miRNA Card

miRNA General Information
miRNA ID hsa-miR-190a-3p
Description Homo sapiens miR-190a stem-loop
Comment This miRNA sequence is predicted based on homology to a verified miRNA from mouse [1], later verified in human [2].
Experiment Illumina [3]
Sequence CUAUAUAUCAAACAUAUUCCU
miRNA Expression in different cancers



circRNA-miRNA-gene regulatory network

Note about Netwrok:
This is a network diagram with miRNA (purple circle) as the center.
We used three tools(PITA, miRanda, targetScan) to predict the binding sites of circrna (green circle) and miRNA. Accordingly, for this miRNA that binds to circrna, we have three confidence levels, namely confident 1, confident 2 and confident 3. Confidence value indicates how many tools can deduce these results. For each confidence, we use different kinds of dashed lines.

Target circRNA with confidence

Confidence 3 (3 of 3 tools predicted)

CircID miRNA PITA miRanda targetScan

Confidence 2 (2 of 3 tools predicted)

CircID miRNA PITA miRanda targetScan

Confidence 1 (1 of 3 tools predicted)

CircID miRNA PITA miRanda targetScan
chr19:16355492|16355644 hsa-miR-190a-3p 0 1 0
chr17:75942635|75942746 hsa-miR-190a-3p 0 1 0
Target genes
miRNA Gene Gene Description HGNC ID details
hsa-miR-190a-3p details
hsa-miR-190a-3p ARHGAP29 Rho GTPase activating protein 29 HGNC:30207 details
hsa-miR-190a-3p TMX4 thioredoxin related transmembrane protein 4 HGNC:25237 details
hsa-miR-190a-3p KLHL23 kelch like family member 23 HGNC:27506 details
hsa-miR-190a-3p HSPA14 heat shock protein family A (Hsp70) member 14 HGNC:29526 details
hsa-miR-190a-3p TMEM164 transmembrane protein 164 HGNC:26217 details
hsa-miR-190a-3p FER FER tyrosine kinase HGNC:3655 details
hsa-miR-190a-3p UBE2K ubiquitin conjugating enzyme E2 K HGNC:4914 details
hsa-miR-190a-3p TRAF6 TNF receptor associated factor 6 HGNC:12036 details
hsa-miR-190a-3p GMNC geminin coiled-coil domain containing HGNC:40049 details
hsa-miR-190a-3p SLC16A6 solute carrier family 16 member 6 HGNC:10927 details
hsa-miR-190a-3p ZNF507 zinc finger protein 507 HGNC:23783 details
hsa-miR-190a-3p USP6NL USP6 N-terminal like HGNC:16858 details
hsa-miR-190a-3p THBS1 thrombospondin 1 HGNC:11785 details
hsa-miR-190a-3p STAU1 staufen double-stranded RNA binding protein 1 HGNC:11370 details
hsa-miR-190a-3p PPP1CC protein phosphatase 1 catalytic subunit gamma HGNC:9283 details
hsa-miR-190a-3p PLEKHA1 pleckstrin homology domain containing A1 HGNC:14335 details
hsa-miR-190a-3p PDHX pyruvate dehydrogenase complex component X HGNC:21350 details
hsa-miR-190a-3p NUFIP2 nuclear FMR1 interacting protein 2 HGNC:17634 details
hsa-miR-190a-3p LMNB2 lamin B2 HGNC:6638 details
hsa-miR-190a-3p LIMA1 LIM domain and actin binding 1 HGNC:24636 details
hsa-miR-190a-3p INSIG2 insulin induced gene 2 HGNC:20452 details
hsa-miR-190a-3p CREBRF CREB3 regulatory factor HGNC:24050 details
hsa-miR-190a-3p CD81 CD81 molecule HGNC:1701 details
hsa-miR-190a-3p PTK7 protein tyrosine kinase 7 (inactive) HGNC:9618 details
hsa-miR-190a-3p LAPTM4A lysosomal protein transmembrane 4 alpha HGNC:6924 details
hsa-miR-190a-3p CPEB2 cytoplasmic polyadenylation element binding protein 2 HGNC:21745 details
hsa-miR-190a-3p KCNK1 potassium two pore domain channel subfamily K member 1 HGNC:6272 details
hsa-miR-190a-3p RNF6 ring finger protein 6 HGNC:10069 details
hsa-miR-190a-3p SMARCAD1 SWI/SNF-related, matrix-associated actin-dependent regulator of chromatin, subfamily a, containing DEAD/H box 1 HGNC:18398 details
hsa-miR-190a-3p KIAA1109 KIAA1109 HGNC:26953 details
hsa-miR-190a-3p BTG2 BTG anti-proliferation factor 2 HGNC:1131 details
hsa-miR-190a-3p KCNJ6 potassium inwardly rectifying channel subfamily J member 6 HGNC:6267 details
hsa-miR-190a-3p XRCC3 X-ray repair cross complementing 3 HGNC:12830 details
hsa-miR-190a-3p SOX5 SRY-box transcription factor 5 HGNC:11201 details
hsa-miR-190a-3p TET2 tet methylcytosine dioxygenase 2 HGNC:25941 details
hsa-miR-190a-3p ASB11 ankyrin repeat and SOCS box containing 11 HGNC:17186 details
hsa-miR-190a-3p details
hsa-miR-190a-3p USP51 ubiquitin specific peptidase 51 HGNC:23086 details
hsa-miR-190a-3p BTBD19 BTB domain containing 19 HGNC:27145 details
hsa-miR-190a-3p CTLA4 cytotoxic T-lymphocyte associated protein 4 HGNC:2505 details
hsa-miR-190a-3p GPATCH11 G-patch domain containing 11 HGNC:26768 details
hsa-miR-190a-3p CARF calcium responsive transcription factor HGNC:14435 details
hsa-miR-190a-3p NCAM2 neural cell adhesion molecule 2 HGNC:7657 details
hsa-miR-190a-3p CSMD1 CUB and Sushi multiple domains 1 HGNC:14026 details
hsa-miR-190a-3p UBXN2B UBX domain protein 2B HGNC:27035 details
hsa-miR-190a-3p ELF2 E74 like ETS transcription factor 2 HGNC:3317 details
hsa-miR-190a-3p ABHD18 abhydrolase domain containing 18 HGNC:26111 details
hsa-miR-190a-3p CEP104 centrosomal protein 104 HGNC:24866 details
hsa-miR-190a-3p RAB3B RAB3B, member RAS oncogene family HGNC:9778 details
hsa-miR-190a-3p ADAMTS4 ADAM metallopeptidase with thrombospondin type 1 motif 4 HGNC:220 details
hsa-miR-190a-3p ZNF318 zinc finger protein 318 HGNC:13578 details
hsa-miR-190a-3p LHFPL5 LHFPL tetraspan subfamily member 5 HGNC:21253 details
hsa-miR-190a-3p COPS8 COP9 signalosome subunit 8 HGNC:24335 details
hsa-miR-190a-3p VCAM1 vascular cell adhesion molecule 1 HGNC:12663 details
hsa-miR-190a-3p SLC24A2 solute carrier family 24 member 2 HGNC:10976 details
hsa-miR-190a-3p MIPOL1 mirror-image polydactyly 1 HGNC:21460 details
hsa-miR-190a-3p BVES blood vessel epicardial substance HGNC:1152 details
hsa-miR-190a-3p UGT2B4 UDP glucuronosyltransferase family 2 member B4 HGNC:12553 details
hsa-miR-190a-3p ADH1B alcohol dehydrogenase 1B (class I), beta polypeptide HGNC:250 details
hsa-miR-190a-3p MMADHC metabolism of cobalamin associated D HGNC:25221 details
hsa-miR-190a-3p MFSD8 major facilitator superfamily domain containing 8 HGNC:28486 details
hsa-miR-190a-3p CYGB cytoglobin HGNC:16505 details
hsa-miR-190a-3p PLEKHA6 pleckstrin homology domain containing A6 HGNC:17053 details
hsa-miR-190a-3p DGKG diacylglycerol kinase gamma HGNC:2853 details
hsa-miR-190a-3p CLEC2D C-type lectin domain family 2 member D HGNC:14351 details
hsa-miR-190a-3p DOCK7 dedicator of cytokinesis 7 HGNC:19190 details
hsa-miR-190a-3p HOXD10 homeobox D10 HGNC:5133 details
hsa-miR-190a-3p VAMP4 vesicle associated membrane protein 4 HGNC:12645 details
hsa-miR-190a-3p LDHA lactate dehydrogenase A HGNC:6535 details
hsa-miR-190a-3p IMPG2 interphotoreceptor matrix proteoglycan 2 HGNC:18362 details
hsa-miR-190a-3p CA12 carbonic anhydrase 12 HGNC:1371 details
hsa-miR-190a-3p ZBED3 zinc finger BED-type containing 3 HGNC:20711 details
hsa-miR-190a-3p WDR76 WD repeat domain 76 HGNC:25773 details
hsa-miR-190a-3p UHMK1 U2AF homology motif kinase 1 HGNC:19683 details
hsa-miR-190a-3p RPS27A ribosomal protein S27a HGNC:10417 details
hsa-miR-190a-3p TBPL1 TATA-box binding protein like 1 HGNC:11589 details
hsa-miR-190a-3p SPATA2 spermatogenesis associated 2 HGNC:14681 details
hsa-miR-190a-3p SENP1 SUMO specific peptidase 1 HGNC:17927 details
hsa-miR-190a-3p SEC23IP SEC23 interacting protein HGNC:17018 details
hsa-miR-190a-3p RSBN1 round spermatid basic protein 1 HGNC:25642 details
hsa-miR-190a-3p PUM1 pumilio RNA binding family member 1 HGNC:14957 details
hsa-miR-190a-3p PPP4R2 protein phosphatase 4 regulatory subunit 2 HGNC:18296 details
hsa-miR-190a-3p PLEKHA3 pleckstrin homology domain containing A3 HGNC:14338 details
hsa-miR-190a-3p PIK3R1 phosphoinositide-3-kinase regulatory subunit 1 HGNC:8979 details
hsa-miR-190a-3p PCMTD1 protein-L-isoaspartate (D-aspartate) O-methyltransferase domain containing 1 HGNC:30483 details
hsa-miR-190a-3p NRF1 nuclear respiratory factor 1 HGNC:7996 details
hsa-miR-190a-3p MON1B MON1 homolog B, secretory trafficking associated HGNC:25020 details
hsa-miR-190a-3p details
hsa-miR-190a-3p LPAR3 lysophosphatidic acid receptor 3 HGNC:14298 details
hsa-miR-190a-3p LMTK2 lemur tyrosine kinase 2 HGNC:17880 details
hsa-miR-190a-3p KCNJ3 potassium inwardly rectifying channel subfamily J member 3 HGNC:6264 details
hsa-miR-190a-3p G3BP2 G3BP stress granule assembly factor 2 HGNC:30291 details
hsa-miR-190a-3p FBXL3 F-box and leucine rich repeat protein 3 HGNC:13599 details
hsa-miR-190a-3p EMC7 ER membrane protein complex subunit 7 HGNC:24301 details
hsa-miR-190a-3p E2F8 E2F transcription factor 8 HGNC:24727 details
hsa-miR-190a-3p CSRNP3 cysteine and serine rich nuclear protein 3 HGNC:30729 details
hsa-miR-190a-3p CD55 CD55 molecule (Cromer blood group) HGNC:2665 details
hsa-miR-190a-3p BACH2 BTB domain and CNC homolog 2 HGNC:14078 details
hsa-miR-190a-3p AMER1 APC membrane recruitment protein 1 HGNC:26837 details
hsa-miR-190a-3p PTP4A2 protein tyrosine phosphatase 4A2 HGNC:9635 details
hsa-miR-190a-3p CD226 CD226 molecule HGNC:16961 details
hsa-miR-190a-3p ADCYAP1 adenylate cyclase activating polypeptide 1 HGNC:241 details
hsa-miR-190a-3p CCDC38 coiled-coil domain containing 38 HGNC:26843 details
hsa-miR-190a-3p ZNF273 zinc finger protein 273 HGNC:13067 details
hsa-miR-190a-3p ITPRIPL1 ITPRIP like 1 HGNC:29371 details
hsa-miR-190a-3p MYBL1 MYB proto-oncogene like 1 HGNC:7547 details
hsa-miR-190a-3p ZNF608 zinc finger protein 608 HGNC:29238 details
hsa-miR-190a-3p RPP14 ribonuclease P/MRP subunit p14 HGNC:30327 details
hsa-miR-190a-3p ZNF516 zinc finger protein 516 HGNC:28990 details
hsa-miR-190a-3p CREB1 cAMP responsive element binding protein 1 HGNC:2345 details
hsa-miR-190a-3p HOXC4 homeobox C4 HGNC:5126 details
hsa-miR-190a-3p EIF2B1 eukaryotic translation initiation factor 2B subunit alpha HGNC:3257 details
hsa-miR-190a-3p RPL23A ribosomal protein L23a HGNC:10317 details
hsa-miR-190a-3p TBX20 T-box transcription factor 20 HGNC:11598 details
hsa-miR-190a-3p ENTHD1 ENTH domain containing 1 HGNC:26352 details
hsa-miR-190a-3p NRIP1 nuclear receptor interacting protein 1 HGNC:8001 details
hsa-miR-190a-3p ETV6 ETS variant transcription factor 6 HGNC:3495 details
hsa-miR-190a-3p CDKL1 cyclin dependent kinase like 1 HGNC:1781 details
hsa-miR-190a-3p NTRK3 neurotrophic receptor tyrosine kinase 3 HGNC:8033 details
hsa-miR-190a-3p TMCO1 transmembrane and coiled-coil domains 1 HGNC:18188 details
hsa-miR-190a-3p TECRL trans-2,3-enoyl-CoA reductase like HGNC:27365 details
hsa-miR-190a-3p MLLT3 MLLT3 super elongation complex subunit HGNC:7136 details
hsa-miR-190a-3p DCLRE1C DNA cross-link repair 1C HGNC:17642 details
hsa-miR-190a-3p TNFRSF9 TNF receptor superfamily member 9 HGNC:11924 details
hsa-miR-190a-3p CUL2 cullin 2 HGNC:2552 details
hsa-miR-190a-3p details
hsa-miR-190a-3p AKAP2 A-kinase anchoring protein 2 HGNC:372 details
hsa-miR-190a-3p RABGAP1 RAB GTPase activating protein 1 HGNC:17155 details
hsa-miR-190a-3p SLC25A27 solute carrier family 25 member 27 HGNC:21065 details
hsa-miR-190a-3p EFHC1 EF-hand domain containing 1 HGNC:16406 details
hsa-miR-190a-3p HS2ST1 heparan sulfate 2-O-sulfotransferase 1 HGNC:5193 details
hsa-miR-190a-3p TSPAN2 tetraspanin 2 HGNC:20659 details
hsa-miR-190a-3p BRCC3 BRCA1/BRCA2-containing complex subunit 3 HGNC:24185 details
hsa-miR-190a-3p PYHIN1 pyrin and HIN domain family member 1 HGNC:28894 details
hsa-miR-190a-3p PDE10A phosphodiesterase 10A HGNC:8772 details
hsa-miR-190a-3p OTX1 orthodenticle homeobox 1 HGNC:8521 details
hsa-miR-190a-3p SUCNR1 succinate receptor 1 HGNC:4542 details
hsa-miR-190a-3p SRP72 signal recognition particle 72 HGNC:11303 details
hsa-miR-190a-3p POU2F2 POU class 2 homeobox 2 HGNC:9213 details
hsa-miR-190a-3p TRIM2 tripartite motif containing 2 HGNC:15974 details
hsa-miR-190a-3p LARP1 La ribonucleoprotein 1, translational regulator HGNC:29531 details
hsa-miR-190a-3p RSBN1L round spermatid basic protein 1 like HGNC:24765 details
hsa-miR-190a-3p SPSB1 splA/ryanodine receptor domain and SOCS box containing 1 HGNC:30628 details
hsa-miR-190a-3p FOXL1 forkhead box L1 HGNC:3817 details
hsa-miR-190a-3p RAPH1 Ras association (RalGDS/AF-6) and pleckstrin homology domains 1 HGNC:14436 details
hsa-miR-190a-3p USF3 upstream transcription factor family member 3 HGNC:30494 details
hsa-miR-190a-3p SERTM1 serine rich and transmembrane domain containing 1 HGNC:33792 details
hsa-miR-190a-3p CHAF1B chromatin assembly factor 1 subunit B HGNC:1911 details
hsa-miR-190a-3p SULT1B1 sulfotransferase family 1B member 1 HGNC:17845 details
hsa-miR-190a-3p GTPBP2 GTP binding protein 2 HGNC:4670 details
hsa-miR-190a-3p TACR3 tachykinin receptor 3 HGNC:11528 details
hsa-miR-190a-3p CASD1 CAS1 domain containing 1 HGNC:16014 details
hsa-miR-190a-3p F2RL1 F2R like trypsin receptor 1 HGNC:3538 details
hsa-miR-190a-3p HHIP hedgehog interacting protein HGNC:14866 details
hsa-miR-190a-3p details
hsa-miR-190a-3p USP25 ubiquitin specific peptidase 25 HGNC:12624 details
hsa-miR-190a-3p ITGA1 integrin subunit alpha 1 HGNC:6134 details
hsa-miR-190a-3p KANSL1L KAT8 regulatory NSL complex subunit 1 like HGNC:26310 details
hsa-miR-190a-3p CRIM1 cysteine rich transmembrane BMP regulator 1 HGNC:2359 details
hsa-miR-190a-3p GTF2H1 general transcription factor IIH subunit 1 HGNC:4655 details
hsa-miR-190a-3p GSK3B glycogen synthase kinase 3 beta HGNC:4617 details
hsa-miR-190a-3p AGPS alkylglycerone phosphate synthase HGNC:327 details
hsa-miR-190a-3p ARID3A AT-rich interaction domain 3A HGNC:3031 details
hsa-miR-190a-3p NAA25 N-alpha-acetyltransferase 25, NatB auxiliary subunit HGNC:25783 details
hsa-miR-190a-3p LRP6 LDL receptor related protein 6 HGNC:6698 details
hsa-miR-190a-3p COL8A1 collagen type VIII alpha 1 chain HGNC:2215 details
hsa-miR-190a-3p C2orf49 chromosome 2 open reading frame 49 HGNC:28772 details
hsa-miR-190a-3p STARD8 StAR related lipid transfer domain containing 8 HGNC:19161 details
hsa-miR-190a-3p CYP4F11 cytochrome P450 family 4 subfamily F member 11 HGNC:13265 details
hsa-miR-190a-3p TNFSF9 TNF superfamily member 9 HGNC:11939 details
hsa-miR-190a-3p details
hsa-miR-190a-3p DDX55 DEAD-box helicase 55 HGNC:20085 details
hsa-miR-190a-3p ZXDA zinc finger X-linked duplicated A HGNC:13198 details
hsa-miR-190a-3p ZIC5 Zic family member 5 HGNC:20322 details
hsa-miR-190a-3p ZFHX3 zinc finger homeobox 3 HGNC:777 details
hsa-miR-190a-3p ZDHHC5 zinc finger DHHC-type palmitoyltransferase 5 HGNC:18472 details
hsa-miR-190a-3p YWHAZ tyrosine 3-monooxygenase/tryptophan 5-monooxygenase activation protein zeta HGNC:12855 details
hsa-miR-190a-3p UNG uracil DNA glycosylase HGNC:12572 details
hsa-miR-190a-3p TPPP tubulin polymerization promoting protein HGNC:24164 details
hsa-miR-190a-3p SV2B synaptic vesicle glycoprotein 2B HGNC:16874 details
hsa-miR-190a-3p STRN striatin HGNC:11424 details
hsa-miR-190a-3p SPPL2A signal peptide peptidase like 2A HGNC:30227 details
hsa-miR-190a-3p SP1 Sp1 transcription factor HGNC:11205 details
hsa-miR-190a-3p SLC8A1 solute carrier family 8 member A1 HGNC:11068 details
hsa-miR-190a-3p SENP3 SUMO specific peptidase 3 HGNC:17862 details
hsa-miR-190a-3p RTN4RL1 reticulon 4 receptor like 1 HGNC:21329 details
hsa-miR-190a-3p RCAN2 regulator of calcineurin 2 HGNC:3041 details
hsa-miR-190a-3p RAB5B RAB5B, member RAS oncogene family HGNC:9784 details
hsa-miR-190a-3p PURG purine rich element binding protein G HGNC:17930 details
hsa-miR-190a-3p PURA purine rich element binding protein A HGNC:9701 details
hsa-miR-190a-3p PRRX1 paired related homeobox 1 HGNC:9142 details
hsa-miR-190a-3p PROX1 prospero homeobox 1 HGNC:9459 details
hsa-miR-190a-3p PMAIP1 phorbol-12-myristate-13-acetate-induced protein 1 HGNC:9108 details
hsa-miR-190a-3p PCBP2 poly(rC) binding protein 2 HGNC:8648 details
hsa-miR-190a-3p PAQR3 progestin and adipoQ receptor family member 3 HGNC:30130 details
hsa-miR-190a-3p details
hsa-miR-190a-3p NPTN neuroplastin HGNC:17867 details
hsa-miR-190a-3p NFIB nuclear factor I B HGNC:7785 details
hsa-miR-190a-3p NDST1 N-deacetylase and N-sulfotransferase 1 HGNC:7680 details
hsa-miR-190a-3p NABP1 nucleic acid binding protein 1 HGNC:26232 details
hsa-miR-190a-3p MBNL3 muscleblind like splicing regulator 3 HGNC:20564 details
hsa-miR-190a-3p MARCKS myristoylated alanine rich protein kinase C substrate HGNC:6759 details
hsa-miR-190a-3p MAP3K12 mitogen-activated protein kinase kinase kinase 12 HGNC:6851 details
hsa-miR-190a-3p KPNA4 karyopherin subunit alpha 4 HGNC:6397 details
hsa-miR-190a-3p KIAA1522 KIAA1522 HGNC:29301 details
hsa-miR-190a-3p KHSRP KH-type splicing regulatory protein HGNC:6316 details
hsa-miR-190a-3p ITPRIPL2 ITPRIP like 2 HGNC:27257 details
hsa-miR-190a-3p IL6ST interleukin 6 cytokine family signal transducer HGNC:6021 details
hsa-miR-190a-3p IKZF4 IKAROS family zinc finger 4 HGNC:13179 details
hsa-miR-190a-3p HSPA13 heat shock protein family A (Hsp70) member 13 HGNC:11375 details
hsa-miR-190a-3p HMGXB4 HMG-box containing 4 HGNC:5003 details
hsa-miR-190a-3p HMGB2 high mobility group box 2 HGNC:5000 details
hsa-miR-190a-3p details
hsa-miR-190a-3p HDGF heparin binding growth factor HGNC:4856 details
hsa-miR-190a-3p FKBP14 FKBP prolyl isomerase 14 HGNC:18625 details
hsa-miR-190a-3p EVI5 ecotropic viral integration site 5 HGNC:3501 details
hsa-miR-190a-3p DUSP7 dual specificity phosphatase 7 HGNC:3073 details
hsa-miR-190a-3p DTX4 deltex E3 ubiquitin ligase 4 HGNC:29151 details
hsa-miR-190a-3p DENR density regulated re-initiation and release factor HGNC:2769 details
hsa-miR-190a-3p DDX6 DEAD-box helicase 6 HGNC:2747 details
hsa-miR-190a-3p CFL2 cofilin 2 HGNC:1875 details
hsa-miR-190a-3p BMP2K BMP2 inducible kinase HGNC:18041 details
hsa-miR-190a-3p ARHGEF33 Rho guanine nucleotide exchange factor 33 HGNC:37252 details
hsa-miR-190a-3p ADCY9 adenylate cyclase 9 HGNC:240 details
hsa-miR-190a-3p ABI2 abl interactor 2 HGNC:24011 details
hsa-miR-190a-3p TRPM6 transient receptor potential cation channel subfamily M member 6 HGNC:17995 details
hsa-miR-190a-3p LRRC63 leucine rich repeat containing 63 HGNC:34296 details
hsa-miR-190a-3p EPOR erythropoietin receptor HGNC:3416 details
hsa-miR-190a-3p details
hsa-miR-190a-3p details
hsa-miR-190a-3p CRADD CASP2 and RIPK1 domain containing adaptor with death domain HGNC:2340 details
hsa-miR-190a-3p PHEX phosphate regulating endopeptidase homolog X-linked HGNC:8918 details
hsa-miR-190a-3p ACER3 alkaline ceramidase 3 HGNC:16066 details
hsa-miR-190a-3p TSNARE1 t-SNARE domain containing 1 HGNC:26437 details
hsa-miR-190a-3p SHOX2 short stature homeobox 2 HGNC:10854 details
hsa-miR-190a-3p GPR141 G protein-coupled receptor 141 HGNC:19997 details
hsa-miR-190a-3p CABP4 calcium binding protein 4 HGNC:1386 details
hsa-miR-190a-3p SLC35E3 solute carrier family 35 member E3 HGNC:20864 details
hsa-miR-190a-3p ARHGAP21 Rho GTPase activating protein 21 HGNC:23725 details
hsa-miR-190a-3p WDR72 WD repeat domain 72 HGNC:26790 details
hsa-miR-190a-3p PRKCD protein kinase C delta HGNC:9399 details
hsa-miR-190a-3p CCT4 chaperonin containing TCP1 subunit 4 HGNC:1617 details
hsa-miR-190a-3p KRT222 keratin 222 HGNC:28695 details
hsa-miR-190a-3p WDR17 WD repeat domain 17 HGNC:16661 details
hsa-miR-190a-3p MYBPC1 myosin binding protein C1 HGNC:7549 details
hsa-miR-190a-3p RIC8B RIC8 guanine nucleotide exchange factor B HGNC:25555 details
hsa-miR-190a-3p NLGN4X neuroligin 4 X-linked HGNC:14287 details
hsa-miR-190a-3p FOCAD focadhesin HGNC:23377 details
hsa-miR-190a-3p AJAP1 adherens junctions associated protein 1 HGNC:30801 details
hsa-miR-190a-3p NAA40 N-alpha-acetyltransferase 40, NatD catalytic subunit HGNC:25845 details
hsa-miR-190a-3p PLXDC2 plexin domain containing 2 HGNC:21013 details
hsa-miR-190a-3p FAM182B family with sequence similarity 182 member B HGNC:34503 details
hsa-miR-190a-3p TRMO tRNA methyltransferase O HGNC:30967 details
hsa-miR-190a-3p AR androgen receptor HGNC:644 details
hsa-miR-190a-3p DBT dihydrolipoamide branched chain transacylase E2 HGNC:2698 details
hsa-miR-190a-3p RARS2 arginyl-tRNA synthetase 2, mitochondrial HGNC:21406 details
hsa-miR-190a-3p CALHM5 calcium homeostasis modulator family member 5 HGNC:21568 details
hsa-miR-190a-3p GLRX2 glutaredoxin 2 HGNC:16065 details
hsa-miR-190a-3p ZNF675 zinc finger protein 675 HGNC:30768 details
hsa-miR-190a-3p PIK3CG phosphatidylinositol-4,5-bisphosphate 3-kinase catalytic subunit gamma HGNC:8978 details
hsa-miR-190a-3p POT1 protection of telomeres 1 HGNC:17284 details
hsa-miR-190a-3p RAI1 retinoic acid induced 1 HGNC:9834 details
hsa-miR-190a-3p SLC35F6 solute carrier family 35 member F6 HGNC:26055 details
hsa-miR-190a-3p ZC3H6 zinc finger CCCH-type containing 6 HGNC:24762 details
hsa-miR-190a-3p VHLL VHL like HGNC:30666 details
hsa-miR-190a-3p ZNF347 zinc finger protein 347 HGNC:16447 details
hsa-miR-190a-3p NLRP9 NLR family pyrin domain containing 9 HGNC:22941 details
hsa-miR-190a-3p GRID1 glutamate ionotropic receptor delta type subunit 1 HGNC:4575 details
hsa-miR-190a-3p KCNK12 potassium two pore domain channel subfamily K member 12 HGNC:6274 details
hsa-miR-190a-3p ABCF1 ATP binding cassette subfamily F member 1 HGNC:70 details
hsa-miR-190a-3p VENTX VENT homeobox HGNC:13639 details
hsa-miR-190a-3p C10orf67 chromosome 10 open reading frame 67 HGNC:28716 details
hsa-miR-190a-3p PPIP5K2 diphosphoinositol pentakisphosphate kinase 2 HGNC:29035 details
hsa-miR-190a-3p XKR6 XK related 6 HGNC:27806 details
hsa-miR-190a-3p details
hsa-miR-190a-3p SCIN scinderin HGNC:21695 details
hsa-miR-190a-3p ZNF333 zinc finger protein 333 HGNC:15624 details
hsa-miR-190a-3p FRRS1 ferric chelate reductase 1 HGNC:27622 details
hsa-miR-190a-3p DEPTOR DEP domain containing MTOR interacting protein HGNC:22953 details
hsa-miR-190a-3p GRID2 glutamate ionotropic receptor delta type subunit 2 HGNC:4576 details
hsa-miR-190a-3p CAPN5 calpain 5 HGNC:1482 details
hsa-miR-190a-3p SLC2A12 solute carrier family 2 member 12 HGNC:18067 details
hsa-miR-190a-3p CLVS2 clavesin 2 HGNC:23046 details
hsa-miR-190a-3p TNIP1 TNFAIP3 interacting protein 1 HGNC:16903 details
hsa-miR-190a-3p AKAP8 A-kinase anchoring protein 8 HGNC:378 details
hsa-miR-190a-3p L2HGDH L-2-hydroxyglutarate dehydrogenase HGNC:20499 details
hsa-miR-190a-3p PCDH10 protocadherin 10 HGNC:13404 details
hsa-miR-190a-3p PPP1R1A protein phosphatase 1 regulatory inhibitor subunit 1A HGNC:9286 details
hsa-miR-190a-3p CD180 CD180 molecule HGNC:6726 details
hsa-miR-190a-3p SEMA3F semaphorin 3F HGNC:10728 details
hsa-miR-190a-3p ZNF609 zinc finger protein 609 HGNC:29003 details
hsa-miR-190a-3p ZNF512B zinc finger protein 512B HGNC:29212 details
hsa-miR-190a-3p ZMYM2 zinc finger MYM-type containing 2 HGNC:12989 details
hsa-miR-190a-3p ZER1 zyg-11 related cell cycle regulator HGNC:30960 details
hsa-miR-190a-3p ZBTB20 zinc finger and BTB domain containing 20 HGNC:13503 details
hsa-miR-190a-3p ZBTB16 zinc finger and BTB domain containing 16 HGNC:12930 details
hsa-miR-190a-3p YAF2 YY1 associated factor 2 HGNC:17363 details
hsa-miR-190a-3p XRN1 5'-3' exoribonuclease 1 HGNC:30654 details
hsa-miR-190a-3p WNT5A Wnt family member 5A HGNC:12784 details
hsa-miR-190a-3p WASL WASP like actin nucleation promoting factor HGNC:12735 details
hsa-miR-190a-3p UCHL3 ubiquitin C-terminal hydrolase L3 HGNC:12515 details
hsa-miR-190a-3p UBN2 ubinuclein 2 HGNC:21931 details
hsa-miR-190a-3p TRIM23 tripartite motif containing 23 HGNC:660 details
hsa-miR-190a-3p TRIM13 tripartite motif containing 13 HGNC:9976 details
hsa-miR-190a-3p PIP4P1 phosphatidylinositol-4,5-bisphosphate 4-phosphatase 1 HGNC:19299 details
hsa-miR-190a-3p TMEM106B transmembrane protein 106B HGNC:22407 details
hsa-miR-190a-3p THSD7A thrombospondin type 1 domain containing 7A HGNC:22207 details
hsa-miR-190a-3p TBX18 T-box transcription factor 18 HGNC:11595 details
hsa-miR-190a-3p SYP synaptophysin HGNC:11506 details
hsa-miR-190a-3p SLC30A4 solute carrier family 30 member 4 HGNC:11015 details
hsa-miR-190a-3p SIPA1L3 signal induced proliferation associated 1 like 3 HGNC:23801 details
hsa-miR-190a-3p RUNX1T1 RUNX1 partner transcriptional co-repressor 1 HGNC:1535 details
hsa-miR-190a-3p RC3H1 ring finger and CCCH-type domains 1 HGNC:29434 details
hsa-miR-190a-3p RBBP9 RB binding protein 9, serine hydrolase HGNC:9892 details
hsa-miR-190a-3p PRKD3 protein kinase D3 HGNC:9408 details
hsa-miR-190a-3p PPARGC1A PPARG coactivator 1 alpha HGNC:9237 details
hsa-miR-190a-3p PLRG1 pleiotropic regulator 1 HGNC:9089 details
hsa-miR-190a-3p PITPNC1 phosphatidylinositol transfer protein cytoplasmic 1 HGNC:21045 details
hsa-miR-190a-3p PIAS1 protein inhibitor of activated STAT 1 HGNC:2752 details
hsa-miR-190a-3p PHIP pleckstrin homology domain interacting protein HGNC:15673 details
hsa-miR-190a-3p PHF8 PHD finger protein 8 HGNC:20672 details
hsa-miR-190a-3p PHACTR2 phosphatase and actin regulator 2 HGNC:20956 details
hsa-miR-190a-3p PEX5L peroxisomal biogenesis factor 5 like HGNC:30024 details
hsa-miR-190a-3p PDCD10 programmed cell death 10 HGNC:8761 details
hsa-miR-190a-3p PCGF2 polycomb group ring finger 2 HGNC:12929 details
hsa-miR-190a-3p PAPSS2 3'-phosphoadenosine 5'-phosphosulfate synthase 2 HGNC:8604 details
hsa-miR-190a-3p NELL2 neural EGFL like 2 HGNC:7751 details
hsa-miR-190a-3p NLK nemo like kinase HGNC:29858 details
hsa-miR-190a-3p NFIC nuclear factor I C HGNC:7786 details
hsa-miR-190a-3p MYADM myeloid associated differentiation marker HGNC:7544 details
hsa-miR-190a-3p MMP16 matrix metallopeptidase 16 HGNC:7162 details
hsa-miR-190a-3p MBTD1 mbt domain containing 1 HGNC:19866 details
hsa-miR-190a-3p MAN1A2 mannosidase alpha class 1A member 2 HGNC:6822 details
hsa-miR-190a-3p LRRC55 leucine rich repeat containing 55 HGNC:32324 details
hsa-miR-190a-3p LRP8 LDL receptor related protein 8 HGNC:6700 details
hsa-miR-190a-3p LDLR low density lipoprotein receptor HGNC:6547 details
hsa-miR-190a-3p KLHL9 kelch like family member 9 HGNC:18732 details
hsa-miR-190a-3p KLF7 Kruppel like factor 7 HGNC:6350 details
hsa-miR-190a-3p NEXMIF neurite extension and migration factor HGNC:29433 details
hsa-miR-190a-3p KCNN3 potassium calcium-activated channel subfamily N member 3 HGNC:6292 details
hsa-miR-190a-3p KAT6A lysine acetyltransferase 6A HGNC:13013 details
hsa-miR-190a-3p INTU inturned planar cell polarity protein HGNC:29239 details
hsa-miR-190a-3p IGF1 insulin like growth factor 1 HGNC:5464 details
hsa-miR-190a-3p HOXA11 homeobox A11 HGNC:5101 details
hsa-miR-190a-3p GSR glutathione-disulfide reductase HGNC:4623 details
hsa-miR-190a-3p GRIN2B glutamate ionotropic receptor NMDA type subunit 2B HGNC:4586 details
hsa-miR-190a-3p GRIK3 glutamate ionotropic receptor kainate type subunit 3 HGNC:4581 details
hsa-miR-190a-3p GRAMD1B GRAM domain containing 1B HGNC:29214 details
hsa-miR-190a-3p FZD5 frizzled class receptor 5 HGNC:4043 details
hsa-miR-190a-3p FBXO9 F-box protein 9 HGNC:13588 details
hsa-miR-190a-3p FBXO48 F-box protein 48 HGNC:33857 details
hsa-miR-190a-3p details
hsa-miR-190a-3p EPHA5 EPH receptor A5 HGNC:3389 details
hsa-miR-190a-3p DOCK4 dedicator of cytokinesis 4 HGNC:19192 details
hsa-miR-190a-3p DNAJB14 DnaJ heat shock protein family (Hsp40) member B14 HGNC:25881 details
hsa-miR-190a-3p DDI2 DNA damage inducible 1 homolog 2 HGNC:24578 details
hsa-miR-190a-3p CNOT6L CCR4-NOT transcription complex subunit 6 like HGNC:18042 details
hsa-miR-190a-3p CHRM3 cholinergic receptor muscarinic 3 HGNC:1952 details
hsa-miR-190a-3p CALML4 calmodulin like 4 HGNC:18445 details
hsa-miR-190a-3p C1orf50 chromosome 1 open reading frame 50 HGNC:28795 details
hsa-miR-190a-3p BRI3BP BRI3 binding protein HGNC:14251 details
hsa-miR-190a-3p BACH1 BTB domain and CNC homolog 1 HGNC:935 details
hsa-miR-190a-3p ARSJ arylsulfatase family member J HGNC:26286 details
hsa-miR-190a-3p ANKRD44 ankyrin repeat domain 44 HGNC:25259 details
hsa-miR-190a-3p AMD1 adenosylmethionine decarboxylase 1 HGNC:457 details
hsa-miR-190a-3p AKAP10 A-kinase anchoring protein 10 HGNC:368 details
hsa-miR-190a-3p ABHD13 abhydrolase domain containing 13 HGNC:20293 details
hsa-miR-190a-3p CBR1 carbonyl reductase 1 HGNC:1548 details
hsa-miR-190a-3p GULP1 GULP PTB domain containing engulfment adaptor 1 HGNC:18649 details
hsa-miR-190a-3p ID4 inhibitor of DNA binding 4, HLH protein HGNC:5363 details
hsa-miR-190a-3p GPRIN2 G protein regulated inducer of neurite outgrowth 2 HGNC:23730 details
hsa-miR-190a-3p CERCAM cerebral endothelial cell adhesion molecule HGNC:23723 details
hsa-miR-190a-3p ZNF354B zinc finger protein 354B HGNC:17197 details
hsa-miR-190a-3p SHISA2 shisa family member 2 HGNC:20366 details
hsa-miR-190a-3p HPSE heparanase HGNC:5164 details
hsa-miR-190a-3p ALG10B ALG10 alpha-1,2-glucosyltransferase B HGNC:31088 details
hsa-miR-190a-3p SNX3 sorting nexin 3 HGNC:11174 details
hsa-miR-190a-3p TMEM135 transmembrane protein 135 HGNC:26167 details
hsa-miR-190a-3p SLC7A11 solute carrier family 7 member 11 HGNC:11059 details
hsa-miR-190a-3p SLC16A1 solute carrier family 16 member 1 HGNC:10922 details
hsa-miR-190a-3p REST RE1 silencing transcription factor HGNC:9966 details
hsa-miR-190a-3p RAB18 RAB18, member RAS oncogene family HGNC:14244 details
hsa-miR-190a-3p PRPF40A pre-mRNA processing factor 40 homolog A HGNC:16463 details
hsa-miR-190a-3p PLK2 polo like kinase 2 HGNC:19699 details
hsa-miR-190a-3p MIER1 MIER1 transcriptional regulator HGNC:29657 details
hsa-miR-190a-3p HIVEP1 HIVEP zinc finger 1 HGNC:4920 details
hsa-miR-190a-3p details
hsa-miR-190a-3p BMPR1A bone morphogenetic protein receptor type 1A HGNC:1076 details
hsa-miR-190a-3p ZNF556 zinc finger protein 556 HGNC:25669 details
hsa-miR-190a-3p DNAH10OS dynein axonemal heavy chain 10 opposite strand HGNC:37121 details
hsa-miR-190a-3p LILRB2 leukocyte immunoglobulin like receptor B2 HGNC:6606 details
hsa-miR-190a-3p NLRP8 NLR family pyrin domain containing 8 HGNC:22940 details
hsa-miR-190a-3p TBRG4 transforming growth factor beta regulator 4 HGNC:17443 details
hsa-miR-190a-3p SSPN sarcospan HGNC:11322 details
hsa-miR-190a-3p SAMD12 sterile alpha motif domain containing 12 HGNC:31750 details
hsa-miR-190a-3p MGAT4C MGAT4 family member C HGNC:30871 details
hsa-miR-190a-3p PELP1 proline, glutamate and leucine rich protein 1 HGNC:30134 details
hsa-miR-190a-3p TTC39B tetratricopeptide repeat domain 39B HGNC:23704 details
hsa-miR-190a-3p CDON cell adhesion associated, oncogene regulated HGNC:17104 details
hsa-miR-190a-3p PPP2R5E protein phosphatase 2 regulatory subunit B'epsilon HGNC:9313 details
hsa-miR-190a-3p ROCK2 Rho associated coiled-coil containing protein kinase 2 HGNC:10252 details
hsa-miR-190a-3p STN1 STN1 subunit of CST complex HGNC:26200 details
hsa-miR-190a-3p ZBTB18 zinc finger and BTB domain containing 18 HGNC:13030 details
hsa-miR-190a-3p WEE1 WEE1 G2 checkpoint kinase HGNC:12761 details
hsa-miR-190a-3p RORA RAR related orphan receptor A HGNC:10258 details
hsa-miR-190a-3p PLAG1 PLAG1 zinc finger HGNC:9045 details
hsa-miR-190a-3p MAPK6 mitogen-activated protein kinase 6 HGNC:6879 details
hsa-miR-190a-3p CREBZF CREB/ATF bZIP transcription factor HGNC:24905 details
hsa-miR-190a-3p BCORL1 BCL6 corepressor like 1 HGNC:25657 details
hsa-miR-190a-3p CNTNAP5 contactin associated protein family member 5 HGNC:18748 details
hsa-miR-190a-3p PLEKHM3 pleckstrin homology domain containing M3 HGNC:34006 details
hsa-miR-190a-3p APIP APAF1 interacting protein HGNC:17581 details
hsa-miR-190a-3p PRR23A proline rich 23A HGNC:37172 details
hsa-miR-190a-3p OSBP2 oxysterol binding protein 2 HGNC:8504 details
hsa-miR-190a-3p ERRFI1 ERBB receptor feedback inhibitor 1 HGNC:18185 details
hsa-miR-190a-3p PPIL1 peptidylprolyl isomerase like 1 HGNC:9260 details
hsa-miR-190a-3p GTF2B general transcription factor IIB HGNC:4648 details
hsa-miR-190a-3p TAGLN2 transgelin 2 HGNC:11554 details
hsa-miR-190a-3p ZNF460 zinc finger protein 460 HGNC:21628 details
hsa-miR-190a-3p SPPL3 signal peptide peptidase like 3 HGNC:30424 details
hsa-miR-190a-3p SGPP2 sphingosine-1-phosphate phosphatase 2 HGNC:19953 details
hsa-miR-190a-3p IRS1 insulin receptor substrate 1 HGNC:6125 details
hsa-miR-190a-3p C15orf40 chromosome 15 open reading frame 40 HGNC:28443 details
hsa-miR-190a-3p PLP1 proteolipid protein 1 HGNC:9086 details
hsa-miR-190a-3p TSEN34 tRNA splicing endonuclease subunit 34 HGNC:15506 details
hsa-miR-190a-3p ANXA5 annexin A5 HGNC:543 details
hsa-miR-190a-3p GABRG1 gamma-aminobutyric acid type A receptor subunit gamma1 HGNC:4086 details
hsa-miR-190a-3p ZNF551 zinc finger protein 551 HGNC:25108 details
hsa-miR-190a-3p SLC12A2 solute carrier family 12 member 2 HGNC:10911 details
hsa-miR-190a-3p NEDD4L NEDD4 like E3 ubiquitin protein ligase HGNC:7728 details
hsa-miR-190a-3p NDFIP2 Nedd4 family interacting protein 2 HGNC:18537 details
hsa-miR-190a-3p SNRPD3 small nuclear ribonucleoprotein D3 polypeptide HGNC:11160 details
hsa-miR-190a-3p TNPO1 transportin 1 HGNC:6401 details
hsa-miR-190a-3p TMTC3 transmembrane O-mannosyltransferase targeting cadherins 3 HGNC:26899 details
hsa-miR-190a-3p TFAP2C transcription factor AP-2 gamma HGNC:11744 details
hsa-miR-190a-3p TAOK1 TAO kinase 1 HGNC:29259 details
hsa-miR-190a-3p STOX2 storkhead box 2 HGNC:25450 details
hsa-miR-190a-3p SERTAD2 SERTA domain containing 2 HGNC:30784 details
hsa-miR-190a-3p RBM7 RNA binding motif protein 7 HGNC:9904 details
hsa-miR-190a-3p OSBPL9 oxysterol binding protein like 9 HGNC:16386 details
hsa-miR-190a-3p NFIA nuclear factor I A HGNC:7784 details
hsa-miR-190a-3p MSI2 musashi RNA binding protein 2 HGNC:18585 details
hsa-miR-190a-3p LMNB1 lamin B1 HGNC:6637 details
hsa-miR-190a-3p LIN28B lin-28 homolog B HGNC:32207 details
hsa-miR-190a-3p KLHDC10 kelch domain containing 10 HGNC:22194 details
hsa-miR-190a-3p HNRNPU heterogeneous nuclear ribonucleoprotein U HGNC:5048 details
hsa-miR-190a-3p FBXW7 F-box and WD repeat domain containing 7 HGNC:16712 details
hsa-miR-190a-3p DAPK1 death associated protein kinase 1 HGNC:2674 details
hsa-miR-190a-3p CRK CRK proto-oncogene, adaptor protein HGNC:2362 details
hsa-miR-190a-3p C18orf25 chromosome 18 open reading frame 25 HGNC:28172 details
hsa-miR-190a-3p ATXN3 ataxin 3 HGNC:7106 details
hsa-miR-190a-3p ASH1L ASH1 like histone lysine methyltransferase HGNC:19088 details
hsa-miR-190a-3p ARL8A ADP ribosylation factor like GTPase 8A HGNC:25192 details
hsa-miR-190a-3p ANKRD33B ankyrin repeat domain 33B HGNC:35240 details
hsa-miR-190a-3p ACSL4 acyl-CoA synthetase long chain family member 4 HGNC:3571 details
hsa-miR-190a-3p ACBD5 acyl-CoA binding domain containing 5 HGNC:23338 details
hsa-miR-190a-3p RBM23 RNA binding motif protein 23 HGNC:20155 details
hsa-miR-190a-3p NUP37 nucleoporin 37 HGNC:29929 details
hsa-miR-190a-3p RHCG Rh family C glycoprotein HGNC:18140 details
hsa-miR-190a-3p FAR2 fatty acyl-CoA reductase 2 HGNC:25531 details
hsa-miR-190a-3p LINC00955 long intergenic non-protein coding RNA 955 HGNC:26644 details
hsa-miR-190a-3p CLEC12A C-type lectin domain family 12 member A HGNC:31713 details
hsa-miR-190a-3p TMEM106C transmembrane protein 106C HGNC:28775 details
hsa-miR-190a-3p FAM120AOS family with sequence similarity 120A opposite strand HGNC:23389 details
hsa-miR-190a-3p APOL6 apolipoprotein L6 HGNC:14870 details
hsa-miR-190a-3p SMAD9 SMAD family member 9 HGNC:6774 details
hsa-miR-190a-3p MYLK3 myosin light chain kinase 3 HGNC:29826 details
hsa-miR-190a-3p TBX4 T-box transcription factor 4 HGNC:11603 details
hsa-miR-190a-3p PLCXD1 phosphatidylinositol specific phospholipase C X domain containing 1 HGNC:23148 details
hsa-miR-190a-3p ARSK arylsulfatase family member K HGNC:25239 details
hsa-miR-190a-3p APOOL apolipoprotein O like HGNC:24009 details
hsa-miR-190a-3p OPN5 opsin 5 HGNC:19992 details
hsa-miR-190a-3p FAM229B family with sequence similarity 229 member B HGNC:33858 details
hsa-miR-190a-3p DDX52 DExD-box helicase 52 HGNC:20038 details
hsa-miR-190a-3p ATP7A ATPase copper transporting alpha HGNC:869 details
hsa-miR-190a-3p OPCML opioid binding protein/cell adhesion molecule like HGNC:8143 details
hsa-miR-190a-3p EPM2AIP1 EPM2A interacting protein 1 HGNC:19735 details
hsa-miR-190a-3p GIMAP7 GTPase, IMAP family member 7 HGNC:22404 details
hsa-miR-190a-3p ZNF267 zinc finger protein 267 HGNC:13060 details
hsa-miR-190a-3p SNRPD1 small nuclear ribonucleoprotein D1 polypeptide HGNC:11158 details
hsa-miR-190a-3p CCDC127 coiled-coil domain containing 127 HGNC:30520 details
hsa-miR-190a-3p C4orf33 chromosome 4 open reading frame 33 HGNC:27025 details
hsa-miR-190a-3p LDHAL6A lactate dehydrogenase A like 6A HGNC:28335 details
hsa-miR-190a-3p TMEM47 transmembrane protein 47 HGNC:18515 details
hsa-miR-190a-3p EPHA1 EPH receptor A1 HGNC:3385 details
hsa-miR-190a-3p RAB11FIP3 RAB11 family interacting protein 3 HGNC:17224 details
hsa-miR-190a-3p ZNF562 zinc finger protein 562 HGNC:25950 details
hsa-miR-190a-3p ZHX3 zinc fingers and homeoboxes 3 HGNC:15935 details
hsa-miR-190a-3p ZC3H12C zinc finger CCCH-type containing 12C HGNC:29362 details
hsa-miR-190a-3p VGLL2 vestigial like family member 2 HGNC:20232 details
hsa-miR-190a-3p TSPAN14 tetraspanin 14 HGNC:23303 details
hsa-miR-190a-3p TMEM161B transmembrane protein 161B HGNC:28483 details
hsa-miR-190a-3p TIMM10 translocase of inner mitochondrial membrane 10 HGNC:11814 details
hsa-miR-190a-3p SLAIN2 SLAIN motif family member 2 HGNC:29282 details
hsa-miR-190a-3p RRAGC Ras related GTP binding C HGNC:19902 details
hsa-miR-190a-3p RPL37 ribosomal protein L37 HGNC:10347 details
hsa-miR-190a-3p RECK reversion inducing cysteine rich protein with kazal motifs HGNC:11345 details
hsa-miR-190a-3p RAB5C RAB5C, member RAS oncogene family HGNC:9785 details
hsa-miR-190a-3p QKI QKI, KH domain containing RNA binding HGNC:21100 details
hsa-miR-190a-3p PTPRJ protein tyrosine phosphatase receptor type J HGNC:9673 details
hsa-miR-190a-3p PTPRD protein tyrosine phosphatase receptor type D HGNC:9668 details
hsa-miR-190a-3p PMEPA1 prostate transmembrane protein, androgen induced 1 HGNC:14107 details
hsa-miR-190a-3p PITPNB phosphatidylinositol transfer protein beta HGNC:9002 details
hsa-miR-190a-3p NUBP1 nucleotide binding protein 1 HGNC:8041 details
hsa-miR-190a-3p MBNL2 muscleblind like splicing regulator 2 HGNC:16746 details
hsa-miR-190a-3p details
hsa-miR-190a-3p LAMC1 laminin subunit gamma 1 HGNC:6492 details
hsa-miR-190a-3p KLF6 Kruppel like factor 6 HGNC:2235 details
hsa-miR-190a-3p HOOK1 hook microtubule tethering protein 1 HGNC:19884 details
hsa-miR-190a-3p HMGN3 high mobility group nucleosomal binding domain 3 HGNC:12312 details
hsa-miR-190a-3p FUBP1 far upstream element binding protein 1 HGNC:4004 details
hsa-miR-190a-3p FREM2 FRAS1 related extracellular matrix 2 HGNC:25396 details
hsa-miR-190a-3p FOXP1 forkhead box P1 HGNC:3823 details
hsa-miR-190a-3p FBXL18 F-box and leucine rich repeat protein 18 HGNC:21874 details
hsa-miR-190a-3p FAM177A1 family with sequence similarity 177 member A1 HGNC:19829 details
hsa-miR-190a-3p ERC1 ELKS/RAB6-interacting/CAST family member 1 HGNC:17072 details
hsa-miR-190a-3p DUSP8 dual specificity phosphatase 8 HGNC:3074 details
hsa-miR-190a-3p DGKH diacylglycerol kinase eta HGNC:2854 details
hsa-miR-190a-3p DDX3X DEAD-box helicase 3 X-linked HGNC:2745 details
hsa-miR-190a-3p DDX17 DEAD-box helicase 17 HGNC:2740 details
hsa-miR-190a-3p BMP2 bone morphogenetic protein 2 HGNC:1069 details
hsa-miR-190a-3p BLOC1S4 biogenesis of lysosomal organelles complex 1 subunit 4 HGNC:24206 details
hsa-miR-190a-3p ATP2B4 ATPase plasma membrane Ca2+ transporting 4 HGNC:817 details
hsa-miR-190a-3p ASF1A anti-silencing function 1A histone chaperone HGNC:20995 details
hsa-miR-190a-3p ARL5B ADP ribosylation factor like GTPase 5B HGNC:23052 details
hsa-miR-190a-3p ARID5B AT-rich interaction domain 5B HGNC:17362 details
hsa-miR-190a-3p APP amyloid beta precursor protein HGNC:620 details
hsa-miR-190a-3p AP1AR adaptor related protein complex 1 associated regulatory protein HGNC:28808 details
hsa-miR-190a-3p ZNF529 zinc finger protein 529 HGNC:29328 details
hsa-miR-190a-3p DEGS1 delta 4-desaturase, sphingolipid 1 HGNC:13709 details
hsa-miR-190a-3p TMEM30A transmembrane protein 30A HGNC:16667 details
hsa-miR-190a-3p CBX6 chromobox 6 HGNC:1556 details
hsa-miR-190a-3p ETS2 ETS proto-oncogene 2, transcription factor HGNC:3489 details
hsa-miR-190a-3p SVIP small VCP interacting protein HGNC:25238 details
hsa-miR-190a-3p HUWE1 HECT, UBA and WWE domain containing E3 ubiquitin protein ligase 1 HGNC:30892 details
hsa-miR-190a-3p CCL11 C-C motif chemokine ligand 11 HGNC:10610 details
hsa-miR-190a-3p IFNAR1 interferon alpha and beta receptor subunit 1 HGNC:5432 details
hsa-miR-190a-3p SSB small RNA binding exonuclease protection factor La HGNC:11316 details
hsa-miR-190a-3p CCDC80 coiled-coil domain containing 80 HGNC:30649 details
hsa-miR-190a-3p ZRANB1 zinc finger RANBP2-type containing 1 HGNC:18224 details
hsa-miR-190a-3p XPOT exportin for tRNA HGNC:12826 details
hsa-miR-190a-3p POU2F1 POU class 2 homeobox 1 HGNC:9212 details
hsa-miR-190a-3p NR3C1 nuclear receptor subfamily 3 group C member 1 HGNC:7978 details
hsa-miR-190a-3p MLLT10 MLLT10 histone lysine methyltransferase DOT1L cofactor HGNC:16063 details
hsa-miR-190a-3p MASTL microtubule associated serine/threonine kinase like HGNC:19042 details
hsa-miR-190a-3p LBR lamin B receptor HGNC:6518 details
hsa-miR-190a-3p IRF2BP2 interferon regulatory factor 2 binding protein 2 HGNC:21729 details
hsa-miR-190a-3p EXOC8 exocyst complex component 8 HGNC:24659 details
hsa-miR-190a-3p BCOR BCL6 corepressor HGNC:20893 details
hsa-miR-190a-3p AASDHPPT aminoadipate-semialdehyde dehydrogenase-phosphopantetheinyl transferase HGNC:14235 details
hsa-miR-190a-3p RANBP1 RAN binding protein 1 HGNC:9847 details
hsa-miR-190a-3p N4BP1 NEDD4 binding protein 1 HGNC:29850 details
hsa-miR-190a-3p PCK1 phosphoenolpyruvate carboxykinase 1 HGNC:8724 details
hsa-miR-190a-3p REEP3 receptor accessory protein 3 HGNC:23711 details
hsa-miR-190a-3p CD2AP CD2 associated protein HGNC:14258 details
hsa-miR-190a-3p TAS2R30 taste 2 receptor member 30 HGNC:19112 details
hsa-miR-190a-3p CHEK1 checkpoint kinase 1 HGNC:1925 details
hsa-miR-190a-3p DHX36 DEAH-box helicase 36 HGNC:14410 details
hsa-miR-190a-3p LILRB1 leukocyte immunoglobulin like receptor B1 HGNC:6605 details
hsa-miR-190a-3p RAB3GAP1 RAB3 GTPase activating protein catalytic subunit 1 HGNC:17063 details
hsa-miR-190a-3p EMC3 ER membrane protein complex subunit 3 HGNC:23999 details
hsa-miR-190a-3p SLITRK4 SLIT and NTRK like family member 4 HGNC:23502 details
hsa-miR-190a-3p IGF2BP1 insulin like growth factor 2 mRNA binding protein 1 HGNC:28866 details
hsa-miR-190a-3p GCK glucokinase HGNC:4195 details
hsa-miR-190a-3p TUBD1 tubulin delta 1 HGNC:16811 details
hsa-miR-190a-3p CEP97 centrosomal protein 97 HGNC:26244 details
hsa-miR-190a-3p FGFBP3 fibroblast growth factor binding protein 3 HGNC:23428 details
hsa-miR-190a-3p ELK4 ETS transcription factor ELK4 HGNC:3326 details
hsa-miR-190a-3p NEGR1 neuronal growth regulator 1 HGNC:17302 details
hsa-miR-190a-3p KYNU kynureninase HGNC:6469 details
hsa-miR-190a-3p SPAST spastin HGNC:11233 details
hsa-miR-190a-3p ANGPTL2 angiopoietin like 2 HGNC:490 details
hsa-miR-190a-3p SH3TC2 SH3 domain and tetratricopeptide repeats 2 HGNC:29427 details
hsa-miR-190a-3p ACVR2B activin A receptor type 2B HGNC:174 details
hsa-miR-190a-3p GDNF glial cell derived neurotrophic factor HGNC:4232 details
hsa-miR-190a-3p NSUN3 NOP2/Sun RNA methyltransferase 3 HGNC:26208 details
hsa-miR-190a-3p KCNMB4 potassium calcium-activated channel subfamily M regulatory beta subunit 4 HGNC:6289 details
hsa-miR-190a-3p TRIP10 thyroid hormone receptor interactor 10 HGNC:12304 details
hsa-miR-190a-3p ZNF319 zinc finger protein 319 HGNC:13644 details
hsa-miR-190a-3p ICA1L islet cell autoantigen 1 like HGNC:14442 details
hsa-miR-190a-3p SIKE1 suppressor of IKBKE 1 HGNC:26119 details
hsa-miR-190a-3p TSPAN1 tetraspanin 1 HGNC:20657 details
hsa-miR-190a-3p SLC6A5 solute carrier family 6 member 5 HGNC:11051 details
hsa-miR-190a-3p LRRC40 leucine rich repeat containing 40 HGNC:26004 details
hsa-miR-190a-3p ITPRIP inositol 1,4,5-trisphosphate receptor interacting protein HGNC:29370 details
hsa-miR-190a-3p SLC6A8 solute carrier family 6 member 8 HGNC:11055 details
hsa-miR-190a-3p PPP1R2 protein phosphatase 1 regulatory inhibitor subunit 2 HGNC:9288 details
hsa-miR-190a-3p details
hsa-miR-190a-3p L1CAM L1 cell adhesion molecule HGNC:6470 details
hsa-miR-190a-3p HERPUD2 HERPUD family member 2 HGNC:21915 details
hsa-miR-190a-3p CHST2 carbohydrate sulfotransferase 2 HGNC:1970 details
hsa-miR-190a-3p PRRC2C proline rich coiled-coil 2C HGNC:24903 details
hsa-miR-190a-3p AHCYL2 adenosylhomocysteinase like 2 HGNC:22204 details
hsa-miR-190a-3p SPRED1 sprouty related EVH1 domain containing 1 HGNC:20249 details
hsa-miR-190a-3p BRMS1L BRMS1 like transcriptional repressor HGNC:20512 details
hsa-miR-190a-3p LONRF3 LON peptidase N-terminal domain and ring finger 3 HGNC:21152 details
hsa-miR-190a-3p TANK TRAF family member associated NFKB activator HGNC:11562 details
hsa-miR-190a-3p IKZF2 IKAROS family zinc finger 2 HGNC:13177 details
hsa-miR-190a-3p NCK2 NCK adaptor protein 2 HGNC:7665 details
hsa-miR-190a-3p STAM signal transducing adaptor molecule HGNC:11357 details
hsa-miR-190a-3p SIK3 SIK family kinase 3 HGNC:29165 details
hsa-miR-190a-3p KCNB1 potassium voltage-gated channel subfamily B member 1 HGNC:6231 details
hsa-miR-190a-3p NBPF10 NBPF member 10 HGNC:31992 details
hsa-miR-190a-3p ARHGEF11 Rho guanine nucleotide exchange factor 11 HGNC:14580 details
hsa-miR-190a-3p PCDH7 protocadherin 7 HGNC:8659 details
hsa-miR-190a-3p MFAP5 microfibril associated protein 5 HGNC:29673 details
hsa-miR-190a-3p DCAF4L1 DDB1 and CUL4 associated factor 4 like 1 HGNC:27723 details
hsa-miR-190a-3p WNT11 Wnt family member 11 HGNC:12776 details
hsa-miR-190a-3p WDTC1 WD and tetratricopeptide repeats 1 HGNC:29175 details
hsa-miR-190a-3p CXCL5 C-X-C motif chemokine ligand 5 HGNC:10642 details
hsa-miR-190a-3p ADAMTS9 ADAM metallopeptidase with thrombospondin type 1 motif 9 HGNC:13202 details
hsa-miR-190a-3p IGFBP1 insulin like growth factor binding protein 1 HGNC:5469 details
hsa-miR-190a-3p SLCO1B3 solute carrier organic anion transporter family member 1B3 HGNC:10961 details
hsa-miR-190a-3p details
hsa-miR-190a-3p FAM47E-STBD1 FAM47E-STBD1 readthrough HGNC:44667 details
hsa-miR-190a-3p ZNF264 zinc finger protein 264 HGNC:13057 details
hsa-miR-190a-3p ZMAT3 zinc finger matrin-type 3 HGNC:29983 details
hsa-miR-190a-3p ZBTB7A zinc finger and BTB domain containing 7A HGNC:18078 details
hsa-miR-190a-3p WDR12 WD repeat domain 12 HGNC:14098 details
hsa-miR-190a-3p UNK unk zinc finger HGNC:29369 details
hsa-miR-190a-3p TTYH3 tweety family member 3 HGNC:22222 details
hsa-miR-190a-3p TMEM178B transmembrane protein 178B HGNC:44112 details
hsa-miR-190a-3p TIGD5 tigger transposable element derived 5 HGNC:18336 details
hsa-miR-190a-3p STYX serine/threonine/tyrosine interacting protein HGNC:11447 details
hsa-miR-190a-3p SRGAP2 SLIT-ROBO Rho GTPase activating protein 2 HGNC:19751 details
hsa-miR-190a-3p SNRK SNF related kinase HGNC:30598 details
hsa-miR-190a-3p SLC45A4 solute carrier family 45 member 4 HGNC:29196 details
hsa-miR-190a-3p SLC25A12 solute carrier family 25 member 12 HGNC:10982 details
hsa-miR-190a-3p PRIMA1 proline rich membrane anchor 1 HGNC:18319 details
hsa-miR-190a-3p PAPPA pappalysin 1 HGNC:8602 details
hsa-miR-190a-3p NR2C2 nuclear receptor subfamily 2 group C member 2 HGNC:7972 details
hsa-miR-190a-3p MTF1 metal regulatory transcription factor 1 HGNC:7428 details
hsa-miR-190a-3p MCAM melanoma cell adhesion molecule HGNC:6934 details
hsa-miR-190a-3p KIAA1671 KIAA1671 HGNC:29345 details
hsa-miR-190a-3p IGF1R insulin like growth factor 1 receptor HGNC:5465 details
hsa-miR-190a-3p HACE1 HECT domain and ankyrin repeat containing E3 ubiquitin protein ligase 1 HGNC:21033 details
hsa-miR-190a-3p GREB1L GREB1 like retinoic acid receptor coactivator HGNC:31042 details
hsa-miR-190a-3p CADM1 cell adhesion molecule 1 HGNC:5951 details
hsa-miR-190a-3p C18orf32 chromosome 18 open reading frame 32 HGNC:31690 details
hsa-miR-190a-3p B4GALT6 beta-1,4-galactosyltransferase 6 HGNC:929 details
hsa-miR-190a-3p ADD2 adducin 2 HGNC:244 details
hsa-miR-190a-3p NDUFAF7 NADH:ubiquinone oxidoreductase complex assembly factor 7 HGNC:28816 details
hsa-miR-190a-3p RNF44 ring finger protein 44 HGNC:19180 details
hsa-miR-190a-3p ANGEL2 angel homolog 2 HGNC:30534 details
hsa-miR-190a-3p ADAT2 adenosine deaminase tRNA specific 2 HGNC:21172 details
hsa-miR-190a-3p MXD1 MAX dimerization protein 1 HGNC:6761 details
hsa-miR-190a-3p SMCHD1 structural maintenance of chromosomes flexible hinge domain containing 1 HGNC:29090 details
hsa-miR-190a-3p ZNF268 zinc finger protein 268 HGNC:13061 details
hsa-miR-190a-3p HSF2 heat shock transcription factor 2 HGNC:5225 details