miR-181a-5p 0 1 0
chr7:92662114|92662371 hsa-miR-181a-5p 0 1 0
chr2:63454612|63454740 hsa-miR-181a-5p 0 1 0
chr18:58689607|58689696 hsa-miR-181a-5p 0 1 0
chr2:20035003|20041011 hsa-miR-181a-5p 0 1 0
chr3:16414875|16414990 hsa-miR-181a-5p 0 1 0
chr5:172854962|172855148 hsa-miR-181a-5p 0 1 0
chr18:13614799|13615026 hsa-miR-181a-5p 0 1 0
chr19:57473736|57473922 hsa-miR-181a-5p 0 1 0
chr9:128178905|128178988 hsa-miR-181a-5p 0 1 0
chr17:43218206|43218373 hsa-miR-181a-5p 0 1 0
chr19:7217426|7217533 hsa-miR-181a-5p 0 1 0
chr17:75842398|75842568 hsa-miR-181a-5p 0 1 0
chr6:31640262|31640488 hsa-miR-181a-5p 0 1 0
chr7:5064851|5065012 hsa-miR-181a-5p 1 0 0
chr1:12311566|12311909 hsa-miR-181a-5p 0 1 0
chr13:102861591|102861714 hsa-miR-181a-5p 0 1 0
chr19:56423374|56423541 hsa-miR-181a-5p 0 1 0
chr15:63280683|63280787 hsa-miR-181a-5p 0 1 0
chr3:148986234|148986431 hsa-miR-181a-5p 0 1 0
chr17:72646062|72646275 hsa-miR-181a-5p 0 1 0
chr19:4658559|4658695 hsa-miR-181a-5p 0 1 0
chr16:8689863|8690001 hsa-miR-181a-5p 0 1 0
chr19:1422397|1422585 hsa-miR-181a-5p 0 1 0
chr14:105187897|105187998 hsa-miR-181a-5p 0 1 0
chr6:29945068|29945349 hsa-miR-181a-5p 1 0 0
chrX:53614534|53615835 hsa-miR-181a-5p 1 0 0
chr6:30493465|30493703 hsa-miR-181a-5p 0 1 0
chr7:150626153|150626287 hsa-miR-181a-5p 0 1 0
chr20:35177105|35177252 hsa-miR-181a-5p 0 1 0
chr11:44244234|44244344 hsa-miR-181a-5p 0 1 0
chr12:56159682|56160053 hsa-miR-181a-5p 0 1 0
chr5:136063253|136063419 hsa-miR-181a-5p 0 1 0
chr8:22161789|22162611 hsa-miR-181a-5p 0 1 0
chr20:64260067|64260178 hsa-miR-181a-5p 0 1 0
chr5:179113003|179113118 hsa-miR-181a-5p 0 1 0
chr1:171541495|171541659 hsa-miR-181a-5p 0 1 0
chr11:68933095|68933385 hsa-miR-181a-5p 0 1 0
chr7:149255169|149255522 hsa-miR-181a-5p 0 1 0
chr17:4968392|4968501 hsa-miR-181a-5p 0 1 0
chr1:43273642|43273788 hsa-miR-181a-5p 0 1 0
chr1:22913550|22913704 hsa-miR-181a-5p 0 1 0
chr2:215406389|215407316 hsa-miR-181a-5p 0 1 0
chr12:69271700|69271794 hsa-miR-181a-5p 0 1 0
chr5:136063240|136063365 hsa-miR-181a-5p 0 1 0
chr5:136063256|136063365 hsa-miR-181a-5p 0 1 0
chr17:50090091|50090201 hsa-miR-181a-5p 0 1 0
chr1:44218395|44218731 hsa-miR-181a-5p 0 1 0
chr17:72646103|72646237 hsa-miR-181a-5p 0 1 0
chr3:143265295|143265495 hsa-miR-181a-5p 0 1 0
chr11:44244222|44244319 hsa-miR-181a-5p 0 1 0
chr1:26882723|26882885 hsa-miR-181a-5p 0 1 0
chr6:154832522|154832721 hsa-miR-181a-5p 0 1 0
chr2:215406365|215406487 hsa-miR-181a-5p 0 1 0
chr10:7560241|7560446 hsa-miR-181a-5p 0 1 0
chr3:24487971|24488104 hsa-miR-181a-5p 0 1 0
chrX:140783176|140784660 hsa-miR-181a-5p 0 1 0
chr9:33113430|33113799 hsa-miR-181a-5p 0 1 0
chr10:72275645|72275849 hsa-miR-181a-5p 0 1 0
chr16:58707973|58708105 hsa-miR-181a-5p 0 1 0
chr8:22161789|22161852 hsa-miR-181a-5p 0 1 0
chr17:50090091|50090249 hsa-miR-181a-5p 0 1 0
chr1:155186923|155187042 hsa-miR-181a-5p 0 1 0
chr6:30740285|30740781 hsa-miR-181a-5p 0 1 0
chr8:22161789|22162627 hsa-miR-181a-5p 0 1 0
chr16:57664560|57664780 hsa-miR-181a-5p 0 1 0
chr14:75963461|75965695 hsa-miR-181a-5p 0 1 0
chr12:26065244|26065326 hsa-miR-181a-5p 0 1 0
chr3:48469514|48469843 hsa-miR-181a-5p 0 1 0
chr17:50090060|50090201 hsa-miR-181a-5p 0 1 0
chr8:81758260|81758630 hsa-miR-181a-5p 0 1 0
chr5:67168969|67169136 hsa-miR-181a-5p 0 1 0
chr5:136063253|136063365 hsa-miR-181a-5p 0 1 0
chr11:12942699|12942909 hsa-miR-181a-5p 0 1 0
chr15:63071455|63071678 hsa-miR-181a-5p 0 1 0
chr19:40377849|40378065 hsa-miR-181a-5p 0 1 0
chr9:137102499|137102739 hsa-miR-181a-5p 0 1 0
chr15:41826364|41826523 hsa-miR-181a-5p 0 1 0
chr12:64714724|64714953 hsa-miR-181a-5p 0 1 0
chr7:4249183|4249373 hsa-miR-181a-5p 0 1 0
chr14:24305885|24306062 hsa-miR-181a-5p 0 1 0
chr14:81476663|81476895 hsa-miR-181a-5p 0 1 0
chr17:5443701|5443820 hsa-miR-181a-5p 0 1 0
chr5:150691594|150691747 hsa-miR-181a-5p 0 1 0
chr3:114085705|114085870 hsa-miR-181a-5p 0 1 0
chr14:69354212|69354294 hsa-miR-181a-5p 0 1 0
chr15:89908280|89910819 hsa-miR-181a-5p 0 1 0
chr14:49832051|49834449 hsa-miR-181a-5p 0 1 0
chr2:72718103|72733118 hsa-miR-181a-5p 0 1 0
chr8:22161789|22162614 hsa-miR-181a-5p 0 1 0
chr10:72275697|72275879 hsa-miR-181a-5p 0 1 0
chr15:41909699|41909777 hsa-miR-181a-5p 0 1 0
chr1:32190091|32190249 hsa-miR-181a-5p 0 1 0
chr10:17704431|17705741 hsa-miR-181a-5p 0 1 0
chr15:41909699|41909806 hsa-miR-181a-5p 0 1 0
chr2:33257391|33257511 hsa-miR-181a-5p 0 1 0
chr1:155186836|155187074 hsa-miR-181a-5p 0 1 0
chr15:89908311|89908412 hsa-miR-181a-5p 0 1 0
chr17:50090133|50090295 hsa-miR-181a-5p 0 1 0
chr10:72275704|72275879 hsa-miR-181a-5p 0 1 0
chr3:49012572|49012735 hsa-miR-181a-5p 0 1 0
chr2:187464911|187465064 hsa-miR-181a-5p 0 1 0
chr21:44889336|44889457 hsa-miR-181a-5p 0 1 0
chr19:17212981|17213100 hsa-miR-181a-5p 0 1 0
chr6:30493401|30493589 hsa-miR-181a-5p 0 1 0
chr1:65433437|65433605 hsa-miR-181a-5p 0 1 0
chr6:30740287|30740781 hsa-miR-181a-5p 0 1 0
chr6:30493468|30493589 hsa-miR-181a-5p 0 1 0
chr1:51790596|51790968 hsa-miR-181a-5p 0 1 0
chr17:50090085|50090249 hsa-miR-181a-5p 0 1 0
chr1:32279671|32280210 hsa-miR-181a-5p 0 1 0
chr2:131048872|131049049 hsa-miR-181a-5p 0 1 0
chr14:105854972|105855228 hsa-miR-181a-5p 0 1 0
chr17:48121995|48122101 hsa-miR-181a-5p 0 1 0
chr4:89249771|89249909 hsa-miR-181a-5p -11 1 0
chr20:35176983|35177252 hsa-miR-181a-5p -11 1 0
chr16:58707224|58707342 hsa-miR-181a-5p 0 1 0
chr7:150572577|150572681 hsa-miR-181a-5p 1 0 0
chr18:12329650|12329713 hsa-miR-181a-5p 1 0 0
chr6:31640199|31640432 hsa-miR-181a-5p 0 1 0
chr11:44244213|44244344 hsa-miR-181a-5p 0 1 0
chr11:44244222|44244344 hsa-miR-181a-5p 0 1 0
chr19:17808725|17808924 hsa-miR-181a-5p 0 1 0
chr19:1038110|1038351 hsa-miR-181a-5p 0 1 0
chr12:56159682|56160075 hsa-miR-181a-5p 0 1 0
chr5:136063237|136063365 hsa-miR-181a-5p 0 1 0
chr5:136063253|136063429 hsa-miR-181a-5p 0 1 0
chr19:1038139|1038342 hsa-miR-181a-5p 0 1 0
chr17:31531795|31531902 hsa-miR-181a-5p 0 1 0
chr9:133257401|133257491 hsa-miR-181a-5p 0 1 0
chr9:128178851|128179198 hsa-miR-181a-5p 0 1 0
chr8:9136509|9136653 hsa-miR-181a-5p 0 1 0
chr12:56159691|56160075 hsa-miR-181a-5p 0 1 0
chr1:16206180|16206340 hsa-miR-181a-5p 0 1 0
chrX:103253565|103253747 hsa-miR-181a-5p 0 1 0
chr9:128178953|128179084 hsa-miR-181a-5p 0 1 0
chr2:128266230|128266318 hsa-miR-181a-5p 0 1 0
chr1:43990901|43991037 hsa-miR-181a-5p 0 1 0
chr16:1772173|1772442 hsa-miR-181a-5p 0 1 0
chr9:130862805|130862978 hsa-miR-181a-5p 0 1 0
chr20:44432578|44432732 hsa-miR-181a-5p 0 1 0
chr11:12237132|12237218 hsa-miR-181a-5p 0 1 0
chr5:109378509|109378661 hsa-miR-181a-5p 0 1 0
chr9:745218|745371 hsa-miR-181a-5p 0 1 0
chr1:25829622|25829792 hsa-miR-181a-5p 0 1 0
chr1:15583237|15583350 hsa-miR-181a-5p 0 1 0
chr13:100077128|100077335 hsa-miR-181a-5p 0 1 0
chr20:25007023|25007146 hsa-miR-181a-5p 0 1 0
chr3:50358677|50358910 hsa-miR-181a-5p 0 1 0
chr15:78265876|78266033 hsa-miR-181a-5p 0 1 0
chr2:95148477|95148643 hsa-miR-181a-5p 0 1 0
chr4:24576424|24576610 hsa-miR-181a-5p 0 1 0
chr9:128178953|128179072 hsa-miR-181a-5p 0 1 0
chr11:85696342|85696518 hsa-miR-181a-5p 0 1 0
chr2:101002702|101002806 hsa-miR-181a-5p 0 1 0
chr1:209652369|209652483 hsa-miR-181a-5p 0 1 0
chrX:41349588|41349696 hsa-miR-181a-5p 0 1 0
chr17:63592598|63592801 hsa-miR-181a-5p 0 1 0
chr22:41867083|41867280 hsa-miR-181a-5p 0 1 0
chr2:131048872|131048983 hsa-miR-181a-5p 0 1 0
chr8:22127250|22127352 hsa-miR-181a-5p 0 1 0
chr17:75499443|75499626 hsa-miR-181a-5p 0 1 0
chr9:132648432|132648540 hsa-miR-181a-5p 0 1 0
chr5:14710427|14710584 hsa-miR-181a-5p 0 1 0
chr3:172328966|172329076 hsa-miR-181a-5p 0 1 0
chr20:64260054|64260178 hsa-miR-181a-5p 0 1 0
chr5:14710427|14710587 hsa-miR-181a-5p 0 1 0
chr11:44244147|44244344 hsa-miR-181a-5p 0 1 0
chr18:21612337|21612443 hsa-miR-181a-5p 0 1 0
chr17:78973062|78973136 hsa-miR-181a-5p 0 1 0
chr17:48121886|48122129 hsa-miR-181a-5p 0 1 0
chr5:150375098|150375441 hsa-miR-181a-5p 0 1 0
chr11:62626898|62627328 hsa-miR-181a-5p 1 0 0
chr19:18175362|18175686 hsa-miR-181a-5p 1 0 0
chr1:43990821|43990941 hsa-miR-181a-5p 1 0 0
Target genes
miRNA Gene Gene Description HGNC ID details
hsa-miR-181a-5p KAT2B lysine acetyltransferase 2B HGNC:8638 details
hsa-miR-181a-5p PLAG1 PLAG1 zinc finger HGNC:9045 details
hsa-miR-181a-5p CDX2 caudal type homeobox 2 HGNC:1806 details
hsa-miR-181a-5p GATA6 GATA binding protein 6 HGNC:4174 details
hsa-miR-181a-5p NLK nemo like kinase HGNC:29858 details
hsa-miR-181a-5p CDKN1B cyclin dependent kinase inhibitor 1B HGNC:1785 details
hsa-miR-181a-5p PROX1 prospero homeobox 1 HGNC:9459 details
hsa-miR-181a-5p BCL2 BCL2 apoptosis regulator HGNC:990 details
hsa-miR-181a-5p ZNF763 zinc finger protein 763 HGNC:27614 details
hsa-miR-181a-5p DDIT4 DNA damage inducible transcript 4 HGNC:24944 details
hsa-miR-181a-5p ATM ATM serine/threonine kinase HGNC:795 details
hsa-miR-181a-5p HIPK2 homeodomain interacting protein kinase 2 HGNC:14402 details
hsa-miR-181a-5p BCL2L11 BCL2 like 11 HGNC:994 details
hsa-miR-181a-5p HRAS HRas proto-oncogene, GTPase HGNC:5173 details
hsa-miR-181a-5p RNF2 ring finger protein 2 HGNC:10061 details
hsa-miR-181a-5p RALA RAS like proto-oncogene A HGNC:9839 details
hsa-miR-181a-5p SIRT1 sirtuin 1 HGNC:14929 details
hsa-miR-181a-5p PRAP1 proline rich acidic protein 1 HGNC:23304 details
hsa-miR-181a-5p DUSP6 dual specificity phosphatase 6 HGNC:3072 details
hsa-miR-181a-5p PTPN11 protein tyrosine phosphatase non-receptor type 11 HGNC:9644 details
hsa-miR-181a-5p DUSP5 dual specificity phosphatase 5 HGNC:3071 details
hsa-miR-181a-5p PTPN22 protein tyrosine phosphatase non-receptor type 22 HGNC:9652 details
hsa-miR-181a-5p FOS Fos proto-oncogene, AP-1 transcription factor subunit HGNC:3796 details
hsa-miR-181a-5p MTMR3 myotubularin related protein 3 HGNC:7451 details
hsa-miR-181a-5p KLF6 Kruppel like factor 6 HGNC:2235 details
hsa-miR-181a-5p MCL1 MCL1 apoptosis regulator, BCL2 family member HGNC:6943 details
hsa-miR-181a-5p XIAP X-linked inhibitor of apoptosis HGNC:592 details
hsa-miR-181a-5p GPR78 G protein-coupled receptor 78 HGNC:4528 details
hsa-miR-181a-5p details
hsa-miR-181a-5p LFNG LFNG O-fucosylpeptide 3-beta-N-acetylglucosaminyltransferase HGNC:6560 details
hsa-miR-181a-5p LRRC17 leucine rich repeat containing 17 HGNC:16895 details
hsa-miR-181a-5p CHRFAM7A CHRNA7 (exons 5-10) and FAM7A (exons A-E) fusion HGNC:15781 details
hsa-miR-181a-5p CD46 CD46 molecule HGNC:6953 details
hsa-miR-181a-5p RASSF6 Ras association domain family member 6 HGNC:20796 details
hsa-miR-181a-5p FXYD6 FXYD domain containing ion transport regulator 6 HGNC:4030 details
hsa-miR-181a-5p KCTD3 potassium channel tetramerization domain containing 3 HGNC:21305 details
hsa-miR-181a-5p TSHR thyroid stimulating hormone receptor HGNC:12373 details
hsa-miR-181a-5p ZNF558 zinc finger protein 558 HGNC:26422 details
hsa-miR-181a-5p C8A complement C8 alpha chain HGNC:1352 details
hsa-miR-181a-5p ARL6IP6 ADP ribosylation factor like GTPase 6 interacting protein 6 HGNC:24048 details
hsa-miR-181a-5p ZNF426 zinc finger protein 426 HGNC:20725 details
hsa-miR-181a-5p ESR1 estrogen receptor 1 HGNC:3467 details
hsa-miR-181a-5p ATF7IP2 activating transcription factor 7 interacting protein 2 HGNC:20397 details
hsa-miR-181a-5p PRR4 proline rich 4 HGNC:18020 details
hsa-miR-181a-5p TCF21 transcription factor 21 HGNC:11632 details
hsa-miR-181a-5p PHOX2A paired like homeobox 2A HGNC:691 details
hsa-miR-181a-5p details
hsa-miR-181a-5p details
hsa-miR-181a-5p GSTM2 glutathione S-transferase mu 2 HGNC:4634 details
hsa-miR-181a-5p FSIP1 fibrous sheath interacting protein 1 HGNC:21674 details
hsa-miR-181a-5p KBTBD3 kelch repeat and BTB domain containing 3 HGNC:22934 details
hsa-miR-181a-5p PTPRZ1 protein tyrosine phosphatase receptor type Z1 HGNC:9685 details
hsa-miR-181a-5p WNT3A Wnt family member 3A HGNC:15983 details
hsa-miR-181a-5p TUSC1 tumor suppressor candidate 1 HGNC:31010 details
hsa-miR-181a-5p LRRN3 leucine rich repeat neuronal 3 HGNC:17200 details
hsa-miR-181a-5p TMEM45A transmembrane protein 45A HGNC:25480 details
hsa-miR-181a-5p ARF6 ADP ribosylation factor 6 HGNC:659 details
hsa-miR-181a-5p C1orf109 chromosome 1 open reading frame 109 HGNC:26039 details
hsa-miR-181a-5p TAF15 TATA-box binding protein associated factor 15 HGNC:11547 details
hsa-miR-181a-5p PLXDC2 plexin domain containing 2 HGNC:21013 details
hsa-miR-181a-5p NMRK2 nicotinamide riboside kinase 2 HGNC:17871 details
hsa-miR-181a-5p WNT2 Wnt family member 2 HGNC:12780 details
hsa-miR-181a-5p ATG10 autophagy related 10 HGNC:20315 details
hsa-miR-181a-5p PRDX3 peroxiredoxin 3 HGNC:9354 details
hsa-miR-181a-5p HOXA11 homeobox A11 HGNC:5101 details
hsa-miR-181a-5p ZNF652 zinc finger protein 652 HGNC:29147 details
hsa-miR-181a-5p RTEL1-TNFRSF6B RTEL1-TNFRSF6B readthrough (NMD candidate) HGNC:44095 details
hsa-miR-181a-5p GCNT1 glucosaminyl (N-acetyl) transferase 1 HGNC:4203 details
hsa-miR-181a-5p PCDHB8 protocadherin beta 8 HGNC:8693 details
hsa-miR-181a-5p ENAH ENAH actin regulator HGNC:18271 details
hsa-miR-181a-5p ZNF25 zinc finger protein 25 HGNC:13043 details
hsa-miR-181a-5p TAF6L TATA-box binding protein associated factor 6 like HGNC:17305 details
hsa-miR-181a-5p S100A1 S100 calcium binding protein A1 HGNC:10486 details
hsa-miR-181a-5p PLA2G4C phospholipase A2 group IVC HGNC:9037 details
hsa-miR-181a-5p NOL4 nucleolar protein 4 HGNC:7870 details
hsa-miR-181a-5p SIX6 SIX homeobox 6 HGNC:10892 details
hsa-miR-181a-5p FKBP10 FKBP prolyl isomerase 10 HGNC:18169 details
hsa-miR-181a-5p SMCHD1 structural maintenance of chromosomes flexible hinge domain containing 1 HGNC:29090 details
hsa-miR-181a-5p OR11A1 olfactory receptor family 11 subfamily A member 1 HGNC:8176 details
hsa-miR-181a-5p INCENP inner centromere protein HGNC:6058 details
hsa-miR-181a-5p LPGAT1 lysophosphatidylglycerol acyltransferase 1 HGNC:28985 details
hsa-miR-181a-5p CLUAP1 clusterin associated protein 1 HGNC:19009 details
hsa-miR-181a-5p LYSMD3 LysM domain containing 3 HGNC:26969 details
hsa-miR-181a-5p CCDC6 coiled-coil domain containing 6 HGNC:18782 details
hsa-miR-181a-5p BAG2 BAG cochaperone 2 HGNC:938 details
hsa-miR-181a-5p GPR83 G protein-coupled receptor 83 HGNC:4523 details
hsa-miR-181a-5p PTGS2 prostaglandin-endoperoxide synthase 2 HGNC:9605 details
hsa-miR-181a-5p ANKRD13C ankyrin repeat domain 13C HGNC:25374 details
hsa-miR-181a-5p RLF RLF zinc finger HGNC:10025 details
hsa-miR-181a-5p FBXO28 F-box protein 28 HGNC:29046 details
hsa-miR-181a-5p ZNF350 zinc finger protein 350 HGNC:16656 details
hsa-miR-181a-5p TIAL1 TIA1 cytotoxic granule associated RNA binding protein like 1 HGNC:11804 details
hsa-miR-181a-5p RNF34 ring finger protein 34 HGNC:17297 details
hsa-miR-181a-5p LCLAT1 lysocardiolipin acyltransferase 1 HGNC:26756 details
hsa-miR-181a-5p details
hsa-miR-181a-5p ZNF35 zinc finger protein 35 HGNC:13099 details
hsa-miR-181a-5p PITPNB phosphatidylinositol transfer protein beta HGNC:9002 details
hsa-miR-181a-5p SCD stearoyl-CoA desaturase HGNC:10571 details
hsa-miR-181a-5p details
hsa-miR-181a-5p GATAD2B GATA zinc finger domain containing 2B HGNC:30778 details
hsa-miR-181a-5p LGALSL galectin like HGNC:25012 details
hsa-miR-181a-5p TGIF2 TGFB induced factor homeobox 2 HGNC:15764 details
hsa-miR-181a-5p MOB1A MOB kinase activator 1A HGNC:16015 details
hsa-miR-181a-5p SLC35B4 solute carrier family 35 member B4 HGNC:20584 details
hsa-miR-181a-5p details
hsa-miR-181a-5p details
hsa-miR-181a-5p GPRIN3 GPRIN family member 3 HGNC:27733 details
hsa-miR-181a-5p details
hsa-miR-181a-5p ARHGAP12 Rho GTPase activating protein 12 HGNC:16348 details
hsa-miR-181a-5p SPRY2 sprouty RTK signaling antagonist 2 HGNC:11270 details
hsa-miR-181a-5p TGFBR3 transforming growth factor beta receptor 3 HGNC:11774 details
hsa-miR-181a-5p TMED4 transmembrane p24 trafficking protein 4 HGNC:22301 details
hsa-miR-181a-5p MAP2K1 mitogen-activated protein kinase kinase 1 HGNC:6840 details
hsa-miR-181a-5p PUM1 pumilio RNA binding family member 1 HGNC:14957 details
hsa-miR-181a-5p TRIM2 tripartite motif containing 2 HGNC:15974 details
hsa-miR-181a-5p FBXO33 F-box protein 33 HGNC:19833 details
hsa-miR-181a-5p NRP1 neuropilin 1 HGNC:8004 details
hsa-miR-181a-5p FAM47B family with sequence similarity 47 member B HGNC:26659 details
hsa-miR-181a-5p CCNG1 cyclin G1 HGNC:1592 details
hsa-miR-181a-5p BRMS1L BRMS1 like transcriptional repressor HGNC:20512 details
hsa-miR-181a-5p OTUD1 OTU deubiquitinase 1 HGNC:27346 details
hsa-miR-181a-5p ATP6V0E1 ATPase H+ transporting V0 subunit e1 HGNC:863 details
hsa-miR-181a-5p WNT16 Wnt family member 16 HGNC:16267 details
hsa-miR-181a-5p CST5 cystatin D HGNC:2477 details
hsa-miR-181a-5p SH3BGRL SH3 domain binding glutamate rich protein like HGNC:10823 details
hsa-miR-181a-5p GPR137B G protein-coupled receptor 137B HGNC:11862 details
hsa-miR-181a-5p OFCC1 orofacial cleft 1 candidate 1 HGNC:21017 details
hsa-miR-181a-5p IQCG IQ motif containing G HGNC:25251 details
hsa-miR-181a-5p NKX3-2 NK3 homeobox 2 HGNC:951 details
hsa-miR-181a-5p OTX2 orthodenticle homeobox 2 HGNC:8522 details
hsa-miR-181a-5p ROPN1L rhophilin associated tail protein 1 like HGNC:24060 details
hsa-miR-181a-5p TMEM14A transmembrane protein 14A HGNC:21076 details
hsa-miR-181a-5p TAF2 TATA-box binding protein associated factor 2 HGNC:11536 details
hsa-miR-181a-5p IDS iduronate 2-sulfatase HGNC:5389 details
hsa-miR-181a-5p FRA10AC1 FRA10A associated CGG repeat 1 HGNC:1162 details
hsa-miR-181a-5p COL27A1 collagen type XXVII alpha 1 chain HGNC:22986 details
hsa-miR-181a-5p EPHA5 EPH receptor A5 HGNC:3389 details
hsa-miR-181a-5p DCST1 DC-STAMP domain containing 1 HGNC:26539 details
hsa-miR-181a-5p ZNF562 zinc finger protein 562 HGNC:25950 details
hsa-miR-181a-5p EYA4 EYA transcriptional coactivator and phosphatase 4 HGNC:3522 details
hsa-miR-181a-5p CHL1 cell adhesion molecule L1 like HGNC:1939 details
hsa-miR-181a-5p TAAR6 trace amine associated receptor 6 HGNC:20978 details
hsa-miR-181a-5p SLCO2A1 solute carrier organic anion transporter family member 2A1 HGNC:10955 details
hsa-miR-181a-5p details
hsa-miR-181a-5p HMGB2 high mobility group box 2 HGNC:5000 details
hsa-miR-181a-5p HERC3 HECT and RLD domain containing E3 ubiquitin protein ligase 3 HGNC:4876 details
hsa-miR-181a-5p BTBD3 BTB domain containing 3 HGNC:15854 details
hsa-miR-181a-5p SRPK2 SRSF protein kinase 2 HGNC:11306 details
hsa-miR-181a-5p DNAJC7 DnaJ heat shock protein family (Hsp40) member C7 HGNC:12392 details
hsa-miR-181a-5p ANKRD1 ankyrin repeat domain 1 HGNC:15819 details
hsa-miR-181a-5p CFI complement factor I HGNC:5394 details
hsa-miR-181a-5p MRPS14 mitochondrial ribosomal protein S14 HGNC:14049 details
hsa-miR-181a-5p HEY2 hes related family bHLH transcription factor with YRPW motif 2 HGNC:4881 details
hsa-miR-181a-5p BDNF brain derived neurotrophic factor HGNC:1033 details
hsa-miR-181a-5p MTMR12 myotubularin related protein 12 HGNC:18191 details
hsa-miR-181a-5p ACOT12 acyl-CoA thioesterase 12 HGNC:24436 details
hsa-miR-181a-5p details
hsa-miR-181a-5p USP28 ubiquitin specific peptidase 28 HGNC:12625 details
hsa-miR-181a-5p AMMECR1 AMMECR nuclear protein 1 HGNC:467 details
hsa-miR-181a-5p BPGM bisphosphoglycerate mutase HGNC:1093 details
hsa-miR-181a-5p DSCR8 Down syndrome critical region 8 HGNC:16707 details
hsa-miR-181a-5p UGT3A1 UDP glycosyltransferase family 3 member A1 HGNC:26625 details
hsa-miR-181a-5p HSD17B3 hydroxysteroid 17-beta dehydrogenase 3 HGNC:5212 details
hsa-miR-181a-5p GADD45G growth arrest and DNA damage inducible gamma HGNC:4097 details
hsa-miR-181a-5p FBXO34 F-box protein 34 HGNC:20201 details
hsa-miR-181a-5p C1QTNF9 C1q and TNF related 9 HGNC:28732 details
hsa-miR-181a-5p KLRC4 killer cell lectin like receptor C4 HGNC:6377 details
hsa-miR-181a-5p MOB3B MOB kinase activator 3B HGNC:23825 details
hsa-miR-181a-5p FKBP7 FKBP prolyl isomerase 7 HGNC:3723 details
hsa-miR-181a-5p TBX4 T-box transcription factor 4 HGNC:11603 details
hsa-miR-181a-5p TMPRSS11A transmembrane serine protease 11A HGNC:27954 details
hsa-miR-181a-5p SNAI2 snail family transcriptional repressor 2 HGNC:11094 details
hsa-miR-181a-5p SLC7A11 solute carrier family 7 member 11 HGNC:11059 details
hsa-miR-181a-5p NUDT12 nudix hydrolase 12 HGNC:18826 details
hsa-miR-181a-5p COPS2 COP9 signalosome subunit 2 HGNC:30747 details
hsa-miR-181a-5p ZNF12 zinc finger protein 12 HGNC:12902 details
hsa-miR-181a-5p PRLR prolactin receptor HGNC:9446 details
hsa-miR-181a-5p PLCL2 phospholipase C like 2 HGNC:9064 details
hsa-miR-181a-5p ZNF594 zinc finger protein 594 HGNC:29392 details
hsa-miR-181a-5p METAP1 methionyl aminopeptidase 1 HGNC:15789 details
hsa-miR-181a-5p HSPA13 heat shock protein family A (Hsp70) member 13 HGNC:11375 details
hsa-miR-181a-5p NR6A1 nuclear receptor subfamily 6 group A member 1 HGNC:7985 details
hsa-miR-181a-5p YOD1 YOD1 deubiquitinase HGNC:25035 details
hsa-miR-181a-5p SLC37A3 solute carrier family 37 member 3 HGNC:20651 details
hsa-miR-181a-5p FBXO11 F-box protein 11 HGNC:13590 details
hsa-miR-181a-5p ZNF445 zinc finger protein 445 HGNC:21018 details
hsa-miR-181a-5p TM9SF3 transmembrane 9 superfamily member 3 HGNC:21529 details
hsa-miR-181a-5p ATP8A1 ATPase phospholipid transporting 8A1 HGNC:13531 details
hsa-miR-181a-5p TMEM64 transmembrane protein 64 HGNC:25441 details
hsa-miR-181a-5p MOB1B MOB kinase activator 1B HGNC:29801 details
hsa-miR-181a-5p GNAI3 G protein subunit alpha i3 HGNC:4387 details
hsa-miR-181a-5p TAB2 TGF-beta activated kinase 1 (MAP3K7) binding protein 2 HGNC:17075 details
hsa-miR-181a-5p SRSF7 serine and arginine rich splicing factor 7 HGNC:10789 details
hsa-miR-181a-5p DDX3X DEAD-box helicase 3 X-linked HGNC:2745 details
hsa-miR-181a-5p KRAS KRAS proto-oncogene, GTPase HGNC:6407 details
hsa-miR-181a-5p LBR lamin B receptor HGNC:6518 details
hsa-miR-181a-5p GIGYF1 GRB10 interacting GYF protein 1 HGNC:9126 details
hsa-miR-181a-5p KLHL42 kelch like family member 42 HGNC:29252 details
hsa-miR-181a-5p TMEM132B transmembrane protein 132B HGNC:29397 details
hsa-miR-181a-5p AFTPH aftiphilin HGNC:25951 details
hsa-miR-181a-5p ZNF148 zinc finger protein 148 HGNC:12933 details
hsa-miR-181a-5p NOTCH2 notch receptor 2 HGNC:7882 details
hsa-miR-181a-5p NFYB nuclear transcription factor Y subunit beta HGNC:7805 details
hsa-miR-181a-5p NOTCH1 notch receptor 1 HGNC:7881 details
hsa-miR-181a-5p SIK2 salt inducible kinase 2 HGNC:21680 details
hsa-miR-181a-5p HOOK3 hook microtubule tethering protein 3 HGNC:23576 details
hsa-miR-181a-5p FAM222B family with sequence similarity 222 member B HGNC:25563 details
hsa-miR-181a-5p RPS8 ribosomal protein S8 HGNC:10441 details
hsa-miR-181a-5p STAG2 stromal antigen 2 HGNC:11355 details
hsa-miR-181a-5p SMG1 SMG1 nonsense mediated mRNA decay associated PI3K related kinase HGNC:30045 details
hsa-miR-181a-5p PFKFB2 6-phosphofructo-2-kinase/fructose-2,6-biphosphatase 2 HGNC:8873 details
hsa-miR-181a-5p ZEB2 zinc finger E-box binding homeobox 2 HGNC:14881 details
hsa-miR-181a-5p MAZ MYC associated zinc finger protein HGNC:6914 details
hsa-miR-181a-5p RPL14 ribosomal protein L14 HGNC:10305 details
hsa-miR-181a-5p KCTD2 potassium channel tetramerization domain containing 2 HGNC:21294 details
hsa-miR-181a-5p UBA2 ubiquitin like modifier activating enzyme 2 HGNC:30661 details
hsa-miR-181a-5p DDX27 DEAD-box helicase 27 HGNC:15837 details
hsa-miR-181a-5p FAT1 FAT atypical cadherin 1 HGNC:3595 details
hsa-miR-181a-5p HDAC6 histone deacetylase 6 HGNC:14064 details
hsa-miR-181a-5p TMEM192 transmembrane protein 192 HGNC:26775 details
hsa-miR-181a-5p LAMA3 laminin subunit alpha 3 HGNC:6483 details
hsa-miR-181a-5p HUWE1 HECT, UBA and WWE domain containing E3 ubiquitin protein ligase 1 HGNC:30892 details
hsa-miR-181a-5p details
hsa-miR-181a-5p HNRNPAB heterogeneous nuclear ribonucleoprotein A/B HGNC:5034 details
hsa-miR-181a-5p OCA2 OCA2 melanosomal transmembrane protein HGNC:8101 details
hsa-miR-181a-5p AP1M1 adaptor related protein complex 1 subunit mu 1 HGNC:13667 details
hsa-miR-181a-5p UCHL1 ubiquitin C-terminal hydrolase L1 HGNC:12513 details
hsa-miR-181a-5p PGD phosphogluconate dehydrogenase HGNC:8891 details
hsa-miR-181a-5p ZFP36L2 ZFP36 ring finger protein like 2 HGNC:1108 details
hsa-miR-181a-5p AKAP12 A-kinase anchoring protein 12 HGNC:370 details
hsa-miR-181a-5p PABPC1 poly(A) binding protein cytoplasmic 1 HGNC:8554 details
hsa-miR-181a-5p GANAB glucosidase II alpha subunit HGNC:4138 details
hsa-miR-181a-5p PHPT1 phosphohistidine phosphatase 1 HGNC:30033 details
hsa-miR-181a-5p details
hsa-miR-181a-5p TEAD4 TEA domain transcription factor 4 HGNC:11717 details
hsa-miR-181a-5p KLHL15 kelch like family member 15 HGNC:29347 details
hsa-miR-181a-5p PRRC2B proline rich coiled-coil 2B HGNC:28121 details
hsa-miR-181a-5p BRCA1 BRCA1 DNA repair associated HGNC:1100 details
hsa-miR-181a-5p details
hsa-miR-181a-5p KIAA0100 KIAA0100 HGNC:28960 details
hsa-miR-181a-5p PPP1R9A protein phosphatase 1 regulatory subunit 9A HGNC:14946 details
hsa-miR-181a-5p MGAT5 alpha-1,6-mannosylglycoprotein 6-beta-N-acetylglucosaminyltransferase HGNC:7049 details
hsa-miR-181a-5p TNIP1 TNFAIP3 interacting protein 1 HGNC:16903 details
hsa-miR-181a-5p PBX3 PBX homeobox 3 HGNC:8634 details
hsa-miR-181a-5p TIMP1 TIMP metallopeptidase inhibitor 1 HGNC:11820 details
hsa-miR-181a-5p PGR progesterone receptor HGNC:8910 details
hsa-miR-181a-5p COL16A1 collagen type XVI alpha 1 chain HGNC:2193 details
hsa-miR-181a-5p PPP3CA protein phosphatase 3 catalytic subunit alpha HGNC:9314 details
hsa-miR-181a-5p ATG5 autophagy related 5 HGNC:589 details
hsa-miR-181a-5p CD4 CD4 molecule HGNC:1678 details
hsa-miR-181a-5p TGFBRAP1 transforming growth factor beta receptor associated protein 1 HGNC:16836 details
hsa-miR-181a-5p TGFBR1 transforming growth factor beta receptor 1 HGNC:11772 details
hsa-miR-181a-5p TNFRSF11B TNF receptor superfamily member 11b HGNC:11909 details
hsa-miR-181a-5p PCDHAC1 protocadherin alpha subfamily C, 1 HGNC:8676 details
hsa-miR-181a-5p PCDHAC2 protocadherin alpha subfamily C, 2 HGNC:8677 details
hsa-miR-181a-5p PCDHA1 protocadherin alpha 1 HGNC:8663 details
hsa-miR-181a-5p PCDHA10 protocadherin alpha 10 HGNC:8664 details
hsa-miR-181a-5p PCDHA11 protocadherin alpha 11 HGNC:8665 details
hsa-miR-181a-5p PCDHA12 protocadherin alpha 12 HGNC:8666 details
hsa-miR-181a-5p PCDHA13 protocadherin alpha 13 HGNC:8667 details
hsa-miR-181a-5p PCDHA2 protocadherin alpha 2 HGNC:8668 details
hsa-miR-181a-5p PCDHA3 protocadherin alpha 3 HGNC:8669 details
hsa-miR-181a-5p PCDHA4 protocadherin alpha 4 HGNC:8670 details
hsa-miR-181a-5p PCDHA5 protocadherin alpha 5 HGNC:8671 details
hsa-miR-181a-5p PCDHA6 protocadherin alpha 6 HGNC:8672 details
hsa-miR-181a-5p PCDHA7 protocadherin alpha 7 HGNC:8673 details
hsa-miR-181a-5p PCDHA8 protocadherin alpha 8 HGNC:8674 details
hsa-miR-181a-5p PDGFRA platelet derived growth factor receptor alpha HGNC:8803 details
hsa-miR-181a-5p BMP3 bone morphogenetic protein 3 HGNC:1070 details
hsa-miR-181a-5p SOX5 SRY-box transcription factor 5 HGNC:11201 details
hsa-miR-181a-5p MAP3K3 mitogen-activated protein kinase kinase kinase 3 HGNC:6855 details
hsa-miR-181a-5p TAB3 TGF-beta activated kinase 1 (MAP3K7) binding protein 3 HGNC:30681 details
hsa-miR-181a-5p PDAP1 PDGFA associated protein 1 HGNC:14634 details
hsa-miR-181a-5p MAPK1IP1L mitogen-activated protein kinase 1 interacting protein 1 like HGNC:19840 details
hsa-miR-181a-5p BMPR2 bone morphogenetic protein receptor type 2 HGNC:1078 details
hsa-miR-181a-5p SMAD2 SMAD family member 2 HGNC:6768 details
hsa-miR-181a-5p MADD MAP kinase activating death domain HGNC:6766 details
hsa-miR-181a-5p CDH13 cadherin 13 HGNC:1753 details
hsa-miR-181a-5p ACAN aggrecan HGNC:319 details
hsa-miR-181a-5p MAP3K10 mitogen-activated protein kinase kinase kinase 10 HGNC:6849 details
hsa-miR-181a-5p PCDHB6 protocadherin beta 6 HGNC:8691 details
hsa-miR-181a-5p MAP4K4 mitogen-activated protein kinase kinase kinase kinase 4 HGNC:6866 details
hsa-miR-181a-5p MMP14 matrix metallopeptidase 14 HGNC:7160 details
hsa-miR-181a-5p E2F5 E2F transcription factor 5 HGNC:3119 details
hsa-miR-181a-5p RAP1B RAP1B, member of RAS oncogene family HGNC:9857 details
hsa-miR-181a-5p ZNF664 zinc finger protein 664 HGNC:25406 details
hsa-miR-181a-5p ZNF136 zinc finger protein 136 HGNC:12920 details
hsa-miR-181a-5p ZNF121 zinc finger protein 121 HGNC:12904 details
hsa-miR-181a-5p ZFP36L1 ZFP36 ring finger protein like 1 HGNC:1107 details
hsa-miR-181a-5p ZBTB4 zinc finger and BTB domain containing 4 HGNC:23847 details
hsa-miR-181a-5p ZBTB33 zinc finger and BTB domain containing 33 HGNC:16682 details
hsa-miR-181a-5p ULK1 unc-51 like autophagy activating kinase 1 HGNC:12558 details
hsa-miR-181a-5p TUBB tubulin beta class I HGNC:20778 details
hsa-miR-181a-5p TTPAL alpha tocopherol transfer protein like HGNC:16114 details
hsa-miR-181a-5p TSG101 tumor susceptibility 101 HGNC:15971 details
hsa-miR-181a-5p TNRC6B trinucleotide repeat containing adaptor 6B HGNC:29190 details
hsa-miR-181a-5p TMF1 TATA element modulatory factor 1 HGNC:11870 details
hsa-miR-181a-5p TMEM30A transmembrane protein 30A HGNC:16667 details
hsa-miR-181a-5p TFRC transferrin receptor HGNC:11763 details
hsa-miR-181a-5p TBL1XR1 TBL1X receptor 1 HGNC:29529 details
hsa-miR-181a-5p TBC1D7 TBC1 domain family member 7 HGNC:21066 details
hsa-miR-181a-5p TBC1D13 TBC1 domain family member 13 HGNC:25571 details
hsa-miR-181a-5p STX2 syntaxin 2 HGNC:3403 details
hsa-miR-181a-5p STAG1 stromal antigen 1 HGNC:11354 details
hsa-miR-181a-5p SSX2IP SSX family member 2 interacting protein HGNC:16509 details
hsa-miR-181a-5p SRGN serglycin HGNC:9361 details
hsa-miR-181a-5p SORT1 sortilin 1 HGNC:11186 details
hsa-miR-181a-5p SMCR8 SMCR8-C9orf72 complex subunit HGNC:17921 details
hsa-miR-181a-5p SLC7A1 solute carrier family 7 member 1 HGNC:11057 details
hsa-miR-181a-5p SLC38A2 solute carrier family 38 member 2 HGNC:13448 details
hsa-miR-181a-5p SLC25A37 solute carrier family 25 member 37 HGNC:29786 details
hsa-miR-181a-5p SLC19A2 solute carrier family 19 member 2 HGNC:10938 details
hsa-miR-181a-5p SLC10A7 solute carrier family 10 member 7 HGNC:23088 details
hsa-miR-181a-5p SIPA1L1 signal induced proliferation associated 1 like 1 HGNC:20284 details
hsa-miR-181a-5p SHOC2 SHOC2 leucine rich repeat scaffold protein HGNC:15454 details
hsa-miR-181a-5p RP2 RP2 activator of ARL3 GTPase HGNC:10274 details
hsa-miR-181a-5p RHOG ras homolog family member G HGNC:672 details
hsa-miR-181a-5p RGS16 regulator of G protein signaling 16 HGNC:9997 details
hsa-miR-181a-5p RCOR1 REST corepressor 1 HGNC:17441 details
hsa-miR-181a-5p RAN RAN, member RAS oncogene family HGNC:9846 details
hsa-miR-181a-5p RAB2B RAB2B, member RAS oncogene family HGNC:20246 details
hsa-miR-181a-5p PURB purine rich element binding protein B HGNC:9702 details
hsa-miR-181a-5p PRKCD protein kinase C delta HGNC:9399 details
hsa-miR-181a-5p PNRC2 proline rich nuclear receptor coactivator 2 HGNC:23158 details
hsa-miR-181a-5p PMAIP1 phorbol-12-myristate-13-acetate-induced protein 1 HGNC:9108 details
hsa-miR-181a-5p PHC3 polyhomeotic homolog 3 HGNC:15682 details
hsa-miR-181a-5p PGAP1 post-GPI attachment to proteins inositol deacylase 1 HGNC:25712 details
hsa-miR-181a-5p PER2 period circadian regulator 2 HGNC:8846 details
hsa-miR-181a-5p PEBP1 phosphatidylethanolamine binding protein 1 HGNC:8630 details
hsa-miR-181a-5p PBRM1 polybromo 1 HGNC:30064 details
hsa-miR-181a-5p details
hsa-miR-181a-5p OSBPL3 oxysterol binding protein like 3 HGNC:16370 details
hsa-miR-181a-5p NMT2 N-myristoyltransferase 2 HGNC:7858 details
hsa-miR-181a-5p details
hsa-miR-181a-5p NIN ninein HGNC:14906 details
hsa-miR-181a-5p NHLRC3 NHL repeat containing 3 HGNC:33751 details
hsa-miR-181a-5p NCOA3 nuclear receptor coactivator 3 HGNC:7670 details
hsa-miR-181a-5p NCAPG non-SMC condensin I complex subunit G HGNC:24304 details
hsa-miR-181a-5p NAA50 N-alpha-acetyltransferase 50, NatE catalytic subunit HGNC:29533 details
hsa-miR-181a-5p MTX3 metaxin 3 HGNC:24812 details
hsa-miR-181a-5p MTUS1 microtubule associated scaffold protein 1 HGNC:29789 details
hsa-miR-181a-5p details
hsa-miR-181a-5p KMT2E lysine methyltransferase 2E (inactive) HGNC:18541 details
hsa-miR-181a-5p LRRC8D leucine rich repeat containing 8 VRAC subunit D HGNC:16992 details
hsa-miR-181a-5p LPCAT1 lysophosphatidylcholine acyltransferase 1 HGNC:25718 details
hsa-miR-181a-5p LONRF1 LON peptidase N-terminal domain and ring finger 1 HGNC:26302 details
hsa-miR-181a-5p LMAN1 lectin, mannose binding 1 HGNC:6631 details
hsa-miR-181a-5p KPNA1 karyopherin subunit alpha 1 HGNC:6394 details
hsa-miR-181a-5p KIF3B kinesin family member 3B HGNC:6320 details
hsa-miR-181a-5p KIF2C kinesin family member 2C HGNC:6393 details
hsa-miR-181a-5p EFCAB14 EF-hand calcium binding domain 14 HGNC:29051 details
hsa-miR-181a-5p WASHC5 WASH complex subunit 5 HGNC:28984 details
hsa-miR-181a-5p KDM5A lysine demethylase 5A HGNC:9886 details
hsa-miR-181a-5p IPO5 importin 5 HGNC:6402 details
hsa-miR-181a-5p INO80D INO80 complex subunit D HGNC:25997 details
hsa-miR-181a-5p IL1A interleukin 1 alpha HGNC:5991 details
hsa-miR-181a-5p details
hsa-miR-181a-5p HIGD2A HIG1 hypoxia inducible domain family member 2A HGNC:28311 details
hsa-miR-181a-5p HECW2 HECT, C2 and WW domain containing E3 ubiquitin protein ligase 2 HGNC:29853 details
hsa-miR-181a-5p GOT1 glutamic-oxaloacetic transaminase 1 HGNC:4432 details
hsa-miR-181a-5p GOLGA8B golgin A8 family member B HGNC:31973 details
hsa-miR-181a-5p GOLGA1 golgin A1 HGNC:4424 details
hsa-miR-181a-5p GNS glucosamine (N-acetyl)-6-sulfatase HGNC:4422 details
hsa-miR-181a-5p GK5 glycerol kinase 5 HGNC:28635 details
hsa-miR-181a-5p G3BP2 G3BP stress granule assembly factor 2 HGNC:30291 details
hsa-miR-181a-5p FSD1L fibronectin type III and SPRY domain containing 1 like HGNC:13753 details
hsa-miR-181a-5p FNDC3B fibronectin type III domain containing 3B HGNC:24670 details
hsa-miR-181a-5p CCNQ cyclin Q HGNC:28434 details
hsa-miR-181a-5p EPS15 epidermal growth factor receptor pathway substrate 15 HGNC:3419 details
hsa-miR-181a-5p EED embryonic ectoderm development HGNC:3188 details
hsa-miR-181a-5p DYNC1LI2 dynein cytoplasmic 1 light intermediate chain 2 HGNC:2966 details
hsa-miR-181a-5p DRAM1 DNA damage regulated autophagy modulator 1 HGNC:25645 details
hsa-miR-181a-5p DDX52 DExD-box helicase 52 HGNC:20038 details
hsa-miR-181a-5p DAZAP2 DAZ associated protein 2 HGNC:2684 details
hsa-miR-181a-5p CUL5 cullin 5 HGNC:2556 details
hsa-miR-181a-5p CPOX coproporphyrinogen oxidase HGNC:2321 details
hsa-miR-181a-5p CPEB4 cytoplasmic polyadenylation element binding protein 4 HGNC:21747 details
hsa-miR-181a-5p CLCC1 chloride channel CLIC like 1 HGNC:29675 details
hsa-miR-181a-5p CHD9 chromodomain helicase DNA binding protein 9 HGNC:25701 details
hsa-miR-181a-5p CHCHD7 coiled-coil-helix-coiled-coil-helix domain containing 7 HGNC:28314 details
hsa-miR-181a-5p CCNK cyclin K HGNC:1596 details
hsa-miR-181a-5p CCL22 C-C motif chemokine ligand 22 HGNC:10621 details
hsa-miR-181a-5p CCDC88C coiled-coil domain containing 88C HGNC:19967 details
hsa-miR-181a-5p CARM1 coactivator associated arginine methyltransferase 1 HGNC:23393 details
hsa-miR-181a-5p C2orf69 chromosome 2 open reading frame 69 HGNC:26799 details
hsa-miR-181a-5p details
hsa-miR-181a-5p GSKIP GSK3B interacting protein HGNC:20343 details
hsa-miR-181a-5p details
hsa-miR-181a-5p EMSY EMSY transcriptional repressor, BRCA2 interacting HGNC:18071 details
hsa-miR-181a-5p BLOC1S2 biogenesis of lysosomal organelles complex 1 subunit 2 HGNC:20984 details
hsa-miR-181a-5p BAZ2A bromodomain adjacent to zinc finger domain 2A HGNC:962 details
hsa-miR-181a-5p PRRC2C proline rich coiled-coil 2C HGNC:24903 details
hsa-miR-181a-5p ATP2B1 ATPase plasma membrane Ca2+ transporting 1 HGNC:814 details
hsa-miR-181a-5p ATG2B autophagy related 2B HGNC:20187 details
hsa-miR-181a-5p ASB1 ankyrin repeat and SOCS box containing 1 HGNC:16011 details
hsa-miR-181a-5p ARRDC3 arrestin domain containing 3 HGNC:29263 details
hsa-miR-181a-5p ARRB2 arrestin beta 2 HGNC:712 details
hsa-miR-181a-5p APOL6 apolipoprotein L6 HGNC:14870 details
hsa-miR-181a-5p ALDH9A1 aldehyde dehydrogenase 9 family member A1 HGNC:412 details
hsa-miR-181a-5p AFF4 AF4/FMR2 family member 4 HGNC:17869 details
hsa-miR-181a-5p GRK2 G protein-coupled receptor kinase 2 HGNC:289 details
hsa-miR-181a-5p ACYP1 acylphosphatase 1 HGNC:179 details
hsa-miR-181a-5p DCAF4 DDB1 and CUL4 associated factor 4 HGNC:20229 details
hsa-miR-181a-5p RSF1 remodeling and spacing factor 1 HGNC:18118 details
hsa-miR-181a-5p details
hsa-miR-181a-5p NSD2 nuclear receptor binding SET domain protein 2 HGNC:12766 details
hsa-miR-181a-5p SLC25A25 solute carrier family 25 member 25 HGNC:20663 details
hsa-miR-181a-5p PPP2R5E protein phosphatase 2 regulatory subunit B'epsilon HGNC:9313 details
hsa-miR-181a-5p MIGA2 mitoguardin 2 HGNC:23621 details
hsa-miR-181a-5p CBX4 chromobox 4 HGNC:1554 details
hsa-miR-181a-5p CAPRIN2 caprin family member 2 HGNC:21259 details
hsa-miR-181a-5p TNPO1 transportin 1 HGNC:6401 details
hsa-miR-181a-5p FKBP1C FKBP prolyl isomerase family member 1C HGNC:21376 details
hsa-miR-181a-5p ZNF83 zinc finger protein 83 HGNC:13158 details
hsa-miR-181a-5p HSPA1B heat shock protein family A (Hsp70) member 1B HGNC:5233 details
hsa-miR-181a-5p ZNF669 zinc finger protein 669 HGNC:25736 details
hsa-miR-181a-5p details
hsa-miR-181a-5p ZNF781 zinc finger protein 781 HGNC:26745 details
hsa-miR-181a-5p ZNF667 zinc finger protein 667 HGNC:28854 details
hsa-miR-181a-5p ZNF487 zinc finger protein 487 HGNC:23488 details
hsa-miR-181a-5p TMEM94 transmembrane protein 94 HGNC:28983 details
hsa-miR-181a-5p details
hsa-miR-181a-5p ZNF440 zinc finger protein 440 HGNC:20874 details
hsa-miR-181a-5p EPS8 epidermal growth factor receptor pathway substrate 8 HGNC:3420 details
hsa-miR-181a-5p details
hsa-miR-181a-5p MAN1A2 mannosidase alpha class 1A member 2 HGNC:6822 details
hsa-miR-181a-5p FKBP14 FKBP prolyl isomerase 14 HGNC:18625 details
hsa-miR-181a-5p ZNF791 zinc finger protein 791 HGNC:26895 details
hsa-miR-181a-5p ZFP69B ZFP69 zinc finger protein B HGNC:28053 details
hsa-miR-181a-5p ZFAND6 zinc finger AN1-type containing 6 HGNC:30164 details
hsa-miR-181a-5p NPM3 nucleophosmin/nucleoplasmin 3 HGNC:7931 details
hsa-miR-181a-5p HSP90B1 heat shock protein 90 beta family member 1 HGNC:12028 details
hsa-miR-181a-5p GJB7 gap junction protein beta 7 HGNC:16690 details
hsa-miR-181a-5p ZDHHC15 zinc finger DHHC-type palmitoyltransferase 15 HGNC:20342 details
hsa-miR-181a-5p XPNPEP3 X-prolyl aminopeptidase 3 HGNC:28052 details
hsa-miR-181a-5p ZNF699 zinc finger protein 699 HGNC:24750 details
hsa-miR-181a-5p PHOX2B paired like homeobox 2B HGNC:9143 details
hsa-miR-181a-5p HEPHL1 hephaestin like 1 HGNC:30477 details
hsa-miR-181a-5p ATP8B1 ATPase phospholipid transporting 8B1 HGNC:3706 details
hsa-miR-181a-5p PLPP3 phospholipid phosphatase 3 HGNC:9229 details
hsa-miR-181a-5p ZNF844 zinc finger protein 844 HGNC:25932 details
hsa-miR-181a-5p ZNF780B zinc finger protein 780B HGNC:33109 details
hsa-miR-181a-5p NCOA7 nuclear receptor coactivator 7 HGNC:21081 details
hsa-miR-181a-5p ZNF266 zinc finger protein 266 HGNC:13059 details
hsa-miR-181a-5p KRBOX4 KRAB box domain containing 4 HGNC:26007 details
hsa-miR-181a-5p ZNF439 zinc finger protein 439 HGNC:20873 details
hsa-miR-181a-5p SCAMP2 secretory carrier membrane protein 2 HGNC:10564 details
hsa-miR-181a-5p TMCC1 transmembrane and coiled-coil domain family 1 HGNC:29116 details
hsa-miR-181a-5p FOXL1 forkhead box L1 HGNC:3817 details
hsa-miR-181a-5p SLC35G2 solute carrier family 35 member G2 HGNC:28480 details
hsa-miR-181a-5p ZNF107 zinc finger protein 107 HGNC:12887 details
hsa-miR-181a-5p MRPL34 mitochondrial ribosomal protein L34 HGNC:14488 details
hsa-miR-181a-5p SPIRE1 spire type actin nucleation factor 1 HGNC:30622 details
hsa-miR-181a-5p RNF6 ring finger protein 6 HGNC:10069 details
hsa-miR-181a-5p PTPDC1 protein tyrosine phosphatase domain containing 1 HGNC:30184 details
hsa-miR-181a-5p HMGA2 high mobility group AT-hook 2 HGNC:5009 details
hsa-miR-181a-5p FKBP1A FKBP prolyl isomerase 1A HGNC:3711 details
hsa-miR-181a-5p CSNK1A1 casein kinase 1 alpha 1 HGNC:2451 details
hsa-miR-181a-5p CHMP2B charged multivesicular body protein 2B HGNC:24537 details
hsa-miR-181a-5p ARSJ arylsulfatase family member J HGNC:26286 details
hsa-miR-181a-5p ZNF415 zinc finger protein 415 HGNC:20636 details
hsa-miR-181a-5p ZNF616 zinc finger protein 616 HGNC:28062 details
hsa-miR-181a-5p SUV39H2 SUV39H2 histone lysine methyltransferase HGNC:17287 details
hsa-miR-181a-5p ID4 inhibitor of DNA binding 4, HLH protein HGNC:5363 details
hsa-miR-181a-5p FAM3C FAM3 metabolism regulating signaling molecule C HGNC:18664 details
hsa-miR-181a-5p ZNF846 zinc finger protein 846 HGNC:27260 details
hsa-miR-181a-5p ZNF268 zinc finger protein 268 HGNC:13061 details
hsa-miR-181a-5p ZNF23 zinc finger protein 23 HGNC:13023 details
hsa-miR-181a-5p TUBB2A tubulin beta 2A class IIa HGNC:12412 details
hsa-miR-181a-5p GTPBP3 GTP binding protein 3, mitochondrial HGNC:14880 details
hsa-miR-181a-5p IRAK1BP1 interleukin 1 receptor associated kinase 1 binding protein 1 HGNC:17368 details
hsa-miR-181a-5p UNC5B unc-5 netrin receptor B HGNC:12568 details
hsa-miR-181a-5p ELK4 ETS transcription factor ELK4 HGNC:3326 details
hsa-miR-181a-5p SLC35G3 solute carrier family 35 member G3 HGNC:26848 details
hsa-miR-181a-5p ETS1 ETS proto-oncogene 1, transcription factor HGNC:3488 details
hsa-miR-181a-5p ZC3HAV1L zinc finger CCCH-type containing, antiviral 1 like HGNC:22423 details
hsa-miR-181a-5p RPS6KA3 ribosomal protein S6 kinase A3 HGNC:10432 details
hsa-miR-181a-5p AP5M1 adaptor related protein complex 5 subunit mu 1 HGNC:20192 details
hsa-miR-181a-5p ZNF829 zinc finger protein 829 HGNC:34032 details
hsa-miR-181a-5p WDR72 WD repeat domain 72 HGNC:26790 details
hsa-miR-181a-5p HFM1 helicase for meiosis 1 HGNC:20193 details
hsa-miR-181a-5p SPTLC3 serine palmitoyltransferase long chain base subunit 3 HGNC:16253 details
hsa-miR-181a-5p SCN8A sodium voltage-gated channel alpha subunit 8 HGNC:10596 details
hsa-miR-181a-5p ATXN7 ataxin 7 HGNC:10560 details
hsa-miR-181a-5p details
hsa-miR-181a-5p RBM25 RNA binding motif protein 25 HGNC:23244 details
hsa-miR-181a-5p ZADH2 zinc binding alcohol dehydrogenase domain containing 2 HGNC:28697 details
hsa-miR-181a-5p AP3M2 adaptor related protein complex 3 subunit mu 2 HGNC:570 details
hsa-miR-181a-5p PTBP3 polypyrimidine tract binding protein 3 HGNC:10253 details
hsa-miR-181a-5p ZNF556 zinc finger protein 556 HGNC:25669 details
hsa-miR-181a-5p ZNF253 zinc finger protein 253 HGNC:13497 details
hsa-miR-181a-5p TOPBP1 DNA topoisomerase II binding protein 1 HGNC:17008 details
hsa-miR-181a-5p TEF TEF transcription factor, PAR bZIP family member HGNC:11722 details
hsa-miR-181a-5p PDIA6 protein disulfide isomerase family A member 6 HGNC:30168 details
hsa-miR-181a-5p RNMT RNA guanine-7 methyltransferase HGNC:10075 details
hsa-miR-181a-5p LDLR low density lipoprotein receptor HGNC:6547 details
hsa-miR-181a-5p ADAM17 ADAM metallopeptidase domain 17 HGNC:195 details
hsa-miR-181a-5p RSBN1L round spermatid basic protein 1 like HGNC:24765 details
hsa-miR-181a-5p KLHL24 kelch like family member 24 HGNC:25947 details
hsa-miR-181a-5p PDK3 pyruvate dehydrogenase kinase 3 HGNC:8811 details
hsa-miR-181a-5p RNF187 ring finger protein 187 HGNC:27146 details
hsa-miR-181a-5p ZNF597 zinc finger protein 597 HGNC:26573 details
hsa-miR-181a-5p CENPO centromere protein O HGNC:28152 details
hsa-miR-181a-5p FAM13A family with sequence similarity 13 member A HGNC:19367 details
hsa-miR-181a-5p RLIM ring finger protein, LIM domain interacting HGNC:13429 details
hsa-miR-181a-5p VCAM1 vascular cell adhesion molecule 1 HGNC:12663 details
hsa-miR-181a-5p LAPTM4B lysosomal protein transmembrane 4 beta HGNC:13646 details
hsa-miR-181a-5p ZNF449 zinc finger protein 449 HGNC:21039 details
hsa-miR-181a-5p PNKD PNKD metallo-beta-lactamase domain containing HGNC:9153 details
hsa-miR-181a-5p EN2 engrailed homeobox 2 HGNC:3343 details
hsa-miR-181a-5p RGS5 regulator of G protein signaling 5 HGNC:10001 details
hsa-miR-181a-5p IFNG interferon gamma HGNC:5438 details
hsa-miR-181a-5p AHR aryl hydrocarbon receptor HGNC:348 details
hsa-miR-181a-5p STAT3 signal transducer and activator of transcription 3 HGNC:11364 details
hsa-miR-181a-5p WIF1 WNT inhibitory factor 1 HGNC:18081 details
hsa-miR-181a-5p TWIST1 twist family bHLH transcription factor 1 HGNC:12428 details
hsa-miR-181a-5p MAPK1 mitogen-activated protein kinase 1 HGNC:6871 details
hsa-miR-181a-5p ABCG2 ATP binding cassette subfamily G member 2 (Junior blood group) HGNC:74 details
hsa-miR-181a-5p PHACTR2 phosphatase and actin regulator 2 HGNC:20956 details
hsa-miR-181a-5p SASH1 SAM and SH3 domain containing 1 HGNC:19182 details
hsa-miR-181a-5p PHLDA1 pleckstrin homology like domain family A member 1 HGNC:8933 details
hsa-miR-181a-5p MOSPD1 motile sperm domain containing 1 HGNC:25235 details
hsa-miR-181a-5p SRGAP1 SLIT-ROBO Rho GTPase activating protein 1 HGNC:17382 details
hsa-miR-181a-5p C12orf29 chromosome 12 open reading frame 29 HGNC:25322 details
hsa-miR-181a-5p UBL3 ubiquitin like 3 HGNC:12504 details
hsa-miR-181a-5p PHACTR4 phosphatase and actin regulator 4 HGNC:25793 details
hsa-miR-181a-5p EREG epiregulin HGNC:3443 details
hsa-miR-181a-5p TERT telomerase reverse transcriptase HGNC:11730 details
hsa-miR-181a-5p CTDSPL CTD small phosphatase like HGNC:16890 details
hsa-miR-181a-5p TUSC3 tumor suppressor candidate 3 HGNC:30242 details
hsa-miR-181a-5p MEG3 maternally expressed 3 HGNC:14575 details
hsa-miR-181a-5p PHLPP2 PH domain and leucine rich repeat protein phosphatase 2 HGNC:29149 details
hsa-miR-181a-5p GPD1L glycerol-3-phosphate dehydrogenase 1 like HGNC:28956 details
hsa-miR-181a-5p PTEN phosphatase and tensin homolog HGNC:9588 details
hsa-miR-181a-5p ALDH1A1 aldehyde dehydrogenase 1 family member A1 HGNC:402 details
hsa-miR-181a-5p CDKN1A cyclin dependent kinase inhibitor 1A HGNC:1784 details
hsa-miR-181a-5p BAX BCL2 associated X, apoptosis regulator HGNC:959 details
hsa-miR-181a-5p RASSF1 Ras association domain family member 1 HGNC:9882 details
hsa-miR-181a-5p INPP4B inositol polyphosphate-4-phosphatase type II B HGNC:6075 details
hsa-miR-181a-5p CTNNB1 catenin beta 1 HGNC:2514 details
hsa-miR-181a-5p TCF4 transcription factor 4 HGNC:11634 details
hsa-miR-181a-5p VEGFA vascular endothelial growth factor A HGNC:12680 details
hsa-miR-181a-5p PRKN parkin RBR E3 ubiquitin protein ligase HGNC:8607 details
hsa-miR-181a-5p EGR1 early growth response 1 HGNC:3238 details
hsa-miR-181a-5p NRAS NRAS proto-oncogene, GTPase HGNC:7989 details
hsa-miR-181a-5p RUNX1 RUNX family transcription factor 1 HGNC:10471 details
hsa-miR-181a-5p CEBPA CCAAT enhancer binding protein alpha HGNC:1833 details
hsa-miR-181a-5p SAMHD1 SAM and HD domain containing deoxynucleoside triphosphate triphosphohydrolase 1 HGNC:15925 details
hsa-miR-181a-5p ADCY9 adenylate cyclase 9 HGNC:240 details
hsa-miR-181a-5p DCBLD2 discoidin, CUB and LCCL domain containing 2 HGNC:24627 details
hsa-miR-181a-5p RPL13A ribosomal protein L13a HGNC:10304 details
hsa-miR-181a-5p CADPS2 calcium dependent secretion activator 2 HGNC:16018 details
hsa-miR-181a-5p PRAMEF11 PRAME family member 11 HGNC:14086 details
hsa-miR-181a-5p PRAMEF15 PRAME family member 15 HGNC:26764 details
hsa-miR-181a-5p PRAMEF26 PRAME family member 26 HGNC:49178 details
hsa-miR-181a-5p PRAMEF4 PRAME family member 4 HGNC:31971 details
hsa-miR-181a-5p PRAMEF9 PRAME family member 9 HGNC:27996 details
hsa-miR-181a-5p HNRNPH1 heterogeneous nuclear ribonucleoprotein H1 HGNC:5041 details
hsa-miR-181a-5p WDFY3 WD repeat and FYVE domain containing 3 HGNC:20751 details