miRNA Card

miRNA General Information
miRNA ID hsa-miR-219a-5p
Description Homo sapiens miR-219a-1 stem-loop
Comment This human miRNA was predicted by computational methods using conservation with mouse and Fugu rubripes sequences [1]. Expression of the 5' excised miR has been validated in zebrafish, and the 5' end mapped by PCR [2]. The mature products were later validated in human [3]. Two hairpin precursor structures are predicted, mir-219-1 on chromosome 6 (MIR:MI0000296) and mir-219-2 on chromosome 9 (MIR:MI0000740) [2].
Experiment cloned [3]
Sequence UGAUUGUCCAAACGCAAUUCU
miRNA Expression in different cancers

    by mir_boxplot.py

circRNA-miRNA-gene regulatory network

Note about Netwrok:
This is a network diagram with miRNA (purple circle) as the center.
We used three tools(PITA, miRanda, targetScan) to predict the binding sites of circrna (green circle) and miRNA. Accordingly, for this miRNA that binds to circrna, we have three confidence levels, namely confident 1, confident 2 and confident 3. Confidence value indicates how many tools can deduce these results. For each confidence, we use different kinds of dashed lines.

Target circRNA with confidence

Confidence 3 (3 of 3 tools predicted)

CircID miRNA PITA miRanda targetScan

Confidence 2 (2 of 3 tools predicted)

CircID miRNA PITA miRanda targetScan

Confidence 1 (1 of 3 tools predicted)

CircID miRNA PITA miRanda targetScan
chr22:20065629|20065837 hsa-miR-219a-5p 0 1 0
chr4:10075339|10075432 hsa-miR-219a-5p 0 1 0
chr20:32334647|32334765 hsa-miR-219a-5p 0 1 0
chr3:52477604|52477693 hsa-miR-219a-5p 0 1 0
chr4:10075339|10075467 hsa-miR-219a-5p 0 1 0
chrX:71574089|71574200 hsa-miR-219a-5p 0 1 0
chr3:122555286|122555407 hsa-miR-219a-5p 0 1 0
chr20:63943830|63943988 hsa-miR-219a-5p 0 1 0
chr20:46370463|46370525 hsa-miR-219a-5p 0 1 0
chr12:115975195~115975304 hsa-miR-219a-5p 0 1 0
chr9:137582646~137583045 hsa-miR-219a-5p 0 1 0
chr6:17625966~17626061 hsa-miR-219a-5p 0 1 0
chr17:759775~760059 hsa-miR-219a-5p 0 1 0
chr12:49763986~49764188 hsa-miR-219a-5p 0 1 0
chr19:12791953~12792152 hsa-miR-219a-5p 0 1 0
chr20:32334647~32334765 hsa-miR-219a-5p 0 1 0
chr20:46370443|46371384 hsa-miR-219a-5p 0 1 0
chr19:52640686|52640964 hsa-miR-219a-5p 0 1 0
chr17:58271816|58273515 hsa-miR-219a-5p 0 1 0
chr17:58271700|58273609 hsa-miR-219a-5p 0 1 0
chr2:178653238|178663902 hsa-miR-219a-5p 0 1 0
chr17:58273457|58273609 hsa-miR-219a-5p 0 1 0
chr17:58273437|58275668 hsa-miR-219a-5p 0 1 0
chr12:49764118|49764272 hsa-miR-219a-5p 0 1 0
chrX:65509013|65509349 hsa-miR-219a-5p 0 1 0
chr12:49763986|49764188 hsa-miR-219a-5p 0 1 0
chr4:154585919|154586100 hsa-miR-219a-5p 0 1 0
chr22:20065660|20065787 hsa-miR-219a-5p 0 1 0
chr7:140694537|140694662 hsa-miR-219a-5p 0 1 0
chr17:29166437|29166605 hsa-miR-219a-5p 0 1 0
chrX:63636649|63636750 hsa-miR-219a-5p 0 1 0
chr1:223738522|223738637 hsa-miR-219a-5p -10 1 0
chr6:158782558|158782737 hsa-miR-219a-5p -4 1 0
chr1:161158693|161158806 hsa-miR-219a-5p 0 1 0
chr6:159680811|159680896 hsa-miR-219a-5p 0 1 0
chr12:50082126|50082246 hsa-miR-219a-5p 0 1 0
chr12:49764040|49764195 hsa-miR-219a-5p 0 1 0
chr4:10075339|10075434 hsa-miR-219a-5p 0 1 0
chr17:2060635|2060821 hsa-miR-219a-5p 1 0 0
chr6:17625852|17626061 hsa-miR-219a-5p 1 0 0
Target genes
miRNA Gene Gene Description HGNC ID details
hsa-miR-219a-5p CAMK2G calcium/calmodulin dependent protein kinase II gamma HGNC:1463 details
hsa-miR-219a-5p GPC3 glypican 3 HGNC:4451 details
hsa-miR-219a-5p details
hsa-miR-219a-5p PSMD6 proteasome 26S subunit, non-ATPase 6 HGNC:9564 details
hsa-miR-219a-5p EGFR epidermal growth factor receptor HGNC:3236 details
hsa-miR-219a-5p SSH2 slingshot protein phosphatase 2 HGNC:30580 details
hsa-miR-219a-5p RPP14 ribonuclease P/MRP subunit p14 HGNC:30327 details
hsa-miR-219a-5p STARD7 StAR related lipid transfer domain containing 7 HGNC:18063 details
hsa-miR-219a-5p MDM4 MDM4 regulator of p53 HGNC:6974 details
hsa-miR-219a-5p UBE2V1 ubiquitin conjugating enzyme E2 V1 HGNC:12494 details
hsa-miR-219a-5p details
hsa-miR-219a-5p details
hsa-miR-219a-5p RASSF8 Ras association domain family member 8 HGNC:13232 details
hsa-miR-219a-5p CHD7 chromodomain helicase DNA binding protein 7 HGNC:20626 details
hsa-miR-219a-5p CLIP2 CAP-Gly domain containing linker protein 2 HGNC:2586 details
hsa-miR-219a-5p MOB4 MOB family member 4, phocein HGNC:17261 details
hsa-miR-219a-5p HSPE1-MOB4 HSPE1-MOB4 readthrough HGNC:49184 details
hsa-miR-219a-5p CEP19 centrosomal protein 19 HGNC:28209 details
hsa-miR-219a-5p ZBTB18 zinc finger and BTB domain containing 18 HGNC:13030 details
hsa-miR-219a-5p SHMT1 serine hydroxymethyltransferase 1 HGNC:10850 details
hsa-miR-219a-5p HMGA2 high mobility group AT-hook 2 HGNC:5009 details
hsa-miR-219a-5p GXYLT1 glucoside xylosyltransferase 1 HGNC:27482 details
hsa-miR-219a-5p BMS1 BMS1 ribosome biogenesis factor HGNC:23505 details
hsa-miR-219a-5p GPR176 G protein-coupled receptor 176 HGNC:32370 details
hsa-miR-219a-5p OIP5 Opa interacting protein 5 HGNC:20300 details
hsa-miR-219a-5p TOR1AIP1 torsin 1A interacting protein 1 HGNC:29456 details
hsa-miR-219a-5p PUM1 pumilio RNA binding family member 1 HGNC:14957 details
hsa-miR-219a-5p C8orf33 chromosome 8 open reading frame 33 HGNC:26104 details
hsa-miR-219a-5p ZNF460 zinc finger protein 460 HGNC:21628 details
hsa-miR-219a-5p ROBO1 roundabout guidance receptor 1 HGNC:10249 details
hsa-miR-219a-5p PCMT1 protein-L-isoaspartate (D-aspartate) O-methyltransferase HGNC:8728 details
hsa-miR-219a-5p FOXC1 forkhead box C1 HGNC:3800 details
hsa-miR-219a-5p QRFPR pyroglutamylated RFamide peptide receptor HGNC:15565 details
hsa-miR-219a-5p NCMAP non-compact myelin associated protein HGNC:29332 details
hsa-miR-219a-5p LIPC lipase C, hepatic type HGNC:6619 details
hsa-miR-219a-5p CHRM3 cholinergic receptor muscarinic 3 HGNC:1952 details
hsa-miR-219a-5p SATB2 SATB homeobox 2 HGNC:21637 details
hsa-miR-219a-5p RAB30 RAB30, member RAS oncogene family HGNC:9770 details
hsa-miR-219a-5p FLOT2 flotillin 2 HGNC:3758 details
hsa-miR-219a-5p MBNL1 muscleblind like splicing regulator 1 HGNC:6923 details
hsa-miR-219a-5p TRIB3 tribbles pseudokinase 3 HGNC:16228 details
hsa-miR-219a-5p MT1F metallothionein 1F HGNC:7398 details
hsa-miR-219a-5p SALL4 spalt like transcription factor 4 HGNC:15924 details
hsa-miR-219a-5p P2RX5 purinergic receptor P2X 5 HGNC:8536 details
hsa-miR-219a-5p details
hsa-miR-219a-5p RDH10 retinol dehydrogenase 10 HGNC:19975 details
hsa-miR-219a-5p ZNF268 zinc finger protein 268 HGNC:13061 details
© 2021 Arieh Warshel Institute of Computational Biology, CUHK(SZ) | Designed by : Biomics Lab