miRNA Card

miRNA General Information
miRNA ID hsa-miR-190a-5p
Description Homo sapiens miR-190a stem-loop
Comment This miRNA sequence is predicted based on homology to a verified miRNA from mouse [1], later verified in human [2].
Experiment cloned [2], Illumina [3]
Sequence UGAUAUGUUUGAUAUAUUAGGU
miRNA Expression in different cancers

    by mir_boxplot.py

circRNA-miRNA-gene regulatory network

Note about Netwrok:
This is a network diagram with miRNA (purple circle) as the center.
We used three tools(PITA, miRanda, targetScan) to predict the binding sites of circrna (green circle) and miRNA. Accordingly, for this miRNA that binds to circrna, we have three confidence levels, namely confident 1, confident 2 and confident 3. Confidence value indicates how many tools can deduce these results. For each confidence, we use different kinds of dashed lines.

Target circRNA with confidence

Confidence 3 (3 of 3 tools predicted)

CircID miRNA PITA miRanda targetScan

Confidence 2 (2 of 3 tools predicted)

Confidence 1 (1 of 3 tools predicted)

CircID miRNA PITA miRanda targetScan
chr3:129369616|129369811 hsa-miR-190a-5p 1 0 0
chrX:65741670|65741830 hsa-miR-190a-5p 0 1 0
chr6:167951255|167951504 hsa-miR-190a-5p 0 1 0
chr3:129369668|129369791 hsa-miR-190a-5p 1 0 0
chr3:15679301|15679524 hsa-miR-190a-5p 1 0 0
chr9:121784568|121784684 hsa-miR-190a-5p 0 1 0
chrX:78130101|78130338 hsa-miR-190a-5p 0 1 0
chr7:98310461|98310592 hsa-miR-190a-5p 0 1 0
chrX:54809229|54809359 hsa-miR-190a-5p 0 1 0
chr11:78072998|78073072 hsa-miR-190a-5p 0 1 0
chr8:143915900|143916061 hsa-miR-190a-5p 0 1 0
chr1:166849353|166849484 hsa-miR-190a-5p 0 1 0
chr8:143915946|143916061 hsa-miR-190a-5p 0 1 0
chr17:59840228|59840444 hsa-miR-190a-5p 0 1 0
chrX:65741670~65741830 hsa-miR-190a-5p 0 1 0
chr3:57548158~57548319 hsa-miR-190a-5p 0 1 0
chr12:7062495~7062622 hsa-miR-190a-5p 0 1 0
chr7:29921871~29921966 hsa-miR-190a-5p 0 1 0
chr6:108621758|108621981 hsa-miR-190a-5p 0 1 0
chr12:68842483|68842701 hsa-miR-190a-5p 0 1 0
chr5:78884302|78884479 hsa-miR-190a-5p 0 1 0
chr2:9310998|9311145 hsa-miR-190a-5p 0 1 0
chr6:1691559|1691787 hsa-miR-190a-5p 0 1 0
chr10:101896837|101897013 hsa-miR-190a-5p 0 1 0
chr10:113730041|113730228 hsa-miR-190a-5p 0 1 0
chr22:32478981|32479275 hsa-miR-190a-5p 0 1 0
chr8:40175330|40175444 hsa-miR-190a-5p 0 1 0
chrX:54809224|54809359 hsa-miR-190a-5p 0 1 0
chr8:143915933|143916052 hsa-miR-190a-5p 0 1 0
chr11:86022367|86031611 hsa-miR-190a-5p 0 1 0
chr10:27142387|27145590 hsa-miR-190a-5p 0 1 0
chr22:46361815|46361908 hsa-miR-190a-5p 0 1 0
chr5:131426559|131426709 hsa-miR-190a-5p 0 1 0
chr10:113730050|113730228 hsa-miR-190a-5p 0 1 0
chrX:65741563|65741830 hsa-miR-190a-5p 0 1 0
chr7:92564089|92564199 hsa-miR-190a-5p 0 1 0
chr12:101757212|101757588 hsa-miR-190a-5p 0 1 0
chr21:31992925|31993061 hsa-miR-190a-5p 1 0 0
chr3:15679301|15679555 hsa-miR-190a-5p 1 0 0
chr3:15679301|15679506 hsa-miR-190a-5p 1 0 0
chr16:68301008|68301174 hsa-miR-190a-5p 0 1 0
chr8:143915832|143916103 hsa-miR-190a-5p 0 1 0
chr8:94791378|94791496 hsa-miR-190a-5p 0 1 0
chrX:47505373|47505639 hsa-miR-190a-5p 0 1 0
chr7:99630965|99631092 hsa-miR-190a-5p 0 1 0
chr2:69820699|69820821 hsa-miR-190a-5p 0 1 0
chrX:54809224|54809743 hsa-miR-190a-5p 0 1 0
chr12:7062495|7062622 hsa-miR-190a-5p 0 1 0
chr4:186588749|186588910 hsa-miR-190a-5p 0 1 0
chrX:65741673|65741830 hsa-miR-190a-5p 0 1 0
chr8:143915845|143916052 hsa-miR-190a-5p 0 1 0
chr7:98310445|98310592 hsa-miR-190a-5p 0 1 0
chr2:96595545|96601663 hsa-miR-190a-5p 0 1 0
Target genes
miRNA Gene Gene Description HGNC ID details
hsa-miR-190a-5p CDKN1B cyclin dependent kinase inhibitor 1B HGNC:1785 details
hsa-miR-190a-5p VEGFA vascular endothelial growth factor A HGNC:12680 details
hsa-miR-190a-5p PHLPP1 PH domain and leucine rich repeat protein phosphatase 1 HGNC:20610 details
hsa-miR-190a-5p KCNQ5 potassium voltage-gated channel subfamily Q member 5 HGNC:6299 details
hsa-miR-190a-5p CDKL2 cyclin dependent kinase like 2 HGNC:1782 details
hsa-miR-190a-5p PCDHB11 protocadherin beta 11 HGNC:8682 details
hsa-miR-190a-5p SDC3 syndecan 3 HGNC:10660 details
hsa-miR-190a-5p TRIM5 tripartite motif containing 5 HGNC:16276 details
hsa-miR-190a-5p GPC5 glypican 5 HGNC:4453 details
hsa-miR-190a-5p TNRC6A trinucleotide repeat containing adaptor 6A HGNC:11969 details
hsa-miR-190a-5p SPRED1 sprouty related EVH1 domain containing 1 HGNC:20249 details
hsa-miR-190a-5p PTPRJ protein tyrosine phosphatase receptor type J HGNC:9673 details
hsa-miR-190a-5p MAP3K9 mitogen-activated protein kinase kinase kinase 9 HGNC:6861 details
hsa-miR-190a-5p LDHA lactate dehydrogenase A HGNC:6535 details
hsa-miR-190a-5p KLF6 Kruppel like factor 6 HGNC:2235 details
hsa-miR-190a-5p FOXN2 forkhead box N2 HGNC:5281 details
hsa-miR-190a-5p DAB2 DAB adaptor protein 2 HGNC:2662 details
hsa-miR-190a-5p details
hsa-miR-190a-5p ATXN7L3B ataxin 7 like 3B HGNC:37931 details
hsa-miR-190a-5p ADAMTS8 ADAM metallopeptidase with thrombospondin type 1 motif 8 HGNC:224 details
hsa-miR-190a-5p MTRNR2L10 MT-RNR2 like 10 HGNC:37167 details
hsa-miR-190a-5p OVOL1 ovo like transcriptional repressor 1 HGNC:8525 details
hsa-miR-190a-5p MTRNR2L8 MT-RNR2 like 8 HGNC:37165 details
hsa-miR-190a-5p CYGB cytoglobin HGNC:16505 details
hsa-miR-190a-5p MSANTD4 Myb/SANT DNA binding domain containing 4 with coiled-coils HGNC:29383 details
hsa-miR-190a-5p BCL2L13 BCL2 like 13 HGNC:17164 details
hsa-miR-190a-5p ZNF608 zinc finger protein 608 HGNC:29238 details
hsa-miR-190a-5p SGMS2 sphingomyelin synthase 2 HGNC:28395 details
hsa-miR-190a-5p IL6ST interleukin 6 cytokine family signal transducer HGNC:6021 details
hsa-miR-190a-5p TRA2B transformer 2 beta homolog HGNC:10781 details
hsa-miR-190a-5p CALML4 calmodulin like 4 HGNC:18445 details
hsa-miR-190a-5p INVS inversin HGNC:17870 details
hsa-miR-190a-5p TATDN2 TatD DNase domain containing 2 HGNC:28988 details
hsa-miR-190a-5p FAM13B family with sequence similarity 13 member B HGNC:1335 details
hsa-miR-190a-5p CCDC160 coiled-coil domain containing 160 HGNC:37286 details
hsa-miR-190a-5p KLHL24 kelch like family member 24 HGNC:25947 details
hsa-miR-190a-5p ZNF460 zinc finger protein 460 HGNC:21628 details
hsa-miR-190a-5p CSDE1 cold shock domain containing E1 HGNC:29905 details
hsa-miR-190a-5p IL7R interleukin 7 receptor HGNC:6024 details
hsa-miR-190a-5p ZNF264 zinc finger protein 264 HGNC:13057 details
hsa-miR-190a-5p MED4 mediator complex subunit 4 HGNC:17903 details
hsa-miR-190a-5p ZNF223 zinc finger protein 223 HGNC:13016 details
hsa-miR-190a-5p STAMBP STAM binding protein HGNC:16950 details
hsa-miR-190a-5p SERP1 stress associated endoplasmic reticulum protein 1 HGNC:10759 details
hsa-miR-190a-5p PGAM4 phosphoglycerate mutase family member 4 HGNC:21731 details
hsa-miR-190a-5p PM20D2 peptidase M20 domain containing 2 HGNC:21408 details
hsa-miR-190a-5p details
hsa-miR-190a-5p LRRC58 leucine rich repeat containing 58 HGNC:26968 details
hsa-miR-190a-5p KIAA0232 KIAA0232 HGNC:28992 details
hsa-miR-190a-5p details
hsa-miR-190a-5p RAB30 RAB30, member RAS oncogene family HGNC:9770 details
hsa-miR-190a-5p ENO4 enolase 4 HGNC:31670 details
hsa-miR-190a-5p ADCYAP1R1 ADCYAP receptor type I HGNC:242 details
hsa-miR-190a-5p DUSP10 dual specificity phosphatase 10 HGNC:3065 details
hsa-miR-190a-5p KCNMB4 potassium calcium-activated channel subfamily M regulatory beta subunit 4 HGNC:6289 details
hsa-miR-190a-5p TMEM161B transmembrane protein 161B HGNC:28483 details
hsa-miR-190a-5p MAP3K2 mitogen-activated protein kinase kinase kinase 2 HGNC:6854 details
hsa-miR-190a-5p ZNF850 zinc finger protein 850 HGNC:27994 details
hsa-miR-190a-5p HACD4 3-hydroxyacyl-CoA dehydratase 4 HGNC:20920 details
hsa-miR-190a-5p IGF1 insulin like growth factor 1 HGNC:5464 details
hsa-miR-190a-5p MARK2 microtubule affinity regulating kinase 2 HGNC:3332 details
hsa-miR-190a-5p FOXP2 forkhead box P2 HGNC:13875 details
hsa-miR-190a-5p HBS1L HBS1 like translational GTPase HGNC:4834 details
hsa-miR-190a-5p OMD osteomodulin HGNC:8134 details
hsa-miR-190a-5p PIGM phosphatidylinositol glycan anchor biosynthesis class M HGNC:18858 details
hsa-miR-190a-5p SIGMAR1 sigma non-opioid intracellular receptor 1 HGNC:8157 details
© 2021 Arieh Warshel Institute of Computational Biology, CUHK(SZ) | Designed by : Biomics Lab