miRNA Card

miRNA General Information
miRNA ID hsa-miR-2052
Description Homo sapiens miR-2052 stem-loop
Comment None
Experiment cloned [1], PCR [1]
Sequence UGUUUUGAUAACAGUAAUGU
miRNA Expression in different cancers

    by mir_boxplot.py

circRNA-miRNA-gene regulatory network

Note about Netwrok:
This is a network diagram with miRNA (purple circle) as the center.
We used three tools(PITA, miRanda, targetScan) to predict the binding sites of circrna (green circle) and miRNA. Accordingly, for this miRNA that binds to circrna, we have three confidence levels, namely confident 1, confident 2 and confident 3. Confidence value indicates how many tools can deduce these results. For each confidence, we use different kinds of dashed lines.

Target circRNA with confidence

Confidence 3 (3 of 3 tools predicted)

CircID miRNA PITA miRanda targetScan

Confidence 2 (2 of 3 tools predicted)

CircID miRNA PITA miRanda targetScan
chr6:83046934|83047114 hsa-miR-2052 1 1 0
Target genes
miRNA Gene Gene Description HGNC ID details
hsa-miR-2052 MOB3B MOB kinase activator 3B HGNC:23825 details
hsa-miR-2052 SCML4 Scm polycomb group protein like 4 HGNC:21397 details
hsa-miR-2052 ZNF281 zinc finger protein 281 HGNC:13075 details
hsa-miR-2052 ZNF131 zinc finger protein 131 HGNC:12915 details
hsa-miR-2052 SMAD5 SMAD family member 5 HGNC:6771 details
hsa-miR-2052 MDM4 MDM4 regulator of p53 HGNC:6974 details
hsa-miR-2052 LONRF1 LON peptidase N-terminal domain and ring finger 1 HGNC:26302 details
hsa-miR-2052 FBXW7 F-box and WD repeat domain containing 7 HGNC:16712 details
hsa-miR-2052 FAM83G family with sequence similarity 83 member G HGNC:32554 details
hsa-miR-2052 details
hsa-miR-2052 ATXN7L3B ataxin 7 like 3B HGNC:37931 details
hsa-miR-2052 APPBP2 amyloid beta precursor protein binding protein 2 HGNC:622 details
hsa-miR-2052 RASSF8 Ras association domain family member 8 HGNC:13232 details
hsa-miR-2052 ZNF384 zinc finger protein 384 HGNC:11955 details
hsa-miR-2052 SLC39A9 solute carrier family 39 member 9 HGNC:20182 details
hsa-miR-2052 RGL2 ral guanine nucleotide dissociation stimulator like 2 HGNC:9769 details
hsa-miR-2052 TNRC6A trinucleotide repeat containing adaptor 6A HGNC:11969 details
hsa-miR-2052 MAPK6 mitogen-activated protein kinase 6 HGNC:6879 details
hsa-miR-2052 CELSR3 cadherin EGF LAG seven-pass G-type receptor 3 HGNC:3230 details
hsa-miR-2052 details
hsa-miR-2052 DNAAF2 dynein axonemal assembly factor 2 HGNC:20188 details
hsa-miR-2052 MNX1 motor neuron and pancreas homeobox 1 HGNC:4979 details
hsa-miR-2052 HMGA2 high mobility group AT-hook 2 HGNC:5009 details
hsa-miR-2052 SINHCAF SIN3-HDAC complex associated factor HGNC:30702 details
hsa-miR-2052 BZW1 basic leucine zipper and W2 domains 1 HGNC:18380 details
hsa-miR-2052 PPP1R15B protein phosphatase 1 regulatory subunit 15B HGNC:14951 details
hsa-miR-2052 KLHL15 kelch like family member 15 HGNC:29347 details
hsa-miR-2052 PSMG2 proteasome assembly chaperone 2 HGNC:24929 details
hsa-miR-2052 ESR2 estrogen receptor 2 HGNC:3468 details
hsa-miR-2052 SRPX2 sushi repeat containing protein X-linked 2 HGNC:30668 details
hsa-miR-2052 PEX26 peroxisomal biogenesis factor 26 HGNC:22965 details
hsa-miR-2052 ZNF620 zinc finger protein 620 HGNC:28742 details
hsa-miR-2052 STXBP4 syntaxin binding protein 4 HGNC:19694 details
hsa-miR-2052 PPIL1 peptidylprolyl isomerase like 1 HGNC:9260 details
hsa-miR-2052 GTF2E2 general transcription factor IIE subunit 2 HGNC:4651 details
hsa-miR-2052 RLIM ring finger protein, LIM domain interacting HGNC:13429 details
hsa-miR-2052 MAT2A methionine adenosyltransferase 2A HGNC:6904 details
hsa-miR-2052 HNRNPR heterogeneous nuclear ribonucleoprotein R HGNC:5047 details
hsa-miR-2052 MED21 mediator complex subunit 21 HGNC:11473 details
hsa-miR-2052 SOCS7 suppressor of cytokine signaling 7 HGNC:29846 details
hsa-miR-2052 RAD23B RAD23 homolog B, nucleotide excision repair protein HGNC:9813 details
hsa-miR-2052 MAP3K3 mitogen-activated protein kinase kinase kinase 3 HGNC:6855 details
hsa-miR-2052 HMGXB4 HMG-box containing 4 HGNC:5003 details
hsa-miR-2052 FYCO1 FYVE and coiled-coil domain autophagy adaptor 1 HGNC:14673 details
hsa-miR-2052 EDEM1 ER degradation enhancing alpha-mannosidase like protein 1 HGNC:18967 details
hsa-miR-2052 CBX1 chromobox 1 HGNC:1551 details
hsa-miR-2052 ANKRD27 ankyrin repeat domain 27 HGNC:25310 details
hsa-miR-2052 CORO1C coronin 1C HGNC:2254 details
hsa-miR-2052 ZNF28 zinc finger protein 28 HGNC:13073 details
hsa-miR-2052 RPLP0 ribosomal protein lateral stalk subunit P0 HGNC:10371 details
hsa-miR-2052 MED26 mediator complex subunit 26 HGNC:2376 details
hsa-miR-2052 DMD dystrophin HGNC:2928 details
hsa-miR-2052 TNFAIP6 TNF alpha induced protein 6 HGNC:11898 details
hsa-miR-2052 RPS16 ribosomal protein S16 HGNC:10396 details
hsa-miR-2052 C12orf73 chromosome 12 open reading frame 73 HGNC:34450 details
hsa-miR-2052 ZXDA zinc finger X-linked duplicated A HGNC:13198 details
hsa-miR-2052 GRK3 G protein-coupled receptor kinase 3 HGNC:290 details
hsa-miR-2052 ESD esterase D HGNC:3465 details
hsa-miR-2052 ZSCAN2 zinc finger and SCAN domain containing 2 HGNC:20994 details
hsa-miR-2052 MMAB metabolism of cobalamin associated B HGNC:19331 details
hsa-miR-2052 SF3A1 splicing factor 3a subunit 1 HGNC:10765 details
hsa-miR-2052 MDM2 MDM2 proto-oncogene HGNC:6973 details
hsa-miR-2052 FAM13B family with sequence similarity 13 member B HGNC:1335 details
hsa-miR-2052 RHOBTB3 Rho related BTB domain containing 3 HGNC:18757 details
hsa-miR-2052 HOOK3 hook microtubule tethering protein 3 HGNC:23576 details
hsa-miR-2052 FANCF FA complementation group F HGNC:3587 details
hsa-miR-2052 ZNF99 zinc finger protein 99 HGNC:13175 details
hsa-miR-2052 ZFAND1 zinc finger AN1-type containing 1 HGNC:25858 details
hsa-miR-2052 CERK ceramide kinase HGNC:19256 details
hsa-miR-2052 NR4A3 nuclear receptor subfamily 4 group A member 3 HGNC:7982 details
hsa-miR-2052 KMT2A lysine methyltransferase 2A HGNC:7132 details
hsa-miR-2052 GID4 GID complex subunit 4 homolog HGNC:28453 details
hsa-miR-2052 CHD9 chromodomain helicase DNA binding protein 9 HGNC:25701 details
hsa-miR-2052 ZNF799 zinc finger protein 799 HGNC:28071 details
hsa-miR-2052 QRFPR pyroglutamylated RFamide peptide receptor HGNC:15565 details
hsa-miR-2052 GTF2H5 general transcription factor IIH subunit 5 HGNC:21157 details
hsa-miR-2052 IL6R interleukin 6 receptor HGNC:6019 details
hsa-miR-2052 CMBL carboxymethylenebutenolidase homolog HGNC:25090 details
hsa-miR-2052 CACNB2 calcium voltage-gated channel auxiliary subunit beta 2 HGNC:1402 details
hsa-miR-2052 FAM200B family with sequence similarity 200 member B HGNC:27740 details
hsa-miR-2052 BCAS2 BCAS2 pre-mRNA processing factor HGNC:975 details
hsa-miR-2052 SOBP sine oculis binding protein homolog HGNC:29256 details
hsa-miR-2052 AP3B1 adaptor related protein complex 3 subunit beta 1 HGNC:566 details
hsa-miR-2052 GPR107 G protein-coupled receptor 107 HGNC:17830 details
hsa-miR-2052 NEMP2 nuclear envelope integral membrane protein 2 HGNC:33700 details
hsa-miR-2052 PRR14L proline rich 14 like HGNC:28738 details
hsa-miR-2052 TTL tubulin tyrosine ligase HGNC:21586 details
hsa-miR-2052 EOGT EGF domain specific O-linked N-acetylglucosamine transferase HGNC:28526 details
hsa-miR-2052 ERVMER34-1 endogenous retrovirus group MER34 member 1, envelope HGNC:42970 details
hsa-miR-2052 LPP LIM domain containing preferred translocation partner in lipoma HGNC:6679 details
hsa-miR-2052 SLC43A3 solute carrier family 43 member 3 HGNC:17466 details
hsa-miR-2052 ZEB1 zinc finger E-box binding homeobox 1 HGNC:11642 details
© 2021 Arieh Warshel Institute of Computational Biology, CUHK(SZ) | Designed by : Biomics Lab