miRNA Card

miRNA General Information
miRNA ID hsa-miR-203a-3p
Description Homo sapiens miR-203a stem-loop
Comment This human miRNA was predicted by computational methods using conservation with mouse and Fugu rubripes sequences [1]. Expression of the excised miR has been validated in zebrafish, and the ends mapped by cloning. Landgraf et al. confirm expression in human [2].
Experiment cloned [2]
Sequence GUGAAAUGUUUAGGACCACUAG
miRNA Expression in different cancers

    by mir_boxplot.py

circRNA-miRNA-gene regulatory network

Note about Netwrok:
This is a network diagram with miRNA (purple circle) as the center.
We used three tools(PITA, miRanda, targetScan) to predict the binding sites of circrna (green circle) and miRNA. Accordingly, for this miRNA that binds to circrna, we have three confidence levels, namely confident 1, confident 2 and confident 3. Confidence value indicates how many tools can deduce these results. For each confidence, we use different kinds of dashed lines.

Target circRNA with confidence

Confidence 3 (3 of 3 tools predicted)

CircID miRNA PITA miRanda targetScan
chr11:126010341|126015510 hsa-miR-203a-3p 1 1 1
chr13:46227512|46234349 hsa-miR-203a-3p 1 1 1

Confidence 2 (2 of 3 tools predicted)

Confidence 1 (1 of 3 tools predicted)

CircID miRNA PITA miRanda targetScan
chr7:17794154|17794250 hsa-miR-203a-3p 0 1 0
chr11:78072998|78073072 hsa-miR-203a-3p 0 1 0
chr13:77011944|77012128 hsa-miR-203a-3p 0 1 0
chr2:73730992|73731130 hsa-miR-203a-3p 0 1 0
chr3:44408600|44408768 hsa-miR-203a-3p 0 1 0
chr2:73730992|73731095 hsa-miR-203a-3p 0 1 0
chr17:67912947|67913101 hsa-miR-203a-3p 0 1 0
chr6:42937750|42938130 hsa-miR-203a-3p 0 1 0
chr16:18815223|18815516 hsa-miR-203a-3p 0 1 0
chr20:32309844|32310036 hsa-miR-203a-3p 0 1 0
chr8:23225805|23226123 hsa-miR-203a-3p 0 1 0
chr15:34090317|34090421 hsa-miR-203a-3p 0 1 0
chr2:1633499|1633599 hsa-miR-203a-3p 0 1 0
chr11:76658979|76659116 hsa-miR-203a-3p 0 1 0
chr4:77166123|77166273 hsa-miR-203a-3p 1 0 0
chr7:26498173|26498247 hsa-miR-203a-3p 1 0 0
chr3:156451673|156451733 hsa-miR-203a-3p 0 1 0
chr12:11893905|11894039 hsa-miR-203a-3p 0 1 0
chr22:45195764|45195893 hsa-miR-203a-3p 0 1 0
chr12:108645686|108645852 hsa-miR-203a-3p 0 1 0
chr1:32334008|32334363 hsa-miR-203a-3p 0 1 0
chr10:126003093|126003236 hsa-miR-203a-3p 0 1 0
chr6:7882432|7882659 hsa-miR-203a-3p 0 1 0
chr8:98089892|98090029 hsa-miR-203a-3p 0 1 0
chr17:15977903|15978043 hsa-miR-203a-3p 0 1 0
chr9:105356217|105356289 hsa-miR-203a-3p 0 1 0
chr20:58677889|58678005 hsa-miR-203a-3p 0 1 0
chr12:93409703|93409844 hsa-miR-203a-3p 0 1 0
chr1:153959640|153959761 hsa-miR-203a-3p 0 1 0
chr1:151400523|151400845 hsa-miR-203a-3p 0 1 0
chr8:22080820|22081193 hsa-miR-203a-3p 0 1 0
chr11:65426661|65426847 hsa-miR-203a-3p 0 1 0
chr2:73730992|73731108 hsa-miR-203a-3p 0 1 0
chrX:40663003|40663088 hsa-miR-203a-3p 0 1 0
chr6:7882538|7882659 hsa-miR-203a-3p 0 1 0
chr1:37809316|37809442 hsa-miR-203a-3p 0 1 0
chr6:138091297|138091438 hsa-miR-203a-3p 0 1 0
chr1:6222530|6222665 hsa-miR-203a-3p 0 1 0
chr12:108645778|108645974 hsa-miR-203a-3p 0 1 0
chr11:62524165|62524317 hsa-miR-203a-3p 0 1 0
chr6:6145407|6145751 hsa-miR-203a-3p 0 1 0
chr3:11556280|11556421 hsa-miR-203a-3p 0 1 0
chr2:73730992|73731110 hsa-miR-203a-3p 0 1 0
chr3:58123313|58123407 hsa-miR-203a-3p 0 1 0
chr1:32334296~32334588 hsa-miR-203a-3p 0 1 0
chr19:44919171~44919260 hsa-miR-203a-3p 0 1 0
chr12:10606202~10606374 hsa-miR-203a-3p 0 1 0
chr2:171555825~171555951 hsa-miR-203a-3p 0 1 0
chr4:103026209~103026355 hsa-miR-203a-3p 0 1 0
chr19:49659615|49659762 hsa-miR-203a-3p 0 1 0
chr10:50344001~50344157 hsa-miR-203a-3p 0 1 0
chr8:9144588~9144673 hsa-miR-203a-3p 0 1 0
chr1:151400523~151400845 hsa-miR-203a-3p 0 1 0
chr8:100261579~100261682 hsa-miR-203a-3p 0 1 0
chr17:15977871~15978109 hsa-miR-203a-3p 0 1 0
chr7:26498173~26498247 hsa-miR-203a-3p 0 1 0
chr8:100259965~100261647 hsa-miR-203a-3p 0 1 0
chr6:42937750~42938130 hsa-miR-203a-3p 0 1 0
chr7:29921871~29921966 hsa-miR-203a-3p 0 1 0
chr16:58518411~58518804 hsa-miR-203a-3p 0 1 0
chr5:150402226|150404767 hsa-miR-203a-3p 0 1 0
chr12:132755019|132755133 hsa-miR-203a-3p 0 1 0
chr9:128224716|128224827 hsa-miR-203a-3p 0 1 0
chr8:11802832|11802931 hsa-miR-203a-3p 0 1 0
chr12:11715237|11715407 hsa-miR-203a-3p 0 1 0
chr20:46357829|46358030 hsa-miR-203a-3p 0 1 0
chr5:76894065|76894185 hsa-miR-203a-3p 0 1 0
chr17:75238112|75238284 hsa-miR-203a-3p 0 1 0
chrY:7398618|7398837 hsa-miR-203a-3p 0 1 0
chr4:57032669|57032784 hsa-miR-203a-3p 0 1 0
chr2:10681971|10682069 hsa-miR-203a-3p 0 1 0
chr7:5324482|5324647 hsa-miR-203a-3p 0 1 0
chr7:44826259|44826374 hsa-miR-203a-3p 0 1 0
chr1:205626982|205627184 hsa-miR-203a-3p 0 1 0
chr22:23741204|23741405 hsa-miR-203a-3p 0 1 0
chr11:73972168|73972336 hsa-miR-203a-3p 0 1 0
chr7:127993180|127993298 hsa-miR-203a-3p 0 1 0
chr7:30806563|30806783 hsa-miR-203a-3p 1 0 0
chr18:5238277|5238444 hsa-miR-203a-3p 1 0 0
chr11:118250145|118250369 hsa-miR-203a-3p 0 1 0
chr6:85489494|85489599 hsa-miR-203a-3p 0 1 0
chr12:104349720|104349837 hsa-miR-203a-3p 0 1 0
chr1:6222390|6222623 hsa-miR-203a-3p 0 1 0
chr9:127691254|127691387 hsa-miR-203a-3p 0 1 0
chr1:151400511|151400845 hsa-miR-203a-3p 0 1 0
chr3:193662843|193662962 hsa-miR-203a-3p 0 1 0
chr19:11806930|11807181 hsa-miR-203a-3p 0 1 0
chr13:36168382|36168526 hsa-miR-203a-3p 0 1 0
chr7:135185354|135185501 hsa-miR-203a-3p 0 1 0
chr7:128769866|128770074 hsa-miR-203a-3p 0 1 0
chr6:53003293|53003439 hsa-miR-203a-3p 0 1 0
chr15:40276135|40276289 hsa-miR-203a-3p 0 1 0
chr3:58123202|58123407 hsa-miR-203a-3p 0 1 0
chr11:64223526|64223723 hsa-miR-203a-3p 0 1 0
chr12:104349720|104349903 hsa-miR-203a-3p 0 1 0
chr9:131499454|131499547 hsa-miR-203a-3p 0 1 0
chr2:157737299|157737473 hsa-miR-203a-3p 0 1 0
chr17:64089497|64089587 hsa-miR-203a-3p 0 1 0
chr7:90606502|90606613 hsa-miR-203a-3p 0 1 0
chr9:131499440|131499547 hsa-miR-203a-3p 0 1 0
chr1:1785423|1785664 hsa-miR-203a-3p 0 1 0
chr22:45195735|45195893 hsa-miR-203a-3p 0 1 0
chr5:141655668|141656099 hsa-miR-203a-3p 0 1 0
chrX:47226879|47227223 hsa-miR-203a-3p 0 1 0
chr16:87830656|87830770 hsa-miR-203a-3p 0 1 0
chr4:48515099|48515254 hsa-miR-203a-3p 0 1 0
chr2:73730992|73731127 hsa-miR-203a-3p 0 1 0
chr17:38921485|38921631 hsa-miR-203a-3p 0 1 0
chr15:34090317|34090455 hsa-miR-203a-3p 0 1 0
chr8:11802795|11802910 hsa-miR-203a-3p 0 1 0
chr5:150404680|150405129 hsa-miR-203a-3p 0 1 0
chr19:19934859|19934990 hsa-miR-203a-3p 0 1 0
chr6:149676260|149676569 hsa-miR-203a-3p 0 1 0
chr1:178478361|178478484 hsa-miR-203a-3p 0 1 0
chr3:14154060|14154172 hsa-miR-203a-3p 0 1 0
chr3:100363970|100364105 hsa-miR-203a-3p 0 1 0
chr10:70878711|70878897 hsa-miR-203a-3p 0 1 0
chr14:102019893|102022880 hsa-miR-203a-3p 0 1 0
chr8:140589930|140590074 hsa-miR-203a-3p 0 1 0
chr12:108645715|108645852 hsa-miR-203a-3p 0 1 0
chr20:17616732|17616830 hsa-miR-203a-3p 0 1 0
chr6:7882538|7882652 hsa-miR-203a-3p 0 1 0
chr14:63597961|63598280 hsa-miR-203a-3p 0 1 0
chr10:132207862|132208001 hsa-miR-203a-3p 0 1 0
chr17:45092315|45092491 hsa-miR-203a-3p 0 1 0
chr3:58123213|58123411 hsa-miR-203a-3p 0 1 0
chr15:88630867|88631022 hsa-miR-203a-3p 0 1 0
chr2:27306245|27306478 hsa-miR-203a-3p 0 1 0
chr19:10286102|10286327 hsa-miR-203a-3p 0 1 0
chr1:153959684|153959783 hsa-miR-203a-3p 0 1 0
chr8:118346844|118346929 hsa-miR-203a-3p 0 1 0
chr5:150402563|150405180 hsa-miR-203a-3p 0 1 0
chr11:112227192|112227281 hsa-miR-203a-3p 0 1 0
chr19:12944252|12944435 hsa-miR-203a-3p 0 1 0
chr15:74897047|74897219 hsa-miR-203a-3p 0 1 0
chr7:157220525|157220688 hsa-miR-203a-3p 0 1 0
chr20:35739529|35739644 hsa-miR-203a-3p 0 1 0
chr12:11893914|11894039 hsa-miR-203a-3p 0 1 0
chr9:128730017|128730198 hsa-miR-203a-3p 0 1 0
chr6:486485|486598 hsa-miR-203a-3p 0 1 0
chr14:54424790|54424934 hsa-miR-203a-3p 0 1 0
chr5:14509205|14509324 hsa-miR-203a-3p -6 1 0
chr7:50591905|50592089 hsa-miR-203a-3p 0 1 0
chr10:100984979|100985106 hsa-miR-203a-3p -4 1 0
chrX:119616384|119616495 hsa-miR-203a-3p 1 0 0
chr1:32376622|32376743 hsa-miR-203a-3p 0 1 0
chr1:154962931|154963132 hsa-miR-203a-3p 0 1 0
chr19:763687|763916 hsa-miR-203a-3p 0 1 0
chr3:58123213|58123407 hsa-miR-203a-3p 0 1 0
chr17:43517207|43520152 hsa-miR-203a-3p 0 1 0
chr1:32334296|32334363 hsa-miR-203a-3p 0 1 0
chr17:38322902|38323057 hsa-miR-203a-3p 0 1 0
chr17:38921521|38921648 hsa-miR-203a-3p 0 1 0
chr17:38322929|38323057 hsa-miR-203a-3p 0 1 0
chr10:100984985|100985111 hsa-miR-203a-3p 0 1 0
chr9:32449324|32449434 hsa-miR-203a-3p 0 1 0
chr1:15939803|15939978 hsa-miR-203a-3p 0 1 0
chr19:50518597|50518791 hsa-miR-203a-3p 0 1 0
chr9:35736920|35737130 hsa-miR-203a-3p 0 1 0
chr7:140085382|140085520 hsa-miR-203a-3p 0 1 0
chr20:58993663|58993817 hsa-miR-203a-3p 0 1 0
chr8:100261567|100261708 hsa-miR-203a-3p 0 1 0
chr1:6415630|6415772 hsa-miR-203a-3p 0 1 0
chr12:103946664|103946873 hsa-miR-203a-3p 0 1 0
chr8:100261540|100261670 hsa-miR-203a-3p 0 1 0
chr8:11802839|11802931 hsa-miR-203a-3p 0 1 0
chr1:213997972|213998131 hsa-miR-203a-3p 0 1 0
chr7:128769892|128770074 hsa-miR-203a-3p 0 1 0
chr7:128769917|128770074 hsa-miR-203a-3p 0 1 0
chr10:100984985|100985125 hsa-miR-203a-3p 0 1 0
chr15:40276164|40276289 hsa-miR-203a-3p 0 1 0
chr3:58123166|58123407 hsa-miR-203a-3p 0 1 0
chr17:38322905|38323076 hsa-miR-203a-3p 0 1 0
chr7:98215667|98215771 hsa-miR-203a-3p 0 1 0
chr9:128332850|128332943 hsa-miR-203a-3p 0 1 0
chr3:50245506|50245676 hsa-miR-203a-3p 0 1 0
chr19:763785|763916 hsa-miR-203a-3p 0 1 0
chr1:15939769|15939978 hsa-miR-203a-3p 0 1 0
chr2:88027714|88027822 hsa-miR-203a-3p 0 1 0
Target genes
miRNA Gene Gene Description HGNC ID details
hsa-miR-203a-3p ABL1 ABL proto-oncogene 1, non-receptor tyrosine kinase HGNC:76 details
hsa-miR-203a-3p TP63 tumor protein p63 HGNC:15979 details
hsa-miR-203a-3p details
hsa-miR-203a-3p ABCE1 ATP binding cassette subfamily E member 1 HGNC:69 details
hsa-miR-203a-3p CDK6 cyclin dependent kinase 6 HGNC:1777 details
hsa-miR-203a-3p SOCS3 suppressor of cytokine signaling 3 HGNC:19391 details
hsa-miR-203a-3p BCL2L2 BCL2 like 2 HGNC:995 details
hsa-miR-203a-3p PPM1D protein phosphatase, Mg2+/Mn2+ dependent 1D HGNC:9277 details
hsa-miR-203a-3p GDAP1 ganglioside induced differentiation associated protein 1 HGNC:15968 details
hsa-miR-203a-3p EDNRA endothelin receptor type A HGNC:3179 details
hsa-miR-203a-3p EYA4 EYA transcriptional coactivator and phosphatase 4 HGNC:3522 details
hsa-miR-203a-3p ZEB2 zinc finger E-box binding homeobox 2 HGNC:14881 details
hsa-miR-203a-3p BMI1 BMI1 proto-oncogene, polycomb ring finger HGNC:1066 details
hsa-miR-203a-3p RUNX2 RUNX family transcription factor 2 HGNC:10472 details
hsa-miR-203a-3p SMAD4 SMAD family member 4 HGNC:6770 details
hsa-miR-203a-3p E2F1 E2F transcription factor 1 HGNC:3113 details
hsa-miR-203a-3p MMP10 matrix metallopeptidase 10 HGNC:7156 details
hsa-miR-203a-3p DLX5 distal-less homeobox 5 HGNC:2918 details
hsa-miR-203a-3p IL6 interleukin 6 HGNC:6018 details
hsa-miR-203a-3p MMP1 matrix metallopeptidase 1 HGNC:7155 details
hsa-miR-203a-3p AKT2 AKT serine/threonine kinase 2 HGNC:392 details
hsa-miR-203a-3p BIRC5 baculoviral IAP repeat containing 5 HGNC:593 details
hsa-miR-203a-3p E2F3 E2F transcription factor 3 HGNC:3115 details
hsa-miR-203a-3p ZNF148 zinc finger protein 148 HGNC:12933 details
hsa-miR-203a-3p CREB1 cAMP responsive element binding protein 1 HGNC:2345 details
hsa-miR-203a-3p TJP2 tight junction protein 2 HGNC:11828 details
hsa-miR-203a-3p SOCS6 suppressor of cytokine signaling 6 HGNC:16833 details
hsa-miR-203a-3p TNF tumor necrosis factor HGNC:11892 details
hsa-miR-203a-3p IL24 interleukin 24 HGNC:11346 details
hsa-miR-203a-3p SNAI2 snail family transcriptional repressor 2 HGNC:11094 details
hsa-miR-203a-3p CBLL1 Cbl proto-oncogene like 1 HGNC:21225 details
hsa-miR-203a-3p MYD88 MYD88 innate immune signal transduction adaptor HGNC:7562 details
hsa-miR-203a-3p UVRAG UV radiation resistance associated HGNC:12640 details
hsa-miR-203a-3p LIFR LIF receptor subunit alpha HGNC:6597 details
hsa-miR-203a-3p LASP1 LIM and SH3 protein 1 HGNC:6513 details
hsa-miR-203a-3p JUN Jun proto-oncogene, AP-1 transcription factor subunit HGNC:6204 details
hsa-miR-203a-3p PRKCA protein kinase C alpha HGNC:9393 details
hsa-miR-203a-3p VEGFA vascular endothelial growth factor A HGNC:12680 details
hsa-miR-203a-3p ASAP1 ArfGAP with SH3 domain, ankyrin repeat and PH domain 1 HGNC:2720 details
hsa-miR-203a-3p CAV1 caveolin 1 HGNC:1527 details
hsa-miR-203a-3p ING1 inhibitor of growth family member 1 HGNC:6062 details
hsa-miR-203a-3p SRC SRC proto-oncogene, non-receptor tyrosine kinase HGNC:11283 details
hsa-miR-203a-3p RASAL2 RAS protein activator like 2 HGNC:9874 details
hsa-miR-203a-3p MAP3K13 mitogen-activated protein kinase kinase kinase 13 HGNC:6852 details
hsa-miR-203a-3p NFYA nuclear transcription factor Y subunit alpha HGNC:7804 details
hsa-miR-203a-3p JMY junction mediating and regulatory protein, p53 cofactor HGNC:28916 details
hsa-miR-203a-3p TCF4 transcription factor 4 HGNC:11634 details
hsa-miR-203a-3p ZEB1 zinc finger E-box binding homeobox 1 HGNC:11642 details
hsa-miR-203a-3p SMAD9 SMAD family member 9 HGNC:6774 details
hsa-miR-203a-3p BCL7A BAF chromatin remodeling complex subunit BCL7A HGNC:1004 details
hsa-miR-203a-3p BCL11B BAF chromatin remodeling complex subunit BCL11B HGNC:13222 details
hsa-miR-203a-3p FOXK1 forkhead box K1 HGNC:23480 details
hsa-miR-203a-3p RAN RAN, member RAS oncogene family HGNC:9846 details
hsa-miR-203a-3p RAPH1 Ras association (RalGDS/AF-6) and pleckstrin homology domains 1 HGNC:14436 details
hsa-miR-203a-3p CASK calcium/calmodulin dependent serine protein kinase HGNC:1497 details
hsa-miR-203a-3p PLD2 phospholipase D2 HGNC:9068 details
hsa-miR-203a-3p TBCEL tubulin folding cofactor E like HGNC:28115 details
hsa-miR-203a-3p CXXC4 CXXC finger protein 4 HGNC:24593 details
hsa-miR-203a-3p CIT citron rho-interacting serine/threonine kinase HGNC:1985 details
hsa-miR-203a-3p SIX1 SIX homeobox 1 HGNC:10887 details
hsa-miR-203a-3p PDE7A phosphodiesterase 7A HGNC:8791 details
hsa-miR-203a-3p HOXA1 homeobox A1 HGNC:5099 details
hsa-miR-203a-3p MIDN midnolin HGNC:16298 details
hsa-miR-203a-3p GREM1 gremlin 1, DAN family BMP antagonist HGNC:2001 details
hsa-miR-203a-3p TRIML2 tripartite motif family like 2 HGNC:26378 details
hsa-miR-203a-3p NCOA4 nuclear receptor coactivator 4 HGNC:7671 details
hsa-miR-203a-3p CDKL2 cyclin dependent kinase like 2 HGNC:1782 details
hsa-miR-203a-3p ARHGEF28 Rho guanine nucleotide exchange factor 28 HGNC:30322 details
hsa-miR-203a-3p CERKL ceramide kinase like HGNC:21699 details
hsa-miR-203a-3p POLR1B RNA polymerase I subunit B HGNC:20454 details
hsa-miR-203a-3p GXYLT2 glucoside xylosyltransferase 2 HGNC:33383 details
hsa-miR-203a-3p LOH12CR2 loss of heterozygosity on chromosome 12, region 2 HGNC:26524 details
hsa-miR-203a-3p BMPR1A bone morphogenetic protein receptor type 1A HGNC:1076 details
hsa-miR-203a-3p UFL1 UFM1 specific ligase 1 HGNC:23039 details
hsa-miR-203a-3p PIP5K1A phosphatidylinositol-4-phosphate 5-kinase type 1 alpha HGNC:8994 details
hsa-miR-203a-3p TSC22D2 TSC22 domain family member 2 HGNC:29095 details
hsa-miR-203a-3p HELZ helicase with zinc finger HGNC:16878 details
hsa-miR-203a-3p CYP20A1 cytochrome P450 family 20 subfamily A member 1 HGNC:20576 details
hsa-miR-203a-3p KIF1C kinesin family member 1C HGNC:6317 details
hsa-miR-203a-3p MCM9 minichromosome maintenance 9 homologous recombination repair factor HGNC:21484 details
hsa-miR-203a-3p PEAR1 platelet endothelial aggregation receptor 1 HGNC:33631 details
hsa-miR-203a-3p STOM stomatin HGNC:3383 details
hsa-miR-203a-3p RASA2 RAS p21 protein activator 2 HGNC:9872 details
hsa-miR-203a-3p CUL3 cullin 3 HGNC:2553 details
hsa-miR-203a-3p IL7 interleukin 7 HGNC:6023 details
hsa-miR-203a-3p ASPA aspartoacylase HGNC:756 details
hsa-miR-203a-3p details
hsa-miR-203a-3p TRNT1 tRNA nucleotidyl transferase 1 HGNC:17341 details
hsa-miR-203a-3p NUDCD1 NudC domain containing 1 HGNC:24306 details
hsa-miR-203a-3p WDR77 WD repeat domain 77 HGNC:29652 details
hsa-miR-203a-3p LINC00598 long intergenic non-protein coding RNA 598 HGNC:42770 details
hsa-miR-203a-3p ZNF704 zinc finger protein 704 HGNC:32291 details
hsa-miR-203a-3p ROCK2 Rho associated coiled-coil containing protein kinase 2 HGNC:10252 details
hsa-miR-203a-3p RMND5A required for meiotic nuclear division 5 homolog A HGNC:25850 details
hsa-miR-203a-3p RGS17 regulator of G protein signaling 17 HGNC:14088 details
hsa-miR-203a-3p NCALD neurocalcin delta HGNC:7655 details
hsa-miR-203a-3p MAPK9 mitogen-activated protein kinase 9 HGNC:6886 details
hsa-miR-203a-3p GLIS3 GLIS family zinc finger 3 HGNC:28510 details
hsa-miR-203a-3p GABRB1 gamma-aminobutyric acid type A receptor subunit beta1 HGNC:4081 details
hsa-miR-203a-3p CNNM3 cyclin and CBS domain divalent metal cation transport mediator 3 HGNC:104 details
hsa-miR-203a-3p CLOCK clock circadian regulator HGNC:2082 details
hsa-miR-203a-3p ATM ATM serine/threonine kinase HGNC:795 details
hsa-miR-203a-3p MRO maestro HGNC:24121 details
hsa-miR-203a-3p SLC44A1 solute carrier family 44 member 1 HGNC:18798 details
hsa-miR-203a-3p ENAH ENAH actin regulator HGNC:18271 details
hsa-miR-203a-3p PRAMEF7 PRAME family member 7 HGNC:28415 details
hsa-miR-203a-3p PRAMEF8 PRAME family member 8 HGNC:24074 details
hsa-miR-203a-3p OIT3 oncoprotein induced transcript 3 HGNC:29953 details
hsa-miR-203a-3p MSI2 musashi RNA binding protein 2 HGNC:18585 details
hsa-miR-203a-3p ZBED3 zinc finger BED-type containing 3 HGNC:20711 details
hsa-miR-203a-3p ZNF654 zinc finger protein 654 HGNC:25612 details
hsa-miR-203a-3p ZMYM2 zinc finger MYM-type containing 2 HGNC:12989 details
hsa-miR-203a-3p TMEM70 transmembrane protein 70 HGNC:26050 details
hsa-miR-203a-3p SMURF2 SMAD specific E3 ubiquitin protein ligase 2 HGNC:16809 details
hsa-miR-203a-3p HTR2A 5-hydroxytryptamine receptor 2A HGNC:5293 details
hsa-miR-203a-3p LCE1A late cornified envelope 1A HGNC:29459 details
hsa-miR-203a-3p VGLL4 vestigial like family member 4 HGNC:28966 details
hsa-miR-203a-3p TSR1 TSR1 ribosome maturation factor HGNC:25542 details
hsa-miR-203a-3p TRPS1 transcriptional repressor GATA binding 1 HGNC:12340 details
hsa-miR-203a-3p TRMT5 tRNA methyltransferase 5 HGNC:23141 details
hsa-miR-203a-3p TMPPE transmembrane protein with metallophosphoesterase domain HGNC:33865 details
hsa-miR-203a-3p RNF41 ring finger protein 41 HGNC:18401 details
hsa-miR-203a-3p RGL2 ral guanine nucleotide dissociation stimulator like 2 HGNC:9769 details
hsa-miR-203a-3p NUFIP2 nuclear FMR1 interacting protein 2 HGNC:17634 details
hsa-miR-203a-3p LDHA lactate dehydrogenase A HGNC:6535 details
hsa-miR-203a-3p GXYLT1 glucoside xylosyltransferase 1 HGNC:27482 details
hsa-miR-203a-3p FOXK2 forkhead box K2 HGNC:6036 details
hsa-miR-203a-3p FBXW7 F-box and WD repeat domain containing 7 HGNC:16712 details
hsa-miR-203a-3p DYRK3 dual specificity tyrosine phosphorylation regulated kinase 3 HGNC:3094 details
hsa-miR-203a-3p DHX33 DEAH-box helicase 33 HGNC:16718 details
hsa-miR-203a-3p CAND1 cullin associated and neddylation dissociated 1 HGNC:30688 details
hsa-miR-203a-3p CALR calreticulin HGNC:1455 details
hsa-miR-203a-3p ARID2 AT-rich interaction domain 2 HGNC:18037 details
hsa-miR-203a-3p MXRA7 matrix remodeling associated 7 HGNC:7541 details
hsa-miR-203a-3p ZNF652 zinc finger protein 652 HGNC:29147 details
hsa-miR-203a-3p OSBP oxysterol binding protein HGNC:8503 details
hsa-miR-203a-3p ZNF24 zinc finger protein 24 HGNC:13032 details
hsa-miR-203a-3p SLC39A9 solute carrier family 39 member 9 HGNC:20182 details
hsa-miR-203a-3p RAPGEF1 Rap guanine nucleotide exchange factor 1 HGNC:4568 details
hsa-miR-203a-3p HECTD1 HECT domain E3 ubiquitin protein ligase 1 HGNC:20157 details
hsa-miR-203a-3p GNAS GNAS complex locus HGNC:4392 details
hsa-miR-203a-3p ANKRD13B ankyrin repeat domain 13B HGNC:26363 details
hsa-miR-203a-3p details
hsa-miR-203a-3p PAX6 paired box 6 HGNC:8620 details
hsa-miR-203a-3p details
hsa-miR-203a-3p C6orf223 chromosome 6 open reading frame 223 HGNC:28692 details
hsa-miR-203a-3p CDH7 cadherin 7 HGNC:1766 details
hsa-miR-203a-3p details
hsa-miR-203a-3p SLC23A1 solute carrier family 23 member 1 HGNC:10974 details
hsa-miR-203a-3p PCGF6 polycomb group ring finger 6 HGNC:21156 details
hsa-miR-203a-3p DGAT2 diacylglycerol O-acyltransferase 2 HGNC:16940 details
hsa-miR-203a-3p PRR14L proline rich 14 like HGNC:28738 details
hsa-miR-203a-3p IPO7 importin 7 HGNC:9852 details
hsa-miR-203a-3p ACVR2B activin A receptor type 2B HGNC:174 details
hsa-miR-203a-3p SOD2 superoxide dismutase 2 HGNC:11180 details
hsa-miR-203a-3p TPD52L1 TPD52 like 1 HGNC:12006 details
hsa-miR-203a-3p SLC12A5 solute carrier family 12 member 5 HGNC:13818 details
hsa-miR-203a-3p SUMO1 small ubiquitin like modifier 1 HGNC:12502 details
hsa-miR-203a-3p MAPK8 mitogen-activated protein kinase 8 HGNC:6881 details
hsa-miR-203a-3p DNAJB6 DnaJ heat shock protein family (Hsp40) member B6 HGNC:14888 details
hsa-miR-203a-3p DNAAF2 dynein axonemal assembly factor 2 HGNC:20188 details
hsa-miR-203a-3p ZNF451 zinc finger protein 451 HGNC:21091 details
hsa-miR-203a-3p SH3BP4 SH3 domain binding protein 4 HGNC:10826 details
hsa-miR-203a-3p PI4K2B phosphatidylinositol 4-kinase type 2 beta HGNC:18215 details
hsa-miR-203a-3p PARD6B par-6 family cell polarity regulator beta HGNC:16245 details
hsa-miR-203a-3p GPCPD1 glycerophosphocholine phosphodiesterase 1 HGNC:26957 details
hsa-miR-203a-3p EN2 engrailed homeobox 2 HGNC:3343 details
hsa-miR-203a-3p CPEB4 cytoplasmic polyadenylation element binding protein 4 HGNC:21747 details
hsa-miR-203a-3p MTPN myotrophin HGNC:15667 details
hsa-miR-203a-3p PRNP prion protein HGNC:9449 details
hsa-miR-203a-3p DUSP5 dual specificity phosphatase 5 HGNC:3071 details
hsa-miR-203a-3p details
hsa-miR-203a-3p ARID3B AT-rich interaction domain 3B HGNC:14350 details
hsa-miR-203a-3p COX20 cytochrome c oxidase assembly factor COX20 HGNC:26970 details
hsa-miR-203a-3p GLRX2 glutaredoxin 2 HGNC:16065 details
hsa-miR-203a-3p RAP2B RAP2B, member of RAS oncogene family HGNC:9862 details
hsa-miR-203a-3p PSAT1 phosphoserine aminotransferase 1 HGNC:19129 details
hsa-miR-203a-3p FBXL5 F-box and leucine rich repeat protein 5 HGNC:13602 details
hsa-miR-203a-3p DYNLT1 dynein light chain Tctex-type 1 HGNC:11697 details
hsa-miR-203a-3p FRK fyn related Src family tyrosine kinase HGNC:3955 details
hsa-miR-203a-3p NPPC natriuretic peptide C HGNC:7941 details
hsa-miR-203a-3p HOMEZ homeobox and leucine zipper encoding HGNC:20164 details
hsa-miR-203a-3p SERINC1 serine incorporator 1 HGNC:13464 details
hsa-miR-203a-3p SEMA3D semaphorin 3D HGNC:10726 details
hsa-miR-203a-3p FOXN3 forkhead box N3 HGNC:1928 details
hsa-miR-203a-3p DLC1 DLC1 Rho GTPase activating protein HGNC:2897 details
hsa-miR-203a-3p CCSAP centriole, cilia and spindle associated protein HGNC:29578 details
hsa-miR-203a-3p ZNF367 zinc finger protein 367 HGNC:18320 details
hsa-miR-203a-3p CDC42SE2 CDC42 small effector 2 HGNC:18547 details
hsa-miR-203a-3p C15orf48 chromosome 15 open reading frame 48 HGNC:29898 details
hsa-miR-203a-3p FBXL3 F-box and leucine rich repeat protein 3 HGNC:13599 details
hsa-miR-203a-3p SZRD1 SUZ RNA binding domain containing 1 HGNC:30232 details
hsa-miR-203a-3p IPMK inositol polyphosphate multikinase HGNC:20739 details
hsa-miR-203a-3p EGLN1 egl-9 family hypoxia inducible factor 1 HGNC:1232 details
hsa-miR-203a-3p TRIM4 tripartite motif containing 4 HGNC:16275 details
hsa-miR-203a-3p SPATA18 spermatogenesis associated 18 HGNC:29579 details
hsa-miR-203a-3p TMEM97 transmembrane protein 97 HGNC:28106 details
hsa-miR-203a-3p ZNF200 zinc finger protein 200 HGNC:12993 details
hsa-miR-203a-3p SYNM synemin HGNC:24466 details
hsa-miR-203a-3p SERTAD3 SERTA domain containing 3 HGNC:17931 details
hsa-miR-203a-3p RNF141 ring finger protein 141 HGNC:21159 details
hsa-miR-203a-3p RLIM ring finger protein, LIM domain interacting HGNC:13429 details
hsa-miR-203a-3p PPP1CB protein phosphatase 1 catalytic subunit beta HGNC:9282 details
hsa-miR-203a-3p NR2F2 nuclear receptor subfamily 2 group F member 2 HGNC:7976 details
hsa-miR-203a-3p NETO2 neuropilin and tolloid like 2 HGNC:14644 details
hsa-miR-203a-3p HNRNPR heterogeneous nuclear ribonucleoprotein R HGNC:5047 details
hsa-miR-203a-3p GAS1 growth arrest specific 1 HGNC:4165 details
hsa-miR-203a-3p FYCO1 FYVE and coiled-coil domain autophagy adaptor 1 HGNC:14673 details
hsa-miR-203a-3p CNNM4 cyclin and CBS domain divalent metal cation transport mediator 4 HGNC:105 details
hsa-miR-203a-3p BOLA3 bolA family member 3 HGNC:24415 details
hsa-miR-203a-3p KIAA0408 KIAA0408 HGNC:21636 details
hsa-miR-203a-3p FMNL2 formin like 2 HGNC:18267 details
hsa-miR-203a-3p UBXN2A UBX domain protein 2A HGNC:27265 details
hsa-miR-203a-3p SNX4 sorting nexin 4 HGNC:11175 details
hsa-miR-203a-3p SLAIN2 SLAIN motif family member 2 HGNC:29282 details
hsa-miR-203a-3p PRKACB protein kinase cAMP-activated catalytic subunit beta HGNC:9381 details
hsa-miR-203a-3p PRICKLE2 prickle planar cell polarity protein 2 HGNC:20340 details
hsa-miR-203a-3p PDCD10 programmed cell death 10 HGNC:8761 details
hsa-miR-203a-3p MAFK MAF bZIP transcription factor K HGNC:6782 details
hsa-miR-203a-3p LCOR ligand dependent nuclear receptor corepressor HGNC:29503 details
hsa-miR-203a-3p KLHL28 kelch like family member 28 HGNC:19741 details
hsa-miR-203a-3p GATA6 GATA binding protein 6 HGNC:4174 details
hsa-miR-203a-3p EXT1 exostosin glycosyltransferase 1 HGNC:3512 details
hsa-miR-203a-3p DDX3Y DEAD-box helicase 3 Y-linked HGNC:2699 details
hsa-miR-203a-3p details
hsa-miR-203a-3p SON SON DNA and RNA binding protein HGNC:11183 details
hsa-miR-203a-3p LCLAT1 lysocardiolipin acyltransferase 1 HGNC:26756 details
hsa-miR-203a-3p KLHL15 kelch like family member 15 HGNC:29347 details
hsa-miR-203a-3p IGFBP5 insulin like growth factor binding protein 5 HGNC:5474 details
hsa-miR-203a-3p ARID1A AT-rich interaction domain 1A HGNC:11110 details
hsa-miR-203a-3p ANP32A acidic nuclear phosphoprotein 32 family member A HGNC:13233 details
hsa-miR-203a-3p PARK7 Parkinsonism associated deglycase HGNC:16369 details
hsa-miR-203a-3p ZWINT ZW10 interacting kinetochore protein HGNC:13195 details
hsa-miR-203a-3p THRAP3 thyroid hormone receptor associated protein 3 HGNC:22964 details
hsa-miR-203a-3p ZNF268 zinc finger protein 268 HGNC:13061 details
hsa-miR-203a-3p TRIM71 tripartite motif containing 71 HGNC:32669 details
hsa-miR-203a-3p PIM3 Pim-3 proto-oncogene, serine/threonine kinase HGNC:19310 details
hsa-miR-203a-3p NUP50 nucleoporin 50 HGNC:8065 details
hsa-miR-203a-3p NAA30 N-alpha-acetyltransferase 30, NatC catalytic subunit HGNC:19844 details
hsa-miR-203a-3p MBNL1 muscleblind like splicing regulator 1 HGNC:6923 details
hsa-miR-203a-3p KCNJ2 potassium inwardly rectifying channel subfamily J member 2 HGNC:6263 details
hsa-miR-203a-3p details
hsa-miR-203a-3p CELF2 CUGBP Elav-like family member 2 HGNC:2550 details
hsa-miR-203a-3p ARPP19 cAMP regulated phosphoprotein 19 HGNC:16967 details
hsa-miR-203a-3p NCL nucleolin HGNC:7667 details
hsa-miR-203a-3p HNRNPDL heterogeneous nuclear ribonucleoprotein D like HGNC:5037 details
hsa-miR-203a-3p MAP4 microtubule associated protein 4 HGNC:6862 details
hsa-miR-203a-3p PXDN peroxidasin HGNC:14966 details
hsa-miR-203a-3p details
hsa-miR-203a-3p DAZAP2 DAZ associated protein 2 HGNC:2684 details
hsa-miR-203a-3p TOR1AIP2 torsin 1A interacting protein 2 HGNC:24055 details
hsa-miR-203a-3p SCO1 synthesis of cytochrome C oxidase 1 HGNC:10603 details
hsa-miR-203a-3p KIF13A kinesin family member 13A HGNC:14566 details
hsa-miR-203a-3p CCR5 C-C motif chemokine receptor 5 HGNC:1606 details
hsa-miR-203a-3p SEC63 SEC63 homolog, protein translocation regulator HGNC:21082 details
hsa-miR-203a-3p IGF1R insulin like growth factor 1 receptor HGNC:5465 details
hsa-miR-203a-3p CADM2 cell adhesion molecule 2 HGNC:29849 details
hsa-miR-203a-3p NKX2-1 NK2 homeobox 1 HGNC:11825 details
hsa-miR-203a-3p DNTTIP2 deoxynucleotidyltransferase terminal interacting protein 2 HGNC:24013 details
hsa-miR-203a-3p HEPHL1 hephaestin like 1 HGNC:30477 details
hsa-miR-203a-3p NSD3 nuclear receptor binding SET domain protein 3 HGNC:12767 details
hsa-miR-203a-3p SPATA13 spermatogenesis associated 13 HGNC:23222 details
hsa-miR-203a-3p SMCHD1 structural maintenance of chromosomes flexible hinge domain containing 1 HGNC:29090 details
hsa-miR-203a-3p MCTP1 multiple C2 and transmembrane domain containing 1 HGNC:26183 details
hsa-miR-203a-3p GSTO2 glutathione S-transferase omega 2 HGNC:23064 details
hsa-miR-203a-3p GINS4 GINS complex subunit 4 HGNC:28226 details
hsa-miR-203a-3p details
hsa-miR-203a-3p GPR156 G protein-coupled receptor 156 HGNC:20844 details
hsa-miR-203a-3p PM20D2 peptidase M20 domain containing 2 HGNC:21408 details
hsa-miR-203a-3p TOP2A DNA topoisomerase II alpha HGNC:11989 details
hsa-miR-203a-3p FLYWCH2 FLYWCH family member 2 HGNC:25178 details
hsa-miR-203a-3p SMAD2 SMAD family member 2 HGNC:6768 details
hsa-miR-203a-3p HEXIM1 HEXIM P-TEFb complex subunit 1 HGNC:24953 details
hsa-miR-203a-3p BTG1 BTG anti-proliferation factor 1 HGNC:1130 details
hsa-miR-203a-3p EXOC2 exocyst complex component 2 HGNC:24968 details
hsa-miR-203a-3p SLC45A4 solute carrier family 45 member 4 HGNC:29196 details
hsa-miR-203a-3p details
hsa-miR-203a-3p SYK spleen associated tyrosine kinase HGNC:11491 details
hsa-miR-203a-3p SH3GLB1 SH3 domain containing GRB2 like, endophilin B1 HGNC:10833 details
hsa-miR-203a-3p SRGAP1 SLIT-ROBO Rho GTPase activating protein 1 HGNC:17382 details
hsa-miR-203a-3p CLPTM1L CLPTM1 like HGNC:24308 details
hsa-miR-203a-3p KIF5B kinesin family member 5B HGNC:6324 details
hsa-miR-203a-3p KIF2A kinesin family member 2A HGNC:6318 details
hsa-miR-203a-3p PIK3CA phosphatidylinositol-4,5-bisphosphate 3-kinase catalytic subunit alpha HGNC:8975 details
hsa-miR-203a-3p SNAI1 snail family transcriptional repressor 1 HGNC:11128 details
hsa-miR-203a-3p IFIT1 interferon induced protein with tetratricopeptide repeats 1 HGNC:5407 details
hsa-miR-203a-3p ALOX15 arachidonate 15-lipoxygenase HGNC:433 details
hsa-miR-203a-3p TYMS thymidylate synthetase HGNC:12441 details
hsa-miR-203a-3p WIF1 WNT inhibitory factor 1 HGNC:18081 details
hsa-miR-203a-3p KHDRBS1 KH RNA binding domain containing, signal transduction associated 1 HGNC:18116 details
hsa-miR-203a-3p CXCL8 C-X-C motif chemokine ligand 8 HGNC:6025 details
hsa-miR-203a-3p LIN28B lin-28 homolog B HGNC:32207 details
hsa-miR-203a-3p BANF1 BAF nuclear assembly factor 1 HGNC:17397 details
hsa-miR-203a-3p TBK1 TANK binding kinase 1 HGNC:11584 details
hsa-miR-203a-3p HOXD3 homeobox D3 HGNC:5137 details
hsa-miR-203a-3p NR2C2 nuclear receptor subfamily 2 group C member 2 HGNC:7972 details
hsa-miR-203a-3p STAT1 signal transducer and activator of transcription 1 HGNC:11362 details
hsa-miR-203a-3p CDH1 cadherin 1 HGNC:1748 details
hsa-miR-203a-3p RAP1A RAP1A, member of RAS oncogene family HGNC:9855 details
hsa-miR-203a-3p RAB22A RAB22A, member RAS oncogene family HGNC:9764 details
hsa-miR-203a-3p FGF2 fibroblast growth factor 2 HGNC:3676 details
hsa-miR-203a-3p FZD2 frizzled class receptor 2 HGNC:4040 details
hsa-miR-203a-3p details
hsa-miR-203a-3p CIAO1 cytosolic iron-sulfur assembly component 1 HGNC:14280 details
hsa-miR-203a-3p SATB2 SATB homeobox 2 HGNC:21637 details
hsa-miR-203a-3p STMP1 short transmembrane mitochondrial protein 1 HGNC:41909 details
hsa-miR-203a-3p MCFD2 multiple coagulation factor deficiency 2, ER cargo receptor complex subunit HGNC:18451 details
hsa-miR-203a-3p NEK3 NIMA related kinase 3 HGNC:7746 details
hsa-miR-203a-3p PLAGL2 PLAG1 like zinc finger 2 HGNC:9047 details
hsa-miR-203a-3p POLI DNA polymerase iota HGNC:9182 details
hsa-miR-203a-3p TNFRSF9 TNF receptor superfamily member 9 HGNC:11924 details
hsa-miR-203a-3p GSK3B glycogen synthase kinase 3 beta HGNC:4617 details
hsa-miR-203a-3p REG3A regenerating family member 3 alpha HGNC:8601 details
© 2021 Arieh Warshel Institute of Computational Biology, CUHK(SZ) | Designed by : Biomics Lab