miRNA Card

miRNA General Information
miRNA ID hsa-miR-19b-3p
Description Homo sapiens miR-19b-1 stem-loop
Comment None
Experiment cloned [1-3,6-9], Northern [1,5]
Sequence UGUGCAAAUCCAUGCAAAACUGA
miRNA Expression in different cancers

    by mir_boxplot.py

circRNA-miRNA-gene regulatory network

Note about Netwrok:
This is a network diagram with miRNA (purple circle) as the center.
We used three tools(PITA, miRanda, targetScan) to predict the binding sites of circrna (green circle) and miRNA. Accordingly, for this miRNA that binds to circrna, we have three confidence levels, namely confident 1, confident 2 and confident 3. Confidence value indicates how many tools can deduce these results. For each confidence, we use different kinds of dashed lines.

Target circRNA with confidence

Confidence 3 (3 of 3 tools predicted)

CircID miRNA PITA miRanda targetScan
chr16:74912198|74956610 hsa-miR-19b-3p 1 1 1

Confidence 1 (1 of 3 tools predicted)

CircID miRNA PITA miRanda targetScan
chr12:8941653|8941766 hsa-miR-19b-3p 0 1 0
chr10:1214048|1214140 hsa-miR-19b-3p 0 1 0
chr3:58098761|58098908 hsa-miR-19b-3p 0 1 0
chr9:113386461|113386622 hsa-miR-19b-3p 0 1 0
chr10:80520454|80520641 hsa-miR-19b-3p 0 1 0
chr14:101818023|101818196 hsa-miR-19b-3p 0 1 0
chrX:73846096|73846386 hsa-miR-19b-3p 0 1 0
chr17:1423071|1423254 hsa-miR-19b-3p 0 1 0
chrX:69161622|69161750 hsa-miR-19b-3p 0 1 0
chr2:47795894|47796063 hsa-miR-19b-3p 0 1 0
chr19:45303075|45303246 hsa-miR-19b-3p 0 1 0
chr12:53977086|53977308 hsa-miR-19b-3p 0 1 0
chr19:46411226|46411425 hsa-miR-19b-3p 0 1 0
chr17:82078613|82078944 hsa-miR-19b-3p 0 1 0
chr9:113386466|113386625 hsa-miR-19b-3p 0 1 0
chr1:151051814|151051987 hsa-miR-19b-3p 0 1 0
chr1:13778757|13778950 hsa-miR-19b-3p 0 1 0
chr19:5153422|5153531 hsa-miR-19b-3p 0 1 0
chr1:155328258|155330533 hsa-miR-19b-3p 0 1 0
chr1:224190015|224190236 hsa-miR-19b-3p 0 1 0
chr12:64697249|64697408 hsa-miR-19b-3p 0 1 0
chr3:123590184|123590299 hsa-miR-19b-3p 0 1 0
chr1:222652002|222652332 hsa-miR-19b-3p 0 1 0
chr1:32684034|32684346 hsa-miR-19b-3p 0 1 0
chr12:8941653|8941738 hsa-miR-19b-3p 0 1 0
chr1:39282346|39283301 hsa-miR-19b-3p 0 1 0
chr6:53918680|53918783 hsa-miR-19b-3p 0 1 0
chr2:178450242|178450401 hsa-miR-19b-3p 0 1 0
chr12:124622408|124622535 hsa-miR-19b-3p 0 1 0
chr12:64697281|64697408 hsa-miR-19b-3p 0 1 0
chr16:71856485|71856640 hsa-miR-19b-3p 0 1 0
chr2:47795924|47796063 hsa-miR-19b-3p 0 1 0
chr17:1423069|1423321 hsa-miR-19b-3p 0 1 0
chr14:105855640|105856008 hsa-miR-19b-3p 0 1 0
chr17:1423069|1423254 hsa-miR-19b-3p 0 1 0
chr14:105855662|105856034 hsa-miR-19b-3p 0 1 0
chr1:25499960|25500095 hsa-miR-19b-3p 0 1 0
chr14:22547514|22547778 hsa-miR-19b-3p 0 1 0
chr9:134438644|134438807 hsa-miR-19b-3p 0 1 0
chr5:56888234~56888357 hsa-miR-19b-3p 0 1 0
chr6:139373490~139373662 hsa-miR-19b-3p 0 1 0
chr11:119134516~119134655 hsa-miR-19b-3p 0 1 0
chrX:73846096~73846386 hsa-miR-19b-3p 0 1 0
chr1:51271776~51271923 hsa-miR-19b-3p 0 1 0
chr3:107808973~107809128 hsa-miR-19b-3p 0 1 0
chr11:123060256~123060473 hsa-miR-19b-3p 0 1 0
chr1:154550889|154551004 hsa-miR-19b-3p 0 1 0
chr12:49755693|49758443 hsa-miR-19b-3p 0 1 0
chr2:42970000|42970175 hsa-miR-19b-3p 0 1 0
chr12:46245361|46245525 hsa-miR-19b-3p 0 1 0
chr16:67098858|67098956 hsa-miR-19b-3p 0 1 0
chr8:141428832|141428946 hsa-miR-19b-3p 0 1 0
chr1:54265820|54265903 hsa-miR-19b-3p 0 1 0
chr10:128068796|128068984 hsa-miR-19b-3p 0 1 0
chr6:99568688|99568797 hsa-miR-19b-3p 0 1 0
chr3:149175046|149175232 hsa-miR-19b-3p 0 1 0
chr1:27851376|27851485 hsa-miR-19b-3p 0 1 0
chr14:105855662|105856036 hsa-miR-19b-3p 0 1 0
chr20:62943533|62943665 hsa-miR-19b-3p 0 1 0
chr14:105855667|105855978 hsa-miR-19b-3p 0 1 0
chr16:3021934|3022131 hsa-miR-19b-3p 0 1 0
chr12:12475416|12475600 hsa-miR-19b-3p 0 1 0
chr5:172691288|172691436 hsa-miR-19b-3p 0 1 0
chr10:1214113|1214233 hsa-miR-19b-3p 0 1 0
chr1:21604446|21604546 hsa-miR-19b-3p 0 1 0
chr14:105855667|105856034 hsa-miR-19b-3p 0 1 0
chr17:1423069|1423286 hsa-miR-19b-3p 0 1 0
chr1:184628384|184628510 hsa-miR-19b-3p 0 1 0
chr14:31168298|31169468 hsa-miR-19b-3p 0 1 0
chrX:136706908|136713370 hsa-miR-19b-3p 0 1 0
chr18:79965295|79965434 hsa-miR-19b-3p 0 1 0
chr22:19451242|19451452 hsa-miR-19b-3p 0 1 0
chr1:26777349|26777565 hsa-miR-19b-3p 0 1 0
chr14:105855717|105855971 hsa-miR-19b-3p 0 1 0
chr2:47795920|47796063 hsa-miR-19b-3p 0 1 0
chr1:156465542|156465739 hsa-miR-19b-3p 0 1 0
chr14:105855717|105855978 hsa-miR-19b-3p 0 1 0
chrX:16712519|16712625 hsa-miR-19b-3p 0 1 0
chr13:98431072|98431280 hsa-miR-19b-3p 0 1 0
chr1:51271776|51271923 hsa-miR-19b-3p 0 1 0
chr1:26777250|26777565 hsa-miR-19b-3p 0 1 0
chr14:105855717|105855990 hsa-miR-19b-3p 0 1 0
chr19:39178823|39178990 hsa-miR-19b-3p 0 1 0
chr2:101011106|101011219 hsa-miR-19b-3p -19 1 0
chr8:141172255|141172335 hsa-miR-19b-3p 0 1 0
chr14:105855919|105856036 hsa-miR-19b-3p 0 1 0
chr20:57649588|57649770 hsa-miR-19b-3p 0 1 0
chr9:76663301|76663504 hsa-miR-19b-3p 0 1 0
chr6:131281661|131281783 hsa-miR-19b-3p 0 1 0
chr17:82078779|82078974 hsa-miR-19b-3p 0 1 0
chr19:5153417|5153531 hsa-miR-19b-3p 0 1 0
chr15:59095066|59095239 hsa-miR-19b-3p 0 1 0
chr12:64697290|64697405 hsa-miR-19b-3p 0 1 0
chr20:63284680|63284821 hsa-miR-19b-3p 0 1 0
chr6:139373527|139373659 hsa-miR-19b-3p 0 1 0
chr17:74964511|74964634 hsa-miR-19b-3p 0 1 0
chr3:46680734|46680851 hsa-miR-19b-3p 0 1 0
chr3:100386218|100386328 hsa-miR-19b-3p 0 1 0
chr11:1105311|1105887 hsa-miR-19b-3p 0 1 0
Target genes
miRNA Gene Gene Description HGNC ID details
hsa-miR-19b-3p ATXN1 ataxin 1 HGNC:10548 details
hsa-miR-19b-3p BACE1 beta-secretase 1 HGNC:933 details
hsa-miR-19b-3p HIPK3 homeodomain interacting protein kinase 3 HGNC:4915 details
hsa-miR-19b-3p ARID4B AT-rich interaction domain 4B HGNC:15550 details
hsa-miR-19b-3p MYLIP myosin regulatory light chain interacting protein HGNC:21155 details
hsa-miR-19b-3p ESR1 estrogen receptor 1 HGNC:3467 details
hsa-miR-19b-3p NCOA3 nuclear receptor coactivator 3 HGNC:7670 details
hsa-miR-19b-3p KAT2B lysine acetyltransferase 2B HGNC:8638 details
hsa-miR-19b-3p SOCS1 suppressor of cytokine signaling 1 HGNC:19383 details
hsa-miR-19b-3p BCL2L11 BCL2 like 11 HGNC:994 details
hsa-miR-19b-3p HIF1A hypoxia inducible factor 1 subunit alpha HGNC:4910 details
hsa-miR-19b-3p TGFBR2 transforming growth factor beta receptor 2 HGNC:11773 details
hsa-miR-19b-3p PTEN phosphatase and tensin homolog HGNC:9588 details
hsa-miR-19b-3p BMPR2 bone morphogenetic protein receptor type 2 HGNC:1078 details
hsa-miR-19b-3p CUL5 cullin 5 HGNC:2556 details
hsa-miR-19b-3p TLR2 toll like receptor 2 HGNC:11848 details
hsa-miR-19b-3p PRKAA1 protein kinase AMP-activated catalytic subunit alpha 1 HGNC:9376 details
hsa-miR-19b-3p PPP2R5E protein phosphatase 2 regulatory subunit B'epsilon HGNC:9313 details
hsa-miR-19b-3p CYP19A1 cytochrome P450 family 19 subfamily A member 1 HGNC:2594 details
hsa-miR-19b-3p GCM1 glial cells missing transcription factor 1 HGNC:4197 details
hsa-miR-19b-3p details
hsa-miR-19b-3p HMGCS1 3-hydroxy-3-methylglutaryl-CoA synthase 1 HGNC:5007 details
hsa-miR-19b-3p ZNF417 zinc finger protein 417 HGNC:20646 details
hsa-miR-19b-3p ZNF567 zinc finger protein 567 HGNC:28696 details
hsa-miR-19b-3p MRPL19 mitochondrial ribosomal protein L19 HGNC:14052 details
hsa-miR-19b-3p RPA2 replication protein A2 HGNC:10290 details
hsa-miR-19b-3p HOXC8 homeobox C8 HGNC:5129 details
hsa-miR-19b-3p KCTD20 potassium channel tetramerization domain containing 20 HGNC:21052 details
hsa-miR-19b-3p NDEL1 nudE neurodevelopment protein 1 like 1 HGNC:17620 details
hsa-miR-19b-3p THOP1 thimet oligopeptidase 1 HGNC:11793 details
hsa-miR-19b-3p SESTD1 SEC14 and spectrin domain containing 1 HGNC:18379 details
hsa-miR-19b-3p DYNLL2 dynein light chain LC8-type 2 HGNC:24596 details
hsa-miR-19b-3p SMCR8 SMCR8-C9orf72 complex subunit HGNC:17921 details
hsa-miR-19b-3p RASSF1 Ras association domain family member 1 HGNC:9882 details
hsa-miR-19b-3p RAB5B RAB5B, member RAS oncogene family HGNC:9784 details
hsa-miR-19b-3p HHEX hematopoietically expressed homeobox HGNC:4901 details
hsa-miR-19b-3p ELOVL4 ELOVL fatty acid elongase 4 HGNC:14415 details
hsa-miR-19b-3p PALLD palladin, cytoskeletal associated protein HGNC:17068 details
hsa-miR-19b-3p MOSPD2 motile sperm domain containing 2 HGNC:28381 details
hsa-miR-19b-3p ANKRD10 ankyrin repeat domain 10 HGNC:20265 details
hsa-miR-19b-3p RAB34 RAB34, member RAS oncogene family HGNC:16519 details
hsa-miR-19b-3p YTHDC1 YTH domain containing 1 HGNC:30626 details
hsa-miR-19b-3p KATNAL1 katanin catalytic subunit A1 like 1 HGNC:28361 details
hsa-miR-19b-3p NACC2 NACC family member 2 HGNC:23846 details
hsa-miR-19b-3p ARHGAP12 Rho GTPase activating protein 12 HGNC:16348 details
hsa-miR-19b-3p CENPN centromere protein N HGNC:30873 details
hsa-miR-19b-3p PRKACB protein kinase cAMP-activated catalytic subunit beta HGNC:9381 details
hsa-miR-19b-3p LPGAT1 lysophosphatidylglycerol acyltransferase 1 HGNC:28985 details
hsa-miR-19b-3p SIX4 SIX homeobox 4 HGNC:10890 details
hsa-miR-19b-3p SLAIN1 SLAIN motif family member 1 HGNC:26387 details
hsa-miR-19b-3p HIPK1 homeodomain interacting protein kinase 1 HGNC:19006 details
hsa-miR-19b-3p DNAJA2 DnaJ heat shock protein family (Hsp40) member A2 HGNC:14884 details
hsa-miR-19b-3p TRIM2 tripartite motif containing 2 HGNC:15974 details
hsa-miR-19b-3p DMXL2 Dmx like 2 HGNC:2938 details
hsa-miR-19b-3p CCNL1 cyclin L1 HGNC:20569 details
hsa-miR-19b-3p SECISBP2L SECIS binding protein 2 like HGNC:28997 details
hsa-miR-19b-3p PATL1 PAT1 homolog 1, processing body mRNA decay factor HGNC:26721 details
hsa-miR-19b-3p TES testin LIM domain protein HGNC:14620 details
hsa-miR-19b-3p ATM ATM serine/threonine kinase HGNC:795 details
hsa-miR-19b-3p ARL6IP1 ADP ribosylation factor like GTPase 6 interacting protein 1 HGNC:697 details
hsa-miR-19b-3p NR3C1 nuclear receptor subfamily 3 group C member 1 HGNC:7978 details
hsa-miR-19b-3p LRIG3 leucine rich repeats and immunoglobulin like domains 3 HGNC:30991 details
hsa-miR-19b-3p SNAPIN SNAP associated protein HGNC:17145 details
hsa-miR-19b-3p LRP8 LDL receptor related protein 8 HGNC:6700 details
hsa-miR-19b-3p EGLN3 egl-9 family hypoxia inducible factor 3 HGNC:14661 details
hsa-miR-19b-3p XYLT2 xylosyltransferase 2 HGNC:15517 details
hsa-miR-19b-3p details
hsa-miR-19b-3p ADRM1 ADRM1 26S proteasome ubiquitin receptor HGNC:15759 details
hsa-miR-19b-3p NDUFB2 NADH:ubiquinone oxidoreductase subunit B2 HGNC:7697 details
hsa-miR-19b-3p TRPC3 transient receptor potential cation channel subfamily C member 3 HGNC:12335 details
hsa-miR-19b-3p SLC44A1 solute carrier family 44 member 1 HGNC:18798 details
hsa-miR-19b-3p BAHD1 bromo adjacent homology domain containing 1 HGNC:29153 details
hsa-miR-19b-3p SGTB small glutamine rich tetratricopeptide repeat co-chaperone beta HGNC:23567 details
hsa-miR-19b-3p PDZD11 PDZ domain containing 11 HGNC:28034 details
hsa-miR-19b-3p SEC23B SEC23 homolog B, COPII coat complex component HGNC:10702 details
hsa-miR-19b-3p TBC1D4 TBC1 domain family member 4 HGNC:19165 details
hsa-miR-19b-3p TBC1D25 TBC1 domain family member 25 HGNC:8092 details
hsa-miR-19b-3p details
hsa-miR-19b-3p COX10 cytochrome c oxidase assembly factor heme A:farnesyltransferase COX10 HGNC:2260 details
hsa-miR-19b-3p MAPRE3 microtubule associated protein RP/EB family member 3 HGNC:6892 details
hsa-miR-19b-3p details
hsa-miR-19b-3p CDK19 cyclin dependent kinase 19 HGNC:19338 details
hsa-miR-19b-3p KCTD10 potassium channel tetramerization domain containing 10 HGNC:23236 details
hsa-miR-19b-3p PTP4A1 protein tyrosine phosphatase 4A1 HGNC:9634 details
hsa-miR-19b-3p MAP7 microtubule associated protein 7 HGNC:6869 details
hsa-miR-19b-3p CSNK1G1 casein kinase 1 gamma 1 HGNC:2454 details
hsa-miR-19b-3p WDR33 WD repeat domain 33 HGNC:25651 details
hsa-miR-19b-3p PDRG1 p53 and DNA damage regulated 1 HGNC:16119 details
hsa-miR-19b-3p PSMD9 proteasome 26S subunit, non-ATPase 9 HGNC:9567 details
hsa-miR-19b-3p OTUD4 OTU deubiquitinase 4 HGNC:24949 details
hsa-miR-19b-3p ZCCHC14 zinc finger CCHC-type containing 14 HGNC:24134 details
hsa-miR-19b-3p DERL1 derlin 1 HGNC:28454 details
hsa-miR-19b-3p ATP6V1C1 ATPase H+ transporting V1 subunit C1 HGNC:856 details
hsa-miR-19b-3p SMAD4 SMAD family member 4 HGNC:6770 details
hsa-miR-19b-3p TMEM9B TMEM9 domain family member B HGNC:1168 details
hsa-miR-19b-3p ZMYM2 zinc finger MYM-type containing 2 HGNC:12989 details
hsa-miR-19b-3p GMEB2 glucocorticoid modulatory element binding protein 2 HGNC:4371 details
hsa-miR-19b-3p CD46 CD46 molecule HGNC:6953 details
hsa-miR-19b-3p AP3S2 adaptor related protein complex 3 subunit sigma 2 HGNC:571 details
hsa-miR-19b-3p CA13 carbonic anhydrase 13 HGNC:14914 details
hsa-miR-19b-3p MID1IP1 MID1 interacting protein 1 HGNC:20715 details
hsa-miR-19b-3p POGZ pogo transposable element derived with ZNF domain HGNC:18801 details
hsa-miR-19b-3p TRIM59 tripartite motif containing 59 HGNC:30834 details
hsa-miR-19b-3p ABHD5 abhydrolase domain containing 5, lysophosphatidic acid acyltransferase HGNC:21396 details
hsa-miR-19b-3p SLC35D1 solute carrier family 35 member D1 HGNC:20800 details
hsa-miR-19b-3p PPP6R2 protein phosphatase 6 regulatory subunit 2 HGNC:19253 details
hsa-miR-19b-3p PPP1R15B protein phosphatase 1 regulatory subunit 15B HGNC:14951 details
hsa-miR-19b-3p ZNF217 zinc finger protein 217 HGNC:13009 details
hsa-miR-19b-3p ZNF644 zinc finger protein 644 HGNC:29222 details
hsa-miR-19b-3p FBXO28 F-box protein 28 HGNC:29046 details
hsa-miR-19b-3p SOGA1 suppressor of glucose, autophagy associated 1 HGNC:16111 details
hsa-miR-19b-3p MPHOSPH9 M-phase phosphoprotein 9 HGNC:7215 details
hsa-miR-19b-3p ZNF721 zinc finger protein 721 HGNC:29425 details
hsa-miR-19b-3p details
hsa-miR-19b-3p ZNF711 zinc finger protein 711 HGNC:13128 details
hsa-miR-19b-3p MB21D2 Mab-21 domain containing 2 HGNC:30438 details
hsa-miR-19b-3p ROR1 receptor tyrosine kinase like orphan receptor 1 HGNC:10256 details
hsa-miR-19b-3p ENPP5 ectonucleotide pyrophosphatase/phosphodiesterase family member 5 HGNC:13717 details
hsa-miR-19b-3p CLIP1 CAP-Gly domain containing linker protein 1 HGNC:10461 details
hsa-miR-19b-3p HOXA5 homeobox A5 HGNC:5106 details
hsa-miR-19b-3p details
hsa-miR-19b-3p CYP2U1 cytochrome P450 family 2 subfamily U member 1 HGNC:20582 details
hsa-miR-19b-3p CREB3L2 cAMP responsive element binding protein 3 like 2 HGNC:23720 details
hsa-miR-19b-3p MTRR 5-methyltetrahydrofolate-homocysteine methyltransferase reductase HGNC:7473 details
hsa-miR-19b-3p details
hsa-miR-19b-3p WBP1L WW domain binding protein 1 like HGNC:23510 details
hsa-miR-19b-3p STEAP2 STEAP2 metalloreductase HGNC:17885 details
hsa-miR-19b-3p SON SON DNA and RNA binding protein HGNC:11183 details
hsa-miR-19b-3p AGO1 argonaute RISC component 1 HGNC:3262 details
hsa-miR-19b-3p MBNL1 muscleblind like splicing regulator 1 HGNC:6923 details
hsa-miR-19b-3p SLC4A7 solute carrier family 4 member 7 HGNC:11033 details
hsa-miR-19b-3p NFIB nuclear factor I B HGNC:7785 details
hsa-miR-19b-3p LDLR low density lipoprotein receptor HGNC:6547 details
hsa-miR-19b-3p TMEM45A transmembrane protein 45A HGNC:25480 details
hsa-miR-19b-3p CEP350 centrosomal protein 350 HGNC:24238 details
hsa-miR-19b-3p TRIM33 tripartite motif containing 33 HGNC:16290 details
hsa-miR-19b-3p NR3C2 nuclear receptor subfamily 3 group C member 2 HGNC:7979 details
hsa-miR-19b-3p PTPRG protein tyrosine phosphatase receptor type G HGNC:9671 details
hsa-miR-19b-3p FBXO8 F-box protein 8 HGNC:13587 details
hsa-miR-19b-3p RNF145 ring finger protein 145 HGNC:20853 details
hsa-miR-19b-3p ZER1 zyg-11 related cell cycle regulator HGNC:30960 details
hsa-miR-19b-3p ZBTB4 zinc finger and BTB domain containing 4 HGNC:23847 details
hsa-miR-19b-3p SYBU syntabulin HGNC:26011 details
hsa-miR-19b-3p ARRDC3 arrestin domain containing 3 HGNC:29263 details
hsa-miR-19b-3p VPS4B vacuolar protein sorting 4 homolog B HGNC:10895 details
hsa-miR-19b-3p C11orf96 chromosome 11 open reading frame 96 HGNC:38675 details
hsa-miR-19b-3p SEMA4C semaphorin 4C HGNC:10731 details
hsa-miR-19b-3p RAP2C RAP2C, member of RAS oncogene family HGNC:21165 details
hsa-miR-19b-3p MYCN MYCN proto-oncogene, bHLH transcription factor HGNC:7559 details
hsa-miR-19b-3p SLMAP sarcolemma associated protein HGNC:16643 details
hsa-miR-19b-3p SOCS4 suppressor of cytokine signaling 4 HGNC:19392 details
hsa-miR-19b-3p RDH11 retinol dehydrogenase 11 HGNC:17964 details
hsa-miR-19b-3p FYCO1 FYVE and coiled-coil domain autophagy adaptor 1 HGNC:14673 details
hsa-miR-19b-3p ATMIN ATM interactor HGNC:29034 details
hsa-miR-19b-3p details
hsa-miR-19b-3p NCKAP5 NCK associated protein 5 HGNC:29847 details
hsa-miR-19b-3p BTBD3 BTB domain containing 3 HGNC:15854 details
hsa-miR-19b-3p SAMD1 sterile alpha motif domain containing 1 HGNC:17958 details
hsa-miR-19b-3p WBP2 WW domain binding protein 2 HGNC:12738 details
hsa-miR-19b-3p CTR9 CTR9 homolog, Paf1/RNA polymerase II complex component HGNC:16850 details
hsa-miR-19b-3p details
hsa-miR-19b-3p TBC1D13 TBC1 domain family member 13 HGNC:25571 details
hsa-miR-19b-3p GPATCH8 G-patch domain containing 8 HGNC:29066 details
hsa-miR-19b-3p details
hsa-miR-19b-3p HNRNPA1 heterogeneous nuclear ribonucleoprotein A1 HGNC:5031 details
hsa-miR-19b-3p CD2AP CD2 associated protein HGNC:14258 details
hsa-miR-19b-3p SRSF7 serine and arginine rich splicing factor 7 HGNC:10789 details
hsa-miR-19b-3p TCF4 transcription factor 4 HGNC:11634 details
hsa-miR-19b-3p DAAM2 dishevelled associated activator of morphogenesis 2 HGNC:18143 details
hsa-miR-19b-3p HIF1AN hypoxia inducible factor 1 subunit alpha inhibitor HGNC:17113 details
hsa-miR-19b-3p HEG1 heart development protein with EGF like domains 1 HGNC:29227 details
hsa-miR-19b-3p DCAF8 DDB1 and CUL4 associated factor 8 HGNC:24891 details
hsa-miR-19b-3p KLHL21 kelch like family member 21 HGNC:29041 details
hsa-miR-19b-3p HABP4 hyaluronan binding protein 4 HGNC:17062 details
hsa-miR-19b-3p PDE4D phosphodiesterase 4D HGNC:8783 details
hsa-miR-19b-3p details
hsa-miR-19b-3p SAMD8 sterile alpha motif domain containing 8 HGNC:26320 details
hsa-miR-19b-3p LTN1 listerin E3 ubiquitin protein ligase 1 HGNC:13082 details
hsa-miR-19b-3p MBOAT7 membrane bound O-acyltransferase domain containing 7 HGNC:15505 details
hsa-miR-19b-3p RNF41 ring finger protein 41 HGNC:18401 details
hsa-miR-19b-3p ARHGAP1 Rho GTPase activating protein 1 HGNC:673 details
hsa-miR-19b-3p ANKRD52 ankyrin repeat domain 52 HGNC:26614 details
hsa-miR-19b-3p BTBD10 BTB domain containing 10 HGNC:21445 details
hsa-miR-19b-3p ZFAND5 zinc finger AN1-type containing 5 HGNC:13008 details
hsa-miR-19b-3p SPTY2D1 SPT2 chromatin protein domain containing 1 HGNC:26818 details
hsa-miR-19b-3p LBR lamin B receptor HGNC:6518 details
hsa-miR-19b-3p IER3IP1 immediate early response 3 interacting protein 1 HGNC:18550 details
hsa-miR-19b-3p WEE1 WEE1 G2 checkpoint kinase HGNC:12761 details
hsa-miR-19b-3p TOM1L2 target of myb1 like 2 membrane trafficking protein HGNC:11984 details
hsa-miR-19b-3p MEF2D myocyte enhancer factor 2D HGNC:6997 details
hsa-miR-19b-3p USP37 ubiquitin specific peptidase 37 HGNC:20063 details
hsa-miR-19b-3p ACVR1 activin A receptor type 1 HGNC:171 details
hsa-miR-19b-3p SMYD2 SET and MYND domain containing 2 HGNC:20982 details
hsa-miR-19b-3p DCAF7 DDB1 and CUL4 associated factor 7 HGNC:30915 details
hsa-miR-19b-3p MREG melanoregulin HGNC:25478 details
hsa-miR-19b-3p GFOD1 glucose-fructose oxidoreductase domain containing 1 HGNC:21096 details
hsa-miR-19b-3p SEMA6B semaphorin 6B HGNC:10739 details
hsa-miR-19b-3p SERINC3 serine incorporator 3 HGNC:11699 details
hsa-miR-19b-3p RRAS2 RAS related 2 HGNC:17271 details
hsa-miR-19b-3p ESYT1 extended synaptotagmin 1 HGNC:29534 details
hsa-miR-19b-3p EPC1 enhancer of polycomb homolog 1 HGNC:19876 details
hsa-miR-19b-3p WDR26 WD repeat domain 26 HGNC:21208 details
hsa-miR-19b-3p PSAP prosaposin HGNC:9498 details
hsa-miR-19b-3p SEL1L3 SEL1L family member 3 HGNC:29108 details
hsa-miR-19b-3p JARID2 jumonji and AT-rich interaction domain containing 2 HGNC:6196 details
hsa-miR-19b-3p RAB1A RAB1A, member RAS oncogene family HGNC:9758 details
hsa-miR-19b-3p RHEBL1 RHEB like 1 HGNC:21166 details
hsa-miR-19b-3p CREBL2 cAMP responsive element binding protein like 2 HGNC:2350 details
hsa-miR-19b-3p CPPED1 calcineurin like phosphoesterase domain containing 1 HGNC:25632 details
hsa-miR-19b-3p STK38 serine/threonine kinase 38 HGNC:17847 details
hsa-miR-19b-3p DDX6 DEAD-box helicase 6 HGNC:2747 details
hsa-miR-19b-3p SPATA2 spermatogenesis associated 2 HGNC:14681 details
hsa-miR-19b-3p CCND2 cyclin D2 HGNC:1583 details
hsa-miR-19b-3p CNOT6 CCR4-NOT transcription complex subunit 6 HGNC:14099 details
hsa-miR-19b-3p ALG2 ALG2 alpha-1,3/1,6-mannosyltransferase HGNC:23159 details
hsa-miR-19b-3p BLCAP BLCAP apoptosis inducing factor HGNC:1055 details
hsa-miR-19b-3p CNOT4 CCR4-NOT transcription complex subunit 4 HGNC:7880 details
hsa-miR-19b-3p RASSF2 Ras association domain family member 2 HGNC:9883 details
hsa-miR-19b-3p ARHGAP11A Rho GTPase activating protein 11A HGNC:15783 details
hsa-miR-19b-3p VAMP3 vesicle associated membrane protein 3 HGNC:12644 details
hsa-miR-19b-3p PTPN4 protein tyrosine phosphatase non-receptor type 4 HGNC:9656 details
hsa-miR-19b-3p PRUNE2 prune homolog 2 with BCH domain HGNC:25209 details
hsa-miR-19b-3p CPD carboxypeptidase D HGNC:2301 details
hsa-miR-19b-3p FAT3 FAT atypical cadherin 3 HGNC:23112 details
hsa-miR-19b-3p ZNF521 zinc finger protein 521 HGNC:24605 details
hsa-miR-19b-3p CAMSAP1 calmodulin regulated spectrin associated protein 1 HGNC:19946 details
hsa-miR-19b-3p TNRC6B trinucleotide repeat containing adaptor 6B HGNC:29190 details
hsa-miR-19b-3p CGN cingulin HGNC:17429 details
hsa-miR-19b-3p IMPDH1 inosine monophosphate dehydrogenase 1 HGNC:6052 details
hsa-miR-19b-3p SHCBP1 SHC binding and spindle associated 1 HGNC:29547 details
hsa-miR-19b-3p OTUD1 OTU deubiquitinase 1 HGNC:27346 details
hsa-miR-19b-3p details
hsa-miR-19b-3p E2F8 E2F transcription factor 8 HGNC:24727 details
hsa-miR-19b-3p TAF4 TATA-box binding protein associated factor 4 HGNC:11537 details
hsa-miR-19b-3p ATXN7L1 ataxin 7 like 1 HGNC:22210 details
hsa-miR-19b-3p ATF2 activating transcription factor 2 HGNC:784 details
hsa-miR-19b-3p SMARCA2 SWI/SNF related, matrix associated, actin dependent regulator of chromatin, subfamily a, member 2 HGNC:11098 details
hsa-miR-19b-3p RNF11 ring finger protein 11 HGNC:10056 details
hsa-miR-19b-3p LONRF1 LON peptidase N-terminal domain and ring finger 1 HGNC:26302 details
hsa-miR-19b-3p RNF111 ring finger protein 111 HGNC:17384 details
hsa-miR-19b-3p HBP1 HMG-box transcription factor 1 HGNC:23200 details
hsa-miR-19b-3p KLF10 Kruppel like factor 10 HGNC:11810 details
hsa-miR-19b-3p AP2B1 adaptor related protein complex 2 subunit beta 1 HGNC:563 details
hsa-miR-19b-3p TPGS2 tubulin polyglutamylase complex subunit 2 HGNC:24561 details
hsa-miR-19b-3p ZNF507 zinc finger protein 507 HGNC:23783 details
hsa-miR-19b-3p NCBP2 nuclear cap binding protein subunit 2 HGNC:7659 details
hsa-miR-19b-3p ZFHX4 zinc finger homeobox 4 HGNC:30939 details
hsa-miR-19b-3p EIF3L eukaryotic translation initiation factor 3 subunit L HGNC:18138 details
hsa-miR-19b-3p ALAD aminolevulinate dehydratase HGNC:395 details
hsa-miR-19b-3p MRPL32 mitochondrial ribosomal protein L32 HGNC:14035 details
hsa-miR-19b-3p ELOVL5 ELOVL fatty acid elongase 5 HGNC:21308 details
hsa-miR-19b-3p DEGS1 delta 4-desaturase, sphingolipid 1 HGNC:13709 details
hsa-miR-19b-3p TSC22D3 TSC22 domain family member 3 HGNC:3051 details
hsa-miR-19b-3p TMBIM6 transmembrane BAX inhibitor motif containing 6 HGNC:11723 details
hsa-miR-19b-3p NUTF2 nuclear transport factor 2 HGNC:13722 details
hsa-miR-19b-3p RAB21 RAB21, member RAS oncogene family HGNC:18263 details
hsa-miR-19b-3p MXD1 MAX dimerization protein 1 HGNC:6761 details
hsa-miR-19b-3p ZNF800 zinc finger protein 800 HGNC:27267 details
hsa-miR-19b-3p ZNF526 zinc finger protein 526 HGNC:29415 details
hsa-miR-19b-3p ZBTB18 zinc finger and BTB domain containing 18 HGNC:13030 details
hsa-miR-19b-3p ZNF107 zinc finger protein 107 HGNC:12887 details
hsa-miR-19b-3p ZMYND11 zinc finger MYND-type containing 11 HGNC:16966 details
hsa-miR-19b-3p ZDHHC7 zinc finger DHHC-type palmitoyltransferase 7 HGNC:18459 details
hsa-miR-19b-3p ZBTB7B zinc finger and BTB domain containing 7B HGNC:18668 details
hsa-miR-19b-3p XIAP X-linked inhibitor of apoptosis HGNC:592 details
hsa-miR-19b-3p WNT10A Wnt family member 10A HGNC:13829 details
hsa-miR-19b-3p WNK1 WNK lysine deficient protein kinase 1 HGNC:14540 details
hsa-miR-19b-3p WDR20 WD repeat domain 20 HGNC:19667 details
hsa-miR-19b-3p WDR1 WD repeat domain 1 HGNC:12754 details
hsa-miR-19b-3p WAC WW domain containing adaptor with coiled-coil HGNC:17327 details
hsa-miR-19b-3p VPS37B VPS37B subunit of ESCRT-I HGNC:25754 details
hsa-miR-19b-3p VAMP1 vesicle associated membrane protein 1 HGNC:12642 details
hsa-miR-19b-3p TRAK2 trafficking kinesin protein 2 HGNC:13206 details
hsa-miR-19b-3p TP53INP1 tumor protein p53 inducible nuclear protein 1 HGNC:18022 details
hsa-miR-19b-3p TP53 tumor protein p53 HGNC:11998 details
hsa-miR-19b-3p TNPO2 transportin 2 HGNC:19998 details
hsa-miR-19b-3p TNKS tankyrase HGNC:11941 details
hsa-miR-19b-3p TNIP1 TNFAIP3 interacting protein 1 HGNC:16903 details
hsa-miR-19b-3p TNFRSF1B TNF receptor superfamily member 1B HGNC:11917 details
hsa-miR-19b-3p TNFRSF12A TNF receptor superfamily member 12A HGNC:18152 details
hsa-miR-19b-3p TNFAIP3 TNF alpha induced protein 3 HGNC:11896 details
hsa-miR-19b-3p TMEM106B transmembrane protein 106B HGNC:22407 details
hsa-miR-19b-3p TGOLN2 trans-golgi network protein 2 HGNC:15450 details
hsa-miR-19b-3p TFB1M transcription factor B1, mitochondrial HGNC:17037 details
hsa-miR-19b-3p SUZ12 SUZ12 polycomb repressive complex 2 subunit HGNC:17101 details
hsa-miR-19b-3p STX6 syntaxin 6 HGNC:11441 details
hsa-miR-19b-3p STX12 syntaxin 12 HGNC:11430 details
hsa-miR-19b-3p STK4 serine/threonine kinase 4 HGNC:11408 details
hsa-miR-19b-3p SOCS3 suppressor of cytokine signaling 3 HGNC:19391 details
hsa-miR-19b-3p SNX17 sorting nexin 17 HGNC:14979 details
hsa-miR-19b-3p SMG1 SMG1 nonsense mediated mRNA decay associated PI3K related kinase HGNC:30045 details
hsa-miR-19b-3p SMAD5 SMAD family member 5 HGNC:6771 details
hsa-miR-19b-3p SLC9A6 solute carrier family 9 member A6 HGNC:11079 details
hsa-miR-19b-3p SLC9A1 solute carrier family 9 member A1 HGNC:11071 details
hsa-miR-19b-3p SLC38A2 solute carrier family 38 member 2 HGNC:13448 details
hsa-miR-19b-3p SLC37A1 solute carrier family 37 member 1 HGNC:11024 details
hsa-miR-19b-3p SLC30A7 solute carrier family 30 member 7 HGNC:19306 details
hsa-miR-19b-3p SLC27A1 solute carrier family 27 member 1 HGNC:10995 details
hsa-miR-19b-3p SLC25A12 solute carrier family 25 member 12 HGNC:10982 details
hsa-miR-19b-3p SIVA1 SIVA1 apoptosis inducing factor HGNC:17712 details
hsa-miR-19b-3p SH3KBP1 SH3 domain containing kinase binding protein 1 HGNC:13867 details
hsa-miR-19b-3p SGK1 serum/glucocorticoid regulated kinase 1 HGNC:10810 details
hsa-miR-19b-3p SF3B3 splicing factor 3b subunit 3 HGNC:10770 details
hsa-miR-19b-3p SERBP1 SERPINE1 mRNA binding protein 1 HGNC:17860 details
hsa-miR-19b-3p SEPHS2 selenophosphate synthetase 2 HGNC:19686 details
hsa-miR-19b-3p SEL1L SEL1L adaptor subunit of ERAD E3 ubiquitin ligase HGNC:10717 details
hsa-miR-19b-3p SEC63 SEC63 homolog, protein translocation regulator HGNC:21082 details
hsa-miR-19b-3p SEC61A1 SEC61 translocon subunit alpha 1 HGNC:18276 details
hsa-miR-19b-3p SCD stearoyl-CoA desaturase HGNC:10571 details
hsa-miR-19b-3p MSMO1 methylsterol monooxygenase 1 HGNC:10545 details
hsa-miR-19b-3p SBF2 SET binding factor 2 HGNC:2135 details
hsa-miR-19b-3p S1PR2 sphingosine-1-phosphate receptor 2 HGNC:3169 details
hsa-miR-19b-3p RPS4Y1 ribosomal protein S4 Y-linked 1 HGNC:10425 details
hsa-miR-19b-3p RNF216 ring finger protein 216 HGNC:21698 details
hsa-miR-19b-3p RNF167 ring finger protein 167 HGNC:24544 details
hsa-miR-19b-3p RGL1 ral guanine nucleotide dissociation stimulator like 1 HGNC:30281 details
hsa-miR-19b-3p REEP3 receptor accessory protein 3 HGNC:23711 details
hsa-miR-19b-3p RCOR1 REST corepressor 1 HGNC:17441 details
hsa-miR-19b-3p RBM25 RNA binding motif protein 25 HGNC:23244 details
hsa-miR-19b-3p RBBP8 RB binding protein 8, endonuclease HGNC:9891 details
hsa-miR-19b-3p RASSF5 Ras association domain family member 5 HGNC:17609 details
hsa-miR-19b-3p RASA1 RAS p21 protein activator 1 HGNC:9871 details
hsa-miR-19b-3p RAPGEF6 Rap guanine nucleotide exchange factor 6 HGNC:20655 details
hsa-miR-19b-3p RAPGEF4 Rap guanine nucleotide exchange factor 4 HGNC:16626 details
hsa-miR-19b-3p RAPGEF2 Rap guanine nucleotide exchange factor 2 HGNC:16854 details
hsa-miR-19b-3p RAP1A RAP1A, member of RAS oncogene family HGNC:9855 details
hsa-miR-19b-3p RAN RAN, member RAS oncogene family HGNC:9846 details
hsa-miR-19b-3p RAF1 Raf-1 proto-oncogene, serine/threonine kinase HGNC:9829 details
hsa-miR-19b-3p RAB8B RAB8B, member RAS oncogene family HGNC:30273 details
hsa-miR-19b-3p RAB2B RAB2B, member RAS oncogene family HGNC:20246 details
hsa-miR-19b-3p RAB18 RAB18, member RAS oncogene family HGNC:14244 details
hsa-miR-19b-3p RAB14 RAB14, member RAS oncogene family HGNC:16524 details
hsa-miR-19b-3p PPARA peroxisome proliferator activated receptor alpha HGNC:9232 details
hsa-miR-19b-3p PNRC1 proline rich nuclear receptor coactivator 1 HGNC:17278 details
hsa-miR-19b-3p PLXNC1 plexin C1 HGNC:9106 details
hsa-miR-19b-3p PLAU plasminogen activator, urokinase HGNC:9052 details
hsa-miR-19b-3p PIK3R3 phosphoinositide-3-kinase regulatory subunit 3 HGNC:8981 details
hsa-miR-19b-3p PIGS phosphatidylinositol glycan anchor biosynthesis class S HGNC:14937 details
hsa-miR-19b-3p PHF13 PHD finger protein 13 HGNC:22983 details
hsa-miR-19b-3p PGM2L1 phosphoglucomutase 2 like 1 HGNC:20898 details
hsa-miR-19b-3p PGK1 phosphoglycerate kinase 1 HGNC:8896 details
hsa-miR-19b-3p PDE4A phosphodiesterase 4A HGNC:8780 details
hsa-miR-19b-3p PCDH10 protocadherin 10 HGNC:13404 details
hsa-miR-19b-3p PRKN parkin RBR E3 ubiquitin protein ligase HGNC:8607 details
hsa-miR-19b-3p PAICS phosphoribosylaminoimidazole carboxylase and phosphoribosylaminoimidazolesuccinocarboxamide synthase HGNC:8587 details
hsa-miR-19b-3p OTUD7B OTU deubiquitinase 7B HGNC:16683 details
hsa-miR-19b-3p OCRL OCRL inositol polyphosphate-5-phosphatase HGNC:8108 details
hsa-miR-19b-3p NUP54 nucleoporin 54 HGNC:17359 details
hsa-miR-19b-3p NUFIP2 nuclear FMR1 interacting protein 2 HGNC:17634 details
hsa-miR-19b-3p NRBP1 nuclear receptor binding protein 1 HGNC:7993 details
hsa-miR-19b-3p NPTN neuroplastin HGNC:17867 details
hsa-miR-19b-3p NIPA1 NIPA magnesium transporter 1 HGNC:17043 details
hsa-miR-19b-3p NF1 neurofibromin 1 HGNC:7765 details
hsa-miR-19b-3p NAPB NSF attachment protein beta HGNC:15751 details
hsa-miR-19b-3p MTMR12 myotubularin related protein 12 HGNC:18191 details
hsa-miR-19b-3p MLEC malectin HGNC:28973 details
hsa-miR-19b-3p details
hsa-miR-19b-3p MIER1 MIER1 transcriptional regulator HGNC:29657 details
hsa-miR-19b-3p MFSD6 major facilitator superfamily domain containing 6 HGNC:24711 details
hsa-miR-19b-3p MEF2A myocyte enhancer factor 2A HGNC:6993 details
hsa-miR-19b-3p MECP2 methyl-CpG binding protein 2 HGNC:6990 details
hsa-miR-19b-3p MCM3AP-AS1 MCM3AP antisense RNA 1 HGNC:16417 details
hsa-miR-19b-3p MBNL2 muscleblind like splicing regulator 2 HGNC:16746 details
hsa-miR-19b-3p MBD4 methyl-CpG binding domain 4, DNA glycosylase HGNC:6919 details
hsa-miR-19b-3p MAPK14 mitogen-activated protein kinase 14 HGNC:6876 details
hsa-miR-19b-3p MAP3K1 mitogen-activated protein kinase kinase kinase 1 HGNC:6848 details
hsa-miR-19b-3p MAP3K14 mitogen-activated protein kinase kinase kinase 14 HGNC:6853 details
hsa-miR-19b-3p MAP2K3 mitogen-activated protein kinase kinase 3 HGNC:6843 details
hsa-miR-19b-3p MACF1 microtubule actin crosslinking factor 1 HGNC:13664 details
hsa-miR-19b-3p details
hsa-miR-19b-3p LIN9 lin-9 DREAM MuvB core complex component HGNC:30830 details
hsa-miR-19b-3p LCLAT1 lysocardiolipin acyltransferase 1 HGNC:26756 details
hsa-miR-19b-3p KLHL3 kelch like family member 3 HGNC:6354 details
hsa-miR-19b-3p KLHL20 kelch like family member 20 HGNC:25056 details
hsa-miR-19b-3p KLHL42 kelch like family member 42 HGNC:29252 details
hsa-miR-19b-3p KLHDC2 kelch domain containing 2 HGNC:20231 details
hsa-miR-19b-3p KLF13 Kruppel like factor 13 HGNC:13672 details
hsa-miR-19b-3p KIF3A kinesin family member 3A HGNC:6319 details
hsa-miR-19b-3p details
hsa-miR-19b-3p CCSER2 coiled-coil serine rich protein 2 HGNC:29197 details
hsa-miR-19b-3p details
hsa-miR-19b-3p ATG14 autophagy related 14 HGNC:19962 details
hsa-miR-19b-3p ITPR1 inositol 1,4,5-trisphosphate receptor type 1 HGNC:6180 details
hsa-miR-19b-3p INO80 INO80 complex ATPase subunit HGNC:26956 details
hsa-miR-19b-3p IKZF1 IKAROS family zinc finger 1 HGNC:13176 details
hsa-miR-19b-3p HNRNPUL1 heterogeneous nuclear ribonucleoprotein U like 1 HGNC:17011 details
hsa-miR-19b-3p HNRNPU heterogeneous nuclear ribonucleoprotein U HGNC:5048 details
hsa-miR-19b-3p HIC1 HIC ZBTB transcriptional repressor 1 HGNC:4909 details
hsa-miR-19b-3p HECW2 HECT, C2 and WW domain containing E3 ubiquitin protein ligase 2 HGNC:29853 details
hsa-miR-19b-3p HDAC4 histone deacetylase 4 HGNC:14063 details
hsa-miR-19b-3p GRSF1 G-rich RNA sequence binding factor 1 HGNC:4610 details
hsa-miR-19b-3p GPR137B G protein-coupled receptor 137B HGNC:11862 details
hsa-miR-19b-3p GPAM glycerol-3-phosphate acyltransferase, mitochondrial HGNC:24865 details
hsa-miR-19b-3p GMFB glia maturation factor beta HGNC:4373 details
hsa-miR-19b-3p GIT2 GIT ArfGAP 2 HGNC:4273 details
hsa-miR-19b-3p GINS1 GINS complex subunit 1 HGNC:28980 details
hsa-miR-19b-3p GIGYF1 GRB10 interacting GYF protein 1 HGNC:9126 details
hsa-miR-19b-3p GATAD2B GATA zinc finger domain containing 2B HGNC:30778 details
hsa-miR-19b-3p GAK cyclin G associated kinase HGNC:4113 details
hsa-miR-19b-3p FZD6 frizzled class receptor 6 HGNC:4044 details
hsa-miR-19b-3p FXR1 FMR1 autosomal homolog 1 HGNC:4023 details
hsa-miR-19b-3p FRS2 fibroblast growth factor receptor substrate 2 HGNC:16971 details
hsa-miR-19b-3p FRMD6 FERM domain containing 6 HGNC:19839 details
hsa-miR-19b-3p FOXP1 forkhead box P1 HGNC:3823 details
hsa-miR-19b-3p FNDC3A fibronectin type III domain containing 3A HGNC:20296 details
hsa-miR-19b-3p FN3KRP fructosamine 3 kinase related protein HGNC:25700 details
hsa-miR-19b-3p FKBP15 FKBP prolyl isomerase family member 15 HGNC:23397 details
hsa-miR-19b-3p FBXO48 F-box protein 48 HGNC:33857 details
hsa-miR-19b-3p FBXO10 F-box protein 10 HGNC:13589 details
hsa-miR-19b-3p FAS Fas cell surface death receptor HGNC:11920 details
hsa-miR-19b-3p FAM83D family with sequence similarity 83 member D HGNC:16122 details
hsa-miR-19b-3p MIGA1 mitoguardin 1 HGNC:24741 details
hsa-miR-19b-3p details
hsa-miR-19b-3p DENND6A DENN domain containing 6A HGNC:26635 details
hsa-miR-19b-3p ABHD17C abhydrolase domain containing 17C, depalmitoylase HGNC:26925 details
hsa-miR-19b-3p FAM102A family with sequence similarity 102 member A HGNC:31419 details
hsa-miR-19b-3p EXOC7 exocyst complex component 7 HGNC:23214 details
hsa-miR-19b-3p EVI5L ecotropic viral integration site 5 like HGNC:30464 details
hsa-miR-19b-3p EPS15 epidermal growth factor receptor pathway substrate 15 HGNC:3419 details
hsa-miR-19b-3p EPN2 epsin 2 HGNC:18639 details
hsa-miR-19b-3p ENPP4 ectonucleotide pyrophosphatase/phosphodiesterase 4 HGNC:3359 details
hsa-miR-19b-3p ELMOD2 ELMO domain containing 2 HGNC:28111 details
hsa-miR-19b-3p EIF4E2 eukaryotic translation initiation factor 4E family member 2 HGNC:3293 details
hsa-miR-19b-3p EHD1 EH domain containing 1 HGNC:3242 details
hsa-miR-19b-3p EFR3A EFR3 homolog A HGNC:28970 details
hsa-miR-19b-3p DUT deoxyuridine triphosphatase HGNC:3078 details
hsa-miR-19b-3p details
hsa-miR-19b-3p DHX40 DEAH-box helicase 40 HGNC:18018 details
hsa-miR-19b-3p DEF8 differentially expressed in FDCP 8 homolog HGNC:25969 details
hsa-miR-19b-3p DDX3Y DEAD-box helicase 3 Y-linked HGNC:2699 details
hsa-miR-19b-3p DCP2 decapping mRNA 2 HGNC:24452 details
hsa-miR-19b-3p DAD1 defender against cell death 1 HGNC:2664 details
hsa-miR-19b-3p COQ10B coenzyme Q10B HGNC:25819 details
hsa-miR-19b-3p CNOT7 CCR4-NOT transcription complex subunit 7 HGNC:14101 details
hsa-miR-19b-3p CLOCK clock circadian regulator HGNC:2082 details
hsa-miR-19b-3p CLIC4 chloride intracellular channel 4 HGNC:13518 details
hsa-miR-19b-3p CIT citron rho-interacting serine/threonine kinase HGNC:1985 details
hsa-miR-19b-3p CHEK1 checkpoint kinase 1 HGNC:1925 details
hsa-miR-19b-3p CHD9 chromodomain helicase DNA binding protein 9 HGNC:25701 details
hsa-miR-19b-3p CCNT2 cyclin T2 HGNC:1600 details
hsa-miR-19b-3p CCNA2 cyclin A2 HGNC:1578 details
hsa-miR-19b-3p CCDC137 coiled-coil domain containing 137 HGNC:33451 details
hsa-miR-19b-3p CC2D1A coiled-coil and C2 domain containing 1A HGNC:30237 details
hsa-miR-19b-3p CBX7 chromobox 7 HGNC:1557 details
hsa-miR-19b-3p CBX5 chromobox 5 HGNC:1555 details
hsa-miR-19b-3p CAMTA1 calmodulin binding transcription activator 1 HGNC:18806 details
hsa-miR-19b-3p CAMSAP2 calmodulin regulated spectrin associated protein family member 2 HGNC:29188 details
hsa-miR-19b-3p CAB39 calcium binding protein 39 HGNC:20292 details
hsa-miR-19b-3p IDNK IDNK gluconokinase HGNC:31367 details
hsa-miR-19b-3p C5orf51 chromosome 5 open reading frame 51 HGNC:27750 details
hsa-miR-19b-3p details
hsa-miR-19b-3p C5orf24 chromosome 5 open reading frame 24 HGNC:26746 details
hsa-miR-19b-3p C2orf42 chromosome 2 open reading frame 42 HGNC:26056 details
hsa-miR-19b-3p PRR14L proline rich 14 like HGNC:28738 details
hsa-miR-19b-3p SDE2 SDE2 telomere maintenance homolog HGNC:26643 details
hsa-miR-19b-3p ARPIN actin related protein 2/3 complex inhibitor HGNC:28782 details
hsa-miR-19b-3p SPTSSA serine palmitoyltransferase small subunit A HGNC:20361 details
hsa-miR-19b-3p GSKIP GSK3B interacting protein HGNC:20343 details
hsa-miR-19b-3p details
hsa-miR-19b-3p BTF3L4 basic transcription factor 3 like 4 HGNC:30547 details
hsa-miR-19b-3p BTBD7 BTB domain containing 7 HGNC:18269 details
hsa-miR-19b-3p BRD9 bromodomain containing 9 HGNC:25818 details
hsa-miR-19b-3p BEND3 BEN domain containing 3 HGNC:23040 details
hsa-miR-19b-3p BCL7B BAF chromatin remodeling complex subunit BCL7B HGNC:1005 details
hsa-miR-19b-3p BCL7A BAF chromatin remodeling complex subunit BCL7A HGNC:1004 details
hsa-miR-19b-3p BCL3 BCL3 transcription coactivator HGNC:998 details
hsa-miR-19b-3p B4GALT1 beta-1,4-galactosyltransferase 1 HGNC:924 details
hsa-miR-19b-3p AZIN1 antizyme inhibitor 1 HGNC:16432 details
hsa-miR-19b-3p ATXN7 ataxin 7 HGNC:10560 details
hsa-miR-19b-3p ATPAF1 ATP synthase mitochondrial F1 complex assembly factor 1 HGNC:18803 details
hsa-miR-19b-3p ATP6V1B2 ATPase H+ transporting V1 subunit B2 HGNC:854 details
hsa-miR-19b-3p ATP6V0E1 ATPase H+ transporting V0 subunit e1 HGNC:863 details
hsa-miR-19b-3p ATG5 autophagy related 5 HGNC:589 details
hsa-miR-19b-3p ATG2B autophagy related 2B HGNC:20187 details
hsa-miR-19b-3p ATG16L1 autophagy related 16 like 1 HGNC:21498 details
hsa-miR-19b-3p details
hsa-miR-19b-3p ARPP19 cAMP regulated phosphoprotein 19 HGNC:16967 details
hsa-miR-19b-3p ARMC8 armadillo repeat containing 8 HGNC:24999 details
hsa-miR-19b-3p ARL8A ADP ribosylation factor like GTPase 8A HGNC:25192 details
hsa-miR-19b-3p ARFGEF1 ADP ribosylation factor guanine nucleotide exchange factor 1 HGNC:15772 details
hsa-miR-19b-3p ARAP2 ArfGAP with RhoGAP domain, ankyrin repeat and PH domain 2 HGNC:16924 details
hsa-miR-19b-3p ANKRD12 ankyrin repeat domain 12 HGNC:29135 details
hsa-miR-19b-3p ANKIB1 ankyrin repeat and IBR domain containing 1 HGNC:22215 details
hsa-miR-19b-3p ANGEL2 angel homolog 2 HGNC:30534 details
hsa-miR-19b-3p AMMECR1L AMMECR1 like HGNC:28658 details
hsa-miR-19b-3p AHDC1 AT-hook DNA binding motif containing 1 HGNC:25230 details
hsa-miR-19b-3p AFTPH aftiphilin HGNC:25951 details
hsa-miR-19b-3p AFF1 AF4/FMR2 family member 1 HGNC:7135 details
hsa-miR-19b-3p details
hsa-miR-19b-3p ADIPOR2 adiponectin receptor 2 HGNC:24041 details
hsa-miR-19b-3p ACSL4 acyl-CoA synthetase long chain family member 4 HGNC:3571 details
hsa-miR-19b-3p ACBD5 acyl-CoA binding domain containing 5 HGNC:23338 details
hsa-miR-19b-3p POLI DNA polymerase iota HGNC:9182 details
hsa-miR-19b-3p details
hsa-miR-19b-3p details
hsa-miR-19b-3p details
hsa-miR-19b-3p PTPRB protein tyrosine phosphatase receptor type B HGNC:9665 details
hsa-miR-19b-3p TNFRSF10B TNF receptor superfamily member 10b HGNC:11905 details
hsa-miR-19b-3p ZFYVE9 zinc finger FYVE-type containing 9 HGNC:6775 details
hsa-miR-19b-3p YY1 YY1 transcription factor HGNC:12856 details
hsa-miR-19b-3p WNT7B Wnt family member 7B HGNC:12787 details
hsa-miR-19b-3p TNRC6A trinucleotide repeat containing adaptor 6A HGNC:11969 details
hsa-miR-19b-3p TMOD3 tropomodulin 3 HGNC:11873 details
hsa-miR-19b-3p THBS1 thrombospondin 1 HGNC:11785 details
hsa-miR-19b-3p STX16 syntaxin 16 HGNC:11431 details
hsa-miR-19b-3p RHOB ras homolog family member B HGNC:668 details
hsa-miR-19b-3p PPP6R1 protein phosphatase 6 regulatory subunit 1 HGNC:29195 details
hsa-miR-19b-3p NACC1 nucleus accumbens associated 1 HGNC:20967 details
hsa-miR-19b-3p MTMR6 myotubularin related protein 6 HGNC:7453 details
hsa-miR-19b-3p MLLT10 MLLT10 histone lysine methyltransferase DOT1L cofactor HGNC:16063 details
hsa-miR-19b-3p MAP3K9 mitogen-activated protein kinase kinase kinase 9 HGNC:6861 details
hsa-miR-19b-3p KLHL11 kelch like family member 11 HGNC:19008 details
hsa-miR-19b-3p KIF13A kinesin family member 13A HGNC:14566 details
hsa-miR-19b-3p IMPDH1P11 inosine monophosphate dehydrogenase 1 pseudogene 11 HGNC:6054 details
hsa-miR-19b-3p FBLIM1 filamin binding LIM protein 1 HGNC:24686 details
hsa-miR-19b-3p MIGA2 mitoguardin 2 HGNC:23621 details
hsa-miR-19b-3p EOGT EGF domain specific O-linked N-acetylglucosamine transferase HGNC:28526 details
hsa-miR-19b-3p ELL2 elongation factor for RNA polymerase II 2 HGNC:17064 details
hsa-miR-19b-3p DLG5 discs large MAGUK scaffold protein 5 HGNC:2904 details
hsa-miR-19b-3p CD164 CD164 molecule HGNC:1632 details
hsa-miR-19b-3p CAPRIN2 caprin family member 2 HGNC:21259 details
hsa-miR-19b-3p ANKRD50 ankyrin repeat domain 50 HGNC:29223 details
hsa-miR-19b-3p AGPAT5 1-acylglycerol-3-phosphate O-acyltransferase 5 HGNC:20886 details
hsa-miR-19b-3p ACTB actin beta HGNC:132 details
hsa-miR-19b-3p ABHD14B abhydrolase domain containing 14B HGNC:28235 details
hsa-miR-19b-3p YTHDF1 YTH N6-methyladenosine RNA binding protein 1 HGNC:15867 details
hsa-miR-19b-3p ZFYVE26 zinc finger FYVE-type containing 26 HGNC:20761 details
hsa-miR-19b-3p SOX4 SRY-box transcription factor 4 HGNC:11200 details
hsa-miR-19b-3p FOXQ1 forkhead box Q1 HGNC:20951 details
hsa-miR-19b-3p DICER1 dicer 1, ribonuclease III HGNC:17098 details
hsa-miR-19b-3p WDR45B WD repeat domain 45B HGNC:25072 details
hsa-miR-19b-3p SLC48A1 solute carrier family 48 member 1 HGNC:26035 details
hsa-miR-19b-3p MMGT1 membrane magnesium transporter 1 HGNC:28100 details
hsa-miR-19b-3p BRWD3 bromodomain and WD repeat domain containing 3 HGNC:17342 details
hsa-miR-19b-3p NICN1 nicolin 1 HGNC:18317 details
hsa-miR-19b-3p NUS1 NUS1 dehydrodolichyl diphosphate synthase subunit HGNC:21042 details
hsa-miR-19b-3p PTBP2 polypyrimidine tract binding protein 2 HGNC:17662 details
hsa-miR-19b-3p ZMAT3 zinc finger matrin-type 3 HGNC:29983 details
hsa-miR-19b-3p TRIM37 tripartite motif containing 37 HGNC:7523 details
hsa-miR-19b-3p SKIL SKI like proto-oncogene HGNC:10897 details
hsa-miR-19b-3p RNF44 ring finger protein 44 HGNC:19180 details
hsa-miR-19b-3p PLEKHF2 pleckstrin homology and FYVE domain containing 2 HGNC:20757 details
hsa-miR-19b-3p PHLDA3 pleckstrin homology like domain family A member 3 HGNC:8934 details
hsa-miR-19b-3p NRBF2 nuclear receptor binding factor 2 HGNC:19692 details
hsa-miR-19b-3p MAPK1 mitogen-activated protein kinase 1 HGNC:6871 details
hsa-miR-19b-3p G3BP2 G3BP stress granule assembly factor 2 HGNC:30291 details
hsa-miR-19b-3p ZNF154 zinc finger protein 154 HGNC:12939 details
hsa-miR-19b-3p SLC46A1 solute carrier family 46 member 1 HGNC:30521 details
hsa-miR-19b-3p ERCC4 ERCC excision repair 4, endonuclease catalytic subunit HGNC:3436 details
hsa-miR-19b-3p UBN2 ubinuclein 2 HGNC:21931 details
hsa-miR-19b-3p UBE2D3 ubiquitin conjugating enzyme E2 D3 HGNC:12476 details
hsa-miR-19b-3p SESN3 sestrin 3 HGNC:23060 details
hsa-miR-19b-3p SATB1 SATB homeobox 1 HGNC:10541 details
hsa-miR-19b-3p QKI QKI, KH domain containing RNA binding HGNC:21100 details
hsa-miR-19b-3p MOB1B MOB kinase activator 1B HGNC:29801 details
hsa-miR-19b-3p MED12L mediator complex subunit 12L HGNC:16050 details
hsa-miR-19b-3p LZIC leucine zipper and CTNNBIP1 domain containing HGNC:17497 details
hsa-miR-19b-3p LMLN leishmanolysin like peptidase HGNC:15991 details
hsa-miR-19b-3p EIF4A2 eukaryotic translation initiation factor 4A2 HGNC:3284 details
hsa-miR-19b-3p details
hsa-miR-19b-3p AKAP2 A-kinase anchoring protein 2 HGNC:372 details
hsa-miR-19b-3p MCRIP2 MAPK regulated corepressor interacting protein 2 HGNC:14142 details
hsa-miR-19b-3p USP8 ubiquitin specific peptidase 8 HGNC:12631 details
hsa-miR-19b-3p SPART spartin HGNC:18514 details
hsa-miR-19b-3p PPTC7 protein phosphatase targeting COQ7 HGNC:30695 details
hsa-miR-19b-3p PFN2 profilin 2 HGNC:8882 details
hsa-miR-19b-3p MRPL17 mitochondrial ribosomal protein L17 HGNC:14053 details
hsa-miR-19b-3p DCC DCC netrin 1 receptor HGNC:2701 details
hsa-miR-19b-3p ZNF134 zinc finger protein 134 HGNC:12918 details
hsa-miR-19b-3p RBM20 RNA binding motif protein 20 HGNC:27424 details
hsa-miR-19b-3p RAP1B RAP1B, member of RAS oncogene family HGNC:9857 details
hsa-miR-19b-3p GRB10 growth factor receptor bound protein 10 HGNC:4564 details
hsa-miR-19b-3p DDX3X DEAD-box helicase 3 X-linked HGNC:2745 details
hsa-miR-19b-3p ZBTB47 zinc finger and BTB domain containing 47 HGNC:26955 details
hsa-miR-19b-3p TBRG1 transforming growth factor beta regulator 1 HGNC:29551 details
hsa-miR-19b-3p RRAGD Ras related GTP binding D HGNC:19903 details
hsa-miR-19b-3p KPNA6 karyopherin subunit alpha 6 HGNC:6399 details
hsa-miR-19b-3p CEP170 centrosomal protein 170 HGNC:28920 details
hsa-miR-19b-3p MALT1 MALT1 paracaspase HGNC:6819 details
hsa-miR-19b-3p HADHB hydroxyacyl-CoA dehydrogenase trifunctional multienzyme complex subunit beta HGNC:4803 details
hsa-miR-19b-3p TMEM64 transmembrane protein 64 HGNC:25441 details
hsa-miR-19b-3p TGIF1 TGFB induced factor homeobox 1 HGNC:11776 details
hsa-miR-19b-3p SLC12A7 solute carrier family 12 member 7 HGNC:10915 details
hsa-miR-19b-3p PFN1 profilin 1 HGNC:8881 details
hsa-miR-19b-3p PAFAH1B2 platelet activating factor acetylhydrolase 1b catalytic subunit 2 HGNC:8575 details
hsa-miR-19b-3p DGKH diacylglycerol kinase eta HGNC:2854 details
hsa-miR-19b-3p ZNF367 zinc finger protein 367 HGNC:18320 details
hsa-miR-19b-3p TNFRSF11A TNF receptor superfamily member 11a HGNC:11908 details
hsa-miR-19b-3p TMEM117 transmembrane protein 117 HGNC:25308 details
hsa-miR-19b-3p RPF2 ribosome production factor 2 homolog HGNC:20870 details
hsa-miR-19b-3p NDRG1 N-myc downstream regulated 1 HGNC:7679 details
hsa-miR-19b-3p MFF mitochondrial fission factor HGNC:24858 details
hsa-miR-19b-3p ZNF772 zinc finger protein 772 HGNC:33106 details
hsa-miR-19b-3p WBP4 WW domain binding protein 4 HGNC:12739 details
hsa-miR-19b-3p USP13 ubiquitin specific peptidase 13 HGNC:12611 details
hsa-miR-19b-3p STOX2 storkhead box 2 HGNC:25450 details
hsa-miR-19b-3p SNX5 sorting nexin 5 HGNC:14969 details
hsa-miR-19b-3p SMOC1 SPARC related modular calcium binding 1 HGNC:20318 details
hsa-miR-19b-3p SLC6A8 solute carrier family 6 member 8 HGNC:11055 details
hsa-miR-19b-3p RORA RAR related orphan receptor A HGNC:10258 details
hsa-miR-19b-3p RLIM ring finger protein, LIM domain interacting HGNC:13429 details
hsa-miR-19b-3p SFTPA1 surfactant protein A1 HGNC:10798 details
hsa-miR-19b-3p MBNL3 muscleblind like splicing regulator 3 HGNC:20564 details
hsa-miR-19b-3p GFPT1 glutamine--fructose-6-phosphate transaminase 1 HGNC:4241 details
hsa-miR-19b-3p DCUN1D3 defective in cullin neddylation 1 domain containing 3 HGNC:28734 details
hsa-miR-19b-3p CREBRF CREB3 regulatory factor HGNC:24050 details
hsa-miR-19b-3p CERCAM cerebral endothelial cell adhesion molecule HGNC:23723 details
hsa-miR-19b-3p CEP55 centrosomal protein 55 HGNC:1161 details
hsa-miR-19b-3p CHEK2 checkpoint kinase 2 HGNC:16627 details
hsa-miR-19b-3p CASZ1 castor zinc finger 1 HGNC:26002 details
hsa-miR-19b-3p CALM1 calmodulin 1 HGNC:1442 details
hsa-miR-19b-3p BRWD1 bromodomain and WD repeat domain containing 1 HGNC:12760 details
hsa-miR-19b-3p BMP3 bone morphogenetic protein 3 HGNC:1070 details
hsa-miR-19b-3p ARC activity regulated cytoskeleton associated protein HGNC:648 details
hsa-miR-19b-3p ZNF138 zinc finger protein 138 HGNC:12922 details
hsa-miR-19b-3p MAVS mitochondrial antiviral signaling protein HGNC:29233 details
hsa-miR-19b-3p DSN1 DSN1 component of MIS12 kinetochore complex HGNC:16165 details
hsa-miR-19b-3p RBM38 RNA binding motif protein 38 HGNC:15818 details
hsa-miR-19b-3p TMEM138 transmembrane protein 138 HGNC:26944 details
hsa-miR-19b-3p ALG1 ALG1 chitobiosyldiphosphodolichol beta-mannosyltransferase HGNC:18294 details
hsa-miR-19b-3p CBY1 chibby family member 1, beta catenin antagonist HGNC:1307 details
hsa-miR-19b-3p ZIC5 Zic family member 5 HGNC:20322 details
hsa-miR-19b-3p WNK3 WNK lysine deficient protein kinase 3 HGNC:14543 details
hsa-miR-19b-3p WASL WASP like actin nucleation promoting factor HGNC:12735 details
hsa-miR-19b-3p VPS37A VPS37A subunit of ESCRT-I HGNC:24928 details
hsa-miR-19b-3p UBE2A ubiquitin conjugating enzyme E2 A HGNC:12472 details
hsa-miR-19b-3p TXLNG taxilin gamma HGNC:18578 details
hsa-miR-19b-3p SOX6 SRY-box transcription factor 6 HGNC:16421 details
hsa-miR-19b-3p SLC7A11 solute carrier family 7 member 11 HGNC:11059 details
hsa-miR-19b-3p PURG purine rich element binding protein G HGNC:17930 details
hsa-miR-19b-3p PRICKLE2 prickle planar cell polarity protein 2 HGNC:20340 details
hsa-miR-19b-3p NFATC2IP nuclear factor of activated T cells 2 interacting protein HGNC:25906 details
hsa-miR-19b-3p MPRIP myosin phosphatase Rho interacting protein HGNC:30321 details
hsa-miR-19b-3p MCC MCC regulator of WNT signaling pathway HGNC:6935 details
hsa-miR-19b-3p JAZF1 JAZF zinc finger 1 HGNC:28917 details
hsa-miR-19b-3p ITGA2 integrin subunit alpha 2 HGNC:6137 details
hsa-miR-19b-3p HNRNPF heterogeneous nuclear ribonucleoprotein F HGNC:5039 details
hsa-miR-19b-3p GNPTAB N-acetylglucosamine-1-phosphate transferase subunits alpha and beta HGNC:29670 details
hsa-miR-19b-3p DYNC1LI2 dynein cytoplasmic 1 light intermediate chain 2 HGNC:2966 details
hsa-miR-19b-3p DEPDC1 DEP domain containing 1 HGNC:22949 details
hsa-miR-19b-3p DBN1 drebrin 1 HGNC:2695 details
hsa-miR-19b-3p CFL2 cofilin 2 HGNC:1875 details
hsa-miR-19b-3p GDNF glial cell derived neurotrophic factor HGNC:4232 details
hsa-miR-19b-3p ARHGEF26 Rho guanine nucleotide exchange factor 26 HGNC:24490 details
hsa-miR-19b-3p AGO3 argonaute RISC catalytic component 3 HGNC:18421 details
hsa-miR-19b-3p ZNF680 zinc finger protein 680 HGNC:26897 details
hsa-miR-19b-3p ZDHHC18 zinc finger DHHC-type palmitoyltransferase 18 HGNC:20712 details
hsa-miR-19b-3p PABPC4L poly(A) binding protein cytoplasmic 4 like HGNC:31955 details
hsa-miR-19b-3p details
hsa-miR-19b-3p CLVS2 clavesin 2 HGNC:23046 details
hsa-miR-19b-3p CCDC80 coiled-coil domain containing 80 HGNC:30649 details
hsa-miR-19b-3p ZNF544 zinc finger protein 544 HGNC:16759 details
hsa-miR-19b-3p RACGAP1 Rac GTPase activating protein 1 HGNC:9804 details
hsa-miR-19b-3p PRRG4 proline rich and Gla domain 4 HGNC:30799 details
hsa-miR-19b-3p KCNJ2 potassium inwardly rectifying channel subfamily J member 2 HGNC:6263 details
hsa-miR-19b-3p details
hsa-miR-19b-3p HPRT1 hypoxanthine phosphoribosyltransferase 1 HGNC:5157 details
hsa-miR-19b-3p details
hsa-miR-19b-3p NFIA nuclear factor I A HGNC:7784 details
hsa-miR-19b-3p HOMER1 homer scaffold protein 1 HGNC:17512 details
hsa-miR-19b-3p ODF4 outer dense fiber of sperm tails 4 HGNC:19056 details
hsa-miR-19b-3p MBD3 methyl-CpG binding domain protein 3 HGNC:6918 details
hsa-miR-19b-3p MTX3 metaxin 3 HGNC:24812 details
hsa-miR-19b-3p PTCD2 pentatricopeptide repeat domain 2 HGNC:25734 details
hsa-miR-19b-3p ETV3 ETS variant transcription factor 3 HGNC:3492 details
hsa-miR-19b-3p C6orf132 chromosome 6 open reading frame 132 HGNC:21288 details
hsa-miR-19b-3p DIP2A disco interacting protein 2 homolog A HGNC:17217 details
hsa-miR-19b-3p MTHFD1 methylenetetrahydrofolate dehydrogenase, cyclohydrolase and formyltetrahydrofolate synthetase 1 HGNC:7432 details
hsa-miR-19b-3p UBL3 ubiquitin like 3 HGNC:12504 details
hsa-miR-19b-3p details
hsa-miR-19b-3p STAT5B signal transducer and activator of transcription 5B HGNC:11367 details
hsa-miR-19b-3p KITLG KIT ligand HGNC:6343 details
hsa-miR-19b-3p BTG1 BTG anti-proliferation factor 1 HGNC:1130 details
hsa-miR-19b-3p BAMBI BMP and activin membrane bound inhibitor HGNC:30251 details
hsa-miR-19b-3p TMTC1 transmembrane O-mannosyltransferase targeting cadherins 1 HGNC:24099 details
hsa-miR-19b-3p CHERP calcium homeostasis endoplasmic reticulum protein HGNC:16930 details
hsa-miR-19b-3p DNMT1 DNA methyltransferase 1 HGNC:2976 details
hsa-miR-19b-3p ARHGEF28 Rho guanine nucleotide exchange factor 28 HGNC:30322 details
hsa-miR-19b-3p PSG4 pregnancy specific beta-1-glycoprotein 4 HGNC:9521 details
hsa-miR-19b-3p PIWIL4 piwi like RNA-mediated gene silencing 4 HGNC:18444 details
hsa-miR-19b-3p USP34 ubiquitin specific peptidase 34 HGNC:20066 details
hsa-miR-19b-3p TTC9C tetratricopeptide repeat domain 9C HGNC:28432 details
hsa-miR-19b-3p details
hsa-miR-19b-3p ALKBH6 alkB homolog 6 HGNC:28243 details
hsa-miR-19b-3p KAT2A lysine acetyltransferase 2A HGNC:4201 details
hsa-miR-19b-3p GRK4 G protein-coupled receptor kinase 4 HGNC:4543 details
hsa-miR-19b-3p ESRRB estrogen related receptor beta HGNC:3473 details
hsa-miR-19b-3p SGSM3 small G protein signaling modulator 3 HGNC:25228 details
hsa-miR-19b-3p RNASE1 ribonuclease A family member 1, pancreatic HGNC:10044 details
hsa-miR-19b-3p ST13 ST13 Hsp70 interacting protein HGNC:11343 details
hsa-miR-19b-3p WDFY2 WD repeat and FYVE domain containing 2 HGNC:20482 details
hsa-miR-19b-3p ABCA2 ATP binding cassette subfamily A member 2 HGNC:32 details
hsa-miR-19b-3p BTN2A2 butyrophilin subfamily 2 member A2 HGNC:1137 details
hsa-miR-19b-3p REM1 RRAD and GEM like GTPase 1 HGNC:15922 details
hsa-miR-19b-3p SWT1 SWT1 RNA endoribonuclease homolog HGNC:16785 details
hsa-miR-19b-3p SIRPB2 signal regulatory protein beta 2 HGNC:16247 details
hsa-miR-19b-3p MED28 mediator complex subunit 28 HGNC:24628 details
hsa-miR-19b-3p TMEM107 transmembrane protein 107 HGNC:28128 details
hsa-miR-19b-3p CASQ1 calsequestrin 1 HGNC:1512 details
hsa-miR-19b-3p FAM218A family with sequence similarity 218 member A HGNC:26466 details
hsa-miR-19b-3p NDFIP1 Nedd4 family interacting protein 1 HGNC:17592 details
hsa-miR-19b-3p MYBL2 MYB proto-oncogene like 2 HGNC:7548 details
hsa-miR-19b-3p TGFB1 transforming growth factor beta 1 HGNC:11766 details
hsa-miR-19b-3p CREB1 cAMP responsive element binding protein 1 HGNC:2345 details
hsa-miR-19b-3p PTENP1 phosphatase and tensin homolog pseudogene 1 HGNC:9589 details
hsa-miR-19b-3p PKNOX1 PBX/knotted 1 homeobox 1 HGNC:9022 details
hsa-miR-19b-3p MTUS1 microtubule associated scaffold protein 1 HGNC:29789 details
hsa-miR-19b-3p PITX1 paired like homeodomain 1 HGNC:9004 details
hsa-miR-19b-3p CSNK2A1 casein kinase 2 alpha 1 HGNC:2457 details
hsa-miR-19b-3p DCBLD2 discoidin, CUB and LCCL domain containing 2 HGNC:24627 details
hsa-miR-19b-3p EREG epiregulin HGNC:3443 details
hsa-miR-19b-3p PHLDA1 pleckstrin homology like domain family A member 1 HGNC:8933 details
hsa-miR-19b-3p PKM pyruvate kinase M1/2 HGNC:9021 details
hsa-miR-19b-3p B3GALNT2 beta-1,3-N-acetylgalactosaminyltransferase 2 HGNC:28596 details
hsa-miR-19b-3p DSEL dermatan sulfate epimerase like HGNC:18144 details
hsa-miR-19b-3p IFITM1 interferon induced transmembrane protein 1 HGNC:5412 details
hsa-miR-19b-3p TPRG1L tumor protein p63 regulated 1 like HGNC:27007 details
hsa-miR-19b-3p ZNF423 zinc finger protein 423 HGNC:16762 details
hsa-miR-19b-3p RPAP2 RNA polymerase II associated protein 2 HGNC:25791 details
hsa-miR-19b-3p ZNF618 zinc finger protein 618 HGNC:29416 details
© 2021 Arieh Warshel Institute of Computational Biology, CUHK(SZ) | Designed by : Biomics Lab