miRNA Card

miRNA General Information
miRNA ID hsa-miR-26a-2-3p
Description Homo sapiens miR-26a-2 stem-loop
Comment miR-26a was cloned from HeLa cells [1]. Two predicted hairpin precursor sequences are present on chromosome 3 (MIR:MI0000083) and 12 (MIR:MI0000750), each with homologues in mouse (MIR:MI0000573 and MIR:MI0000706). The mature sequence shown here represents the most commonly cloned form from large-scale cloning studies [6].
Experiment cloned [6]
Sequence CCUAUUCUUGAUUACUUGUUUC
miRNA Expression in different cancers

    by mir_boxplot.py

circRNA-miRNA-gene regulatory network

Note about Netwrok:
This is a network diagram with miRNA (purple circle) as the center.
We used three tools(PITA, miRanda, targetScan) to predict the binding sites of circrna (green circle) and miRNA. Accordingly, for this miRNA that binds to circrna, we have three confidence levels, namely confident 1, confident 2 and confident 3. Confidence value indicates how many tools can deduce these results. For each confidence, we use different kinds of dashed lines.

Target circRNA with confidence

Confidence 3 (3 of 3 tools predicted)

CircID miRNA PITA miRanda targetScan

Confidence 2 (2 of 3 tools predicted)

CircID miRNA PITA miRanda targetScan
chrX:65741497|65741671 hsa-miR-26a-2-3p 1 1 0

Confidence 1 (1 of 3 tools predicted)

CircID miRNA PITA miRanda targetScan
chr12:54350526|54350715 hsa-miR-26a-2-3p 0 1 0
chr11:18702490|18702612 hsa-miR-26a-2-3p 0 1 0
chr3:126021594|126021742 hsa-miR-26a-2-3p 0 1 0
chrX:77826726|77826921 hsa-miR-26a-2-3p 0 1 0
chr5:55164360|55164519 hsa-miR-26a-2-3p 0 1 0
chr7:95497178|95497272 hsa-miR-26a-2-3p 0 1 0
chr12:57820415|57820550 hsa-miR-26a-2-3p 0 1 0
chr20:17989982|17990141 hsa-miR-26a-2-3p 0 1 0
chr6:7585805|7585891 hsa-miR-26a-2-3p 0 1 0
chr12:6870055|6870311 hsa-miR-26a-2-3p 0 1 0
chr11:118601529|118601643 hsa-miR-26a-2-3p 0 1 0
chr6:30493453|30493609 hsa-miR-26a-2-3p 0 1 0
chr5:40982516|40982718 hsa-miR-26a-2-3p 0 1 0
chr2:237512487|237512657 hsa-miR-26a-2-3p 0 1 0
chr3:47418483|47418727 hsa-miR-26a-2-3p 0 1 0
chr6:30493391|30493617 hsa-miR-26a-2-3p 0 1 0
chr1:160213211|160213596 hsa-miR-26a-2-3p 0 1 0
chr6:30493379|30493493 hsa-miR-26a-2-3p 0 1 0
chr1:162527095|162527277 hsa-miR-26a-2-3p 0 1 0
chr1:159918204|159918596 hsa-miR-26a-2-3p 0 1 0
chrX:106942757~106943018 hsa-miR-26a-2-3p 0 1 0
chr4:163572183|163572306 hsa-miR-26a-2-3p 0 1 0
chr2:240481208|240481338 hsa-miR-26a-2-3p 0 1 0
chr14:55069384|55069506 hsa-miR-26a-2-3p 0 1 0
chr10:102109109|102109457 hsa-miR-26a-2-3p 0 1 0
chr16:85673812|85673945 hsa-miR-26a-2-3p 0 1 0
chr2:177234304|177234538 hsa-miR-26a-2-3p 0 1 0
chrX:85088750|85088877 hsa-miR-26a-2-3p 0 1 0
chr2:85314690|85314857 hsa-miR-26a-2-3p 0 1 0
chr20:2463530|2463652 hsa-miR-26a-2-3p 1 0 0
chr11:62796132|62796515 hsa-miR-26a-2-3p 0 1 0
chr19:58352947|58353111 hsa-miR-26a-2-3p 0 1 0
chr3:195287113|195287222 hsa-miR-26a-2-3p 0 1 0
chr6:72744046|72744199 hsa-miR-26a-2-3p 0 1 0
chr2:178653238|178663902 hsa-miR-26a-2-3p 0 1 0
chr11:78216521|78216663 hsa-miR-26a-2-3p 0 1 0
chr16:60034440|60034570 hsa-miR-26a-2-3p 0 1 0
chr11:121633204|121633391 hsa-miR-26a-2-3p 0 1 0
chr6:127289424|127289571 hsa-miR-26a-2-3p 0 1 0
chr17:57006185|57006281 hsa-miR-26a-2-3p 0 1 0
chr12:71700895|71701015 hsa-miR-26a-2-3p 0 1 0
chr17:35264354|35264504 hsa-miR-26a-2-3p 0 1 0
chr6:30493435|30493609 hsa-miR-26a-2-3p 0 1 0
chr1:23802278|23802414 hsa-miR-26a-2-3p 0 1 0
chr7:45913415|45913516 hsa-miR-26a-2-3p 0 1 0
chr3:47418480|47418727 hsa-miR-26a-2-3p 0 1 0
chr11:118601506|118601643 hsa-miR-26a-2-3p 0 1 0
chr6:127289452|127289566 hsa-miR-26a-2-3p 0 1 0
chr7:45913415|45913664 hsa-miR-26a-2-3p 0 1 0
chr6:127289424|127289584 hsa-miR-26a-2-3p 0 1 0
chr16:67288917|67289149 hsa-miR-26a-2-3p 0 1 0
chr6:138943513|138944622 hsa-miR-26a-2-3p 0 1 0
chr1:100424222|100442996 hsa-miR-26a-2-3p 0 1 0
chr1:179095464|179095557 hsa-miR-26a-2-3p 0 1 0
chr16:286583|286735 hsa-miR-26a-2-3p 0 1 0
chr5:42991594|42991751 hsa-miR-26a-2-3p 0 1 0
chr5:42991594|42991755 hsa-miR-26a-2-3p 0 1 0
chr15:40331936|40332066 hsa-miR-26a-2-3p 0 1 0
chr1:26468337|26468505 hsa-miR-26a-2-3p 0 1 0
chr17:78794508|78794640 hsa-miR-26a-2-3p 0 1 0
chr2:219500465|219500630 hsa-miR-26a-2-3p 0 1 0
chr1:40690672|40690814 hsa-miR-26a-2-3p 0 1 0
chr8:143576767|143577135 hsa-miR-26a-2-3p -1 1 0
chr16:28834541|28834693 hsa-miR-26a-2-3p -5 1 0
chr1:179095372|179095557 hsa-miR-26a-2-3p 0 1 0
chr3:49531106|49531279 hsa-miR-26a-2-3p 0 1 0
chr11:8707835|8711203 hsa-miR-26a-2-3p 0 1 0
chr12:120100090|120100301 hsa-miR-26a-2-3p 0 1 0
chr12:71700884|71701015 hsa-miR-26a-2-3p 0 1 0
chr1:179095466|179095557 hsa-miR-26a-2-3p 0 1 0
chr17:4552440|4552539 hsa-miR-26a-2-3p 0 1 0
chr22:30975181|30975309 hsa-miR-26a-2-3p 0 1 0
chr12:71700832|71701015 hsa-miR-26a-2-3p 0 1 0
chr3:49531111|49531279 hsa-miR-26a-2-3p 0 1 0
chr8:143576771|143577135 hsa-miR-26a-2-3p 0 1 0
chr3:185483453|185483569 hsa-miR-26a-2-3p 0 1 0
chr1:113403905|113404195 hsa-miR-26a-2-3p 0 1 0
chr17:4552182|4552518 hsa-miR-26a-2-3p 0 1 0
chr22:41867083|41867280 hsa-miR-26a-2-3p 0 1 0
chr12:6870055|6870333 hsa-miR-26a-2-3p 0 1 0
chr10:99880056|99880207 hsa-miR-26a-2-3p 0 1 0
chr11:130876554|130876676 hsa-miR-26a-2-3p 0 1 0
chr15:72583267|72583466 hsa-miR-26a-2-3p 0 1 0
Target genes
miRNA Gene Gene Description HGNC ID details
hsa-miR-26a-2-3p SYCE1 synaptonemal complex central element protein 1 HGNC:28852 details
hsa-miR-26a-2-3p FER FER tyrosine kinase HGNC:3655 details
hsa-miR-26a-2-3p HBS1L HBS1 like translational GTPase HGNC:4834 details
hsa-miR-26a-2-3p ABHD2 abhydrolase domain containing 2, acylglycerol lipase HGNC:18717 details
hsa-miR-26a-2-3p LRPPRC leucine rich pentatricopeptide repeat containing HGNC:15714 details
hsa-miR-26a-2-3p details
hsa-miR-26a-2-3p MCOLN2 mucolipin TRP cation channel 2 HGNC:13357 details
hsa-miR-26a-2-3p INTS2 integrator complex subunit 2 HGNC:29241 details
hsa-miR-26a-2-3p USP42 ubiquitin specific peptidase 42 HGNC:20068 details
hsa-miR-26a-2-3p ZNF695 zinc finger protein 695 HGNC:30954 details
hsa-miR-26a-2-3p UTRN utrophin HGNC:12635 details
hsa-miR-26a-2-3p IYD iodotyrosine deiodinase HGNC:21071 details
hsa-miR-26a-2-3p CYTIP cytohesin 1 interacting protein HGNC:9506 details
hsa-miR-26a-2-3p STX7 syntaxin 7 HGNC:11442 details
hsa-miR-26a-2-3p SHISA6 shisa family member 6 HGNC:34491 details
hsa-miR-26a-2-3p AAK1 AP2 associated kinase 1 HGNC:19679 details
hsa-miR-26a-2-3p UPP2 uridine phosphorylase 2 HGNC:23061 details
hsa-miR-26a-2-3p CSRNP3 cysteine and serine rich nuclear protein 3 HGNC:30729 details
hsa-miR-26a-2-3p ZBTB18 zinc finger and BTB domain containing 18 HGNC:13030 details
hsa-miR-26a-2-3p BIRC5 baculoviral IAP repeat containing 5 HGNC:593 details
hsa-miR-26a-2-3p RPL36A-HNRNPH2 RPL36A-HNRNPH2 readthrough HGNC:48349 details
hsa-miR-26a-2-3p details
hsa-miR-26a-2-3p GABRG2 gamma-aminobutyric acid type A receptor subunit gamma2 HGNC:4087 details
hsa-miR-26a-2-3p RBM20 RNA binding motif protein 20 HGNC:27424 details
hsa-miR-26a-2-3p PTEN phosphatase and tensin homolog HGNC:9588 details
hsa-miR-26a-2-3p SRSF7 serine and arginine rich splicing factor 7 HGNC:10789 details
hsa-miR-26a-2-3p ZNF652 zinc finger protein 652 HGNC:29147 details
hsa-miR-26a-2-3p KDELR1 KDEL endoplasmic reticulum protein retention receptor 1 HGNC:6304 details
hsa-miR-26a-2-3p GABRB1 gamma-aminobutyric acid type A receptor subunit beta1 HGNC:4081 details
hsa-miR-26a-2-3p ZKSCAN2 zinc finger with KRAB and SCAN domains 2 HGNC:25677 details
hsa-miR-26a-2-3p SCOC short coiled-coil protein HGNC:20335 details
hsa-miR-26a-2-3p CCDC149 coiled-coil domain containing 149 HGNC:25405 details
hsa-miR-26a-2-3p SAR1A secretion associated Ras related GTPase 1A HGNC:10534 details
hsa-miR-26a-2-3p PLSCR1 phospholipid scramblase 1 HGNC:9092 details
hsa-miR-26a-2-3p details
hsa-miR-26a-2-3p ASB16 ankyrin repeat and SOCS box containing 16 HGNC:19768 details
hsa-miR-26a-2-3p ZNF48 zinc finger protein 48 HGNC:13114 details
hsa-miR-26a-2-3p TAB1 TGF-beta activated kinase 1 (MAP3K7) binding protein 1 HGNC:18157 details
hsa-miR-26a-2-3p SOWAHC sosondowah ankyrin repeat domain family member C HGNC:26149 details
hsa-miR-26a-2-3p PKN2 protein kinase N2 HGNC:9406 details
hsa-miR-26a-2-3p PHF13 PHD finger protein 13 HGNC:22983 details
hsa-miR-26a-2-3p GOSR1 golgi SNAP receptor complex member 1 HGNC:4430 details
hsa-miR-26a-2-3p DEPTOR DEP domain containing MTOR interacting protein HGNC:22953 details
hsa-miR-26a-2-3p KANK2 KN motif and ankyrin repeat domains 2 HGNC:29300 details
hsa-miR-26a-2-3p ZNF326 zinc finger protein 326 HGNC:14104 details
hsa-miR-26a-2-3p FGFBP3 fibroblast growth factor binding protein 3 HGNC:23428 details
hsa-miR-26a-2-3p LANCL3 LanC like 3 HGNC:24767 details
hsa-miR-26a-2-3p ZNF573 zinc finger protein 573 HGNC:26420 details
hsa-miR-26a-2-3p TIMM29 translocase of inner mitochondrial membrane 29 HGNC:25152 details
hsa-miR-26a-2-3p ZBTB10 zinc finger and BTB domain containing 10 HGNC:30953 details
hsa-miR-26a-2-3p ANP32B acidic nuclear phosphoprotein 32 family member B HGNC:16677 details
hsa-miR-26a-2-3p HNRNPA3 heterogeneous nuclear ribonucleoprotein A3 HGNC:24941 details
hsa-miR-26a-2-3p PPIP5K2 diphosphoinositol pentakisphosphate kinase 2 HGNC:29035 details
hsa-miR-26a-2-3p NLN neurolysin HGNC:16058 details
hsa-miR-26a-2-3p PRKCH protein kinase C eta HGNC:9403 details
hsa-miR-26a-2-3p KMT2A lysine methyltransferase 2A HGNC:7132 details
hsa-miR-26a-2-3p SYT17 synaptotagmin 17 HGNC:24119 details
hsa-miR-26a-2-3p WSB2 WD repeat and SOCS box containing 2 HGNC:19222 details
hsa-miR-26a-2-3p CEP126 centrosomal protein 126 HGNC:29264 details
hsa-miR-26a-2-3p AFF2 AF4/FMR2 family member 2 HGNC:3776 details
© 2021 Arieh Warshel Institute of Computational Biology, CUHK(SZ) | Designed by : Biomics Lab