miRNA Card

miRNA General Information
miRNA ID hsa-miR-30c-5p
Description Homo sapiens miR-30c-2 stem-loop
Comment miR-30c was cloned from mouse heart and brain tissues by Lagos-Quintana et al. [1]. Two human hairpin precursor sequences are predicted based on homology with the mouse sequences, on chromosomes 1 (MIR:MI0000736) and 6 (MIR:MI0000254) [3]. Expression of miR-30c was later independently verified in human HL-60 leukemia cells [2].
Experiment cloned [2,4-6]
Sequence UGUAAACAUCCUACACUCUCAGC
miRNA Expression in different cancers

    by mir_boxplot.py

circRNA-miRNA-gene regulatory network

Note about Netwrok:
This is a network diagram with miRNA (purple circle) as the center.
We used three tools(PITA, miRanda, targetScan) to predict the binding sites of circrna (green circle) and miRNA. Accordingly, for this miRNA that binds to circrna, we have three confidence levels, namely confident 1, confident 2 and confident 3. Confidence value indicates how many tools can deduce these results. For each confidence, we use different kinds of dashed lines.

Target circRNA with confidence

Confidence 3 (3 of 3 tools predicted)

CircID miRNA PITA miRanda targetScan

Confidence 2 (2 of 3 tools predicted)

CircID miRNA PITA miRanda targetScan
chr16:4266758|4266887 hsa-miR-30c-5p 1 1 0
chr12:56590328|56590505 hsa-miR-30c-5p 1 1 0

Confidence 1 (1 of 3 tools predicted)

CircID miRNA PITA miRanda targetScan
chr10:127444158|127447434 hsa-miR-30c-5p 1 0 0
chr11:62271030|62273121 hsa-miR-30c-5p 0 1 0
chr19:52950458|52950644 hsa-miR-30c-5p 0 1 0
chr14:91869686|91869811 hsa-miR-30c-5p 0 1 0
chr3:51663115|51663227 hsa-miR-30c-5p 0 1 0
chr1:37708933|37709142 hsa-miR-30c-5p 0 1 0
chr11:62271030|62273008 hsa-miR-30c-5p 0 1 0
chr8:60623550|60623820 hsa-miR-30c-5p 0 1 0
chr11:62524459|62524680 hsa-miR-30c-5p 0 1 0
chr12:2691870|2692034 hsa-miR-30c-5p 0 1 0
chr11:62270993|62273008 hsa-miR-30c-5p 0 1 0
chr22:23894399|23894582 hsa-miR-30c-5p 0 1 0
chr22:23894385|23894582 hsa-miR-30c-5p 0 1 0
chr11:62271044|62273121 hsa-miR-30c-5p 0 1 0
chr12:48771749|48771847 hsa-miR-30c-5p 0 1 0
chr11:119048310|119048538 hsa-miR-30c-5p 0 1 0
chr1:171584062|171584155 hsa-miR-30c-5p 0 1 0
chr6:41067065|41067273 hsa-miR-30c-5p 0 1 0
chr22:39973069|39973256 hsa-miR-30c-5p 0 1 0
chr19:45303075|45303246 hsa-miR-30c-5p 0 1 0
chr17:39663004|39663209 hsa-miR-30c-5p 0 1 0
chr6:43011859|43011990 hsa-miR-30c-5p 0 1 0
chr4:335341|335532 hsa-miR-30c-5p 0 1 0
chr2:152759992|152760301 hsa-miR-30c-5p 0 1 0
chrX:49079795|49079897 hsa-miR-30c-5p 0 1 0
chr3:47017050|47017168 hsa-miR-30c-5p 0 1 0
chr17:39663083|39663283 hsa-miR-30c-5p 0 1 0
chr11:216471|216572 hsa-miR-30c-5p 0 1 0
chr2:214932078|214932199 hsa-miR-30c-5p 0 1 0
chrX:2740917|2741069 hsa-miR-30c-5p 0 1 0
chr1:225487672|225487846 hsa-miR-30c-5p 0 1 0
chr5:181237609|181238239 hsa-miR-30c-5p 0 1 0
chr22:23894396|23894582 hsa-miR-30c-5p 0 1 0
chr11:77322120|77322275 hsa-miR-30c-5p 0 1 0
chr16:87360449|87360570 hsa-miR-30c-5p 0 1 0
chr16:5024936|5025031 hsa-miR-30c-5p 0 1 0
chr11:62271030|62273047 hsa-miR-30c-5p 0 1 0
chr11:62270945|62273008 hsa-miR-30c-5p 0 1 0
chr5:181238133|181238239 hsa-miR-30c-5p 0 1 0
chr11:62524459|62524570 hsa-miR-30c-5p 0 1 0
chr11:62271030|62273057 hsa-miR-30c-5p 0 1 0
chr18:59330691|59330765 hsa-miR-30c-5p 0 1 0
chr13:50015797~50015945 hsa-miR-30c-5p 0 1 0
chr1:150003630~150003763 hsa-miR-30c-5p 0 1 0
chr1:171584062~171584155 hsa-miR-30c-5p 0 1 0
chr11:62271030~62273121 hsa-miR-30c-5p 0 1 0
chr11:62271044~62273121 hsa-miR-30c-5p 0 1 0
chr11:62270993~62273008 hsa-miR-30c-5p 0 1 0
chr2:99550224~99550371 hsa-miR-30c-5p 0 1 0
chr5:151028216~151028386 hsa-miR-30c-5p 0 1 0
chr22:23894385~23894582 hsa-miR-30c-5p 0 1 0
chr6:43132101~43132484 hsa-miR-30c-5p 0 1 0
chr20:32444010~32444194 hsa-miR-30c-5p 0 1 0
chr17:35726092~35726243 hsa-miR-30c-5p 0 1 0
chr1:10419986~10420083 hsa-miR-30c-5p 0 1 0
chr12:6749868~6750237 hsa-miR-30c-5p 0 1 0
chr17:28716601~28716862 hsa-miR-30c-5p 0 1 0
chr9:121085526|121085734 hsa-miR-30c-5p 1 0 0
chr9:38397132|38397260 hsa-miR-30c-5p 0 1 0
chr1:27478839|27478985 hsa-miR-30c-5p 0 1 0
chr22:16652559|16652666 hsa-miR-30c-5p 0 1 0
chr19:52950542|52950672 hsa-miR-30c-5p 0 1 0
chr11:32095805|32096009 hsa-miR-30c-5p 0 1 0
chr20:59257155|59257284 hsa-miR-30c-5p 0 1 0
chr13:50015813|50015945 hsa-miR-30c-5p 0 1 0
chr17:57491225|57491388 hsa-miR-30c-5p 0 1 0
chr9:120833312|120833420 hsa-miR-30c-5p 1 0 0
chr2:96184973|96185116 hsa-miR-30c-5p 1 0 0
chr7:2662980|2663123 hsa-miR-30c-5p 0 1 0
chr1:171583993|171584155 hsa-miR-30c-5p 0 1 0
chr1:161039339|161039466 hsa-miR-30c-5p 0 1 0
chr3:4984978|4985078 hsa-miR-30c-5p 0 1 0
chr1:155253667|155253969 hsa-miR-30c-5p 0 1 0
chr11:10799884|10800089 hsa-miR-30c-5p 0 1 0
chr12:46184319|46184501 hsa-miR-30c-5p 0 1 0
chr9:33948374|33948587 hsa-miR-30c-5p 0 1 0
chr16:5024936|5025042 hsa-miR-30c-5p 0 1 0
chr1:10419885|10420083 hsa-miR-30c-5p 0 1 0
chr3:50258912|50259076 hsa-miR-30c-5p 0 1 0
chr17:4718270|4718662 hsa-miR-30c-5p 0 1 0
chr10:27165064|27165539 hsa-miR-30c-5p 0 1 0
chr6:170534740|170534946 hsa-miR-30c-5p 0 1 0
chrX:104190159|104190367 hsa-miR-30c-5p 0 1 0
chr14:73711987|73712100 hsa-miR-30c-5p 0 1 0
chr3:50258967|50259185 hsa-miR-30c-5p 0 1 0
chr8:101667315|101667407 hsa-miR-30c-5p 0 1 0
chr12:55827640|55827803 hsa-miR-30c-5p 0 1 0
chr1:26777349|26777565 hsa-miR-30c-5p 0 1 0
chr19:55060206|55060312 hsa-miR-30c-5p 0 1 0
chr4:1979798|1980062 hsa-miR-30c-5p 0 1 0
chr1:29055104|29055228 hsa-miR-30c-5p 0 1 0
chr17:19666003|19666155 hsa-miR-30c-5p 0 1 0
chr7:66948548|66948686 hsa-miR-30c-5p 0 1 0
chr3:126472882|126473043 hsa-miR-30c-5p 0 1 0
chr1:26777250|26777565 hsa-miR-30c-5p 0 1 0
chr16:10528709|10528885 hsa-miR-30c-5p 0 1 0
chr16:5024936|5025047 hsa-miR-30c-5p 0 1 0
chr16:672270|672539 hsa-miR-30c-5p 0 1 0
chr5:151028216|151028386 hsa-miR-30c-5p -10 1 0
chr22:23894411|23894582 hsa-miR-30c-5p 6 1 0
chr1:10419768|10420068 hsa-miR-30c-5p -6 1 0
chr19:51014516|51014738 hsa-miR-30c-5p -15 1 0
chr1:86559932|86560244 hsa-miR-30c-5p 1 0 0
chr15:80917568|80917758 hsa-miR-30c-5p 0 1 0
chr17:28346117|28346233 hsa-miR-30c-5p 0 1 0
chr16:67723942|67724041 hsa-miR-30c-5p 0 1 0
chr1:1400812|1401070 hsa-miR-30c-5p 0 1 0
chr15:72199077|72199182 hsa-miR-30c-5p 0 1 0
chr13:50015791|50015945 hsa-miR-30c-5p 0 1 0
chr3:51663155|51663240 hsa-miR-30c-5p 0 1 0
chr1:10419922|10420085 hsa-miR-30c-5p 0 1 0
chr8:8784700|8784840 hsa-miR-30c-5p 0 1 0
chrX:15700723|15700826 hsa-miR-30c-5p 0 1 0
chr12:12099352|12099507 hsa-miR-30c-5p 0 1 0
chr5:157789363|157789506 hsa-miR-30c-5p 0 1 0
chr11:119048302|119048522 hsa-miR-30c-5p 0 1 0
chr11:114313729|114313925 hsa-miR-30c-5p 0 1 0
chr4:40425131|40425337 hsa-miR-30c-5p 0 1 0
chr17:63832381|63832642 hsa-miR-30c-5p 0 1 0
chr5:108364738|108364957 hsa-miR-30c-5p 0 1 0
chr3:50258848|50259076 hsa-miR-30c-5p 0 1 0
chr11:66846244|66846359 hsa-miR-30c-5p 0 1 0
chr2:101004742|101004921 hsa-miR-30c-5p 1 0 0
Target genes
miRNA Gene Gene Description HGNC ID details
hsa-miR-30c-5p MUC17 mucin 17, cell surface associated HGNC:16800 details
hsa-miR-30c-5p UBE2I ubiquitin conjugating enzyme E2 I HGNC:12485 details
hsa-miR-30c-5p SERPINE1 serpin family E member 1 HGNC:8583 details
hsa-miR-30c-5p SNAI1 snail family transcriptional repressor 1 HGNC:11128 details
hsa-miR-30c-5p SMAD1 SMAD family member 1 HGNC:6767 details
hsa-miR-30c-5p HSPA4 heat shock protein family A (Hsp70) member 4 HGNC:5237 details
hsa-miR-30c-5p TGIF2 TGFB induced factor homeobox 2 HGNC:15764 details
hsa-miR-30c-5p HDAC4 histone deacetylase 4 HGNC:14063 details
hsa-miR-30c-5p SOCS3 suppressor of cytokine signaling 3 HGNC:19391 details
hsa-miR-30c-5p CUL2 cullin 2 HGNC:2552 details
hsa-miR-30c-5p NEDD4 NEDD4 E3 ubiquitin protein ligase HGNC:7727 details
hsa-miR-30c-5p SOCS1 suppressor of cytokine signaling 1 HGNC:19383 details
hsa-miR-30c-5p ITGB3 integrin subunit beta 3 HGNC:6156 details
hsa-miR-30c-5p ARHGEF6 Rac/Cdc42 guanine nucleotide exchange factor 6 HGNC:685 details
hsa-miR-30c-5p ITGA4 integrin subunit alpha 4 HGNC:6140 details
hsa-miR-30c-5p PIK3R2 phosphoinositide-3-kinase regulatory subunit 2 HGNC:8980 details
hsa-miR-30c-5p VIM vimentin HGNC:12692 details
hsa-miR-30c-5p TWF1 twinfilin actin binding protein 1 HGNC:9620 details
hsa-miR-30c-5p HMG20A high mobility group 20A HGNC:5001 details
hsa-miR-30c-5p ECT2 epithelial cell transforming 2 HGNC:3155 details
hsa-miR-30c-5p KCTD3 potassium channel tetramerization domain containing 3 HGNC:21305 details
hsa-miR-30c-5p HNRNPK heterogeneous nuclear ribonucleoprotein K HGNC:5044 details
hsa-miR-30c-5p TRA2A transformer 2 alpha homolog HGNC:16645 details
hsa-miR-30c-5p CAMKV CaM kinase like vesicle associated HGNC:28788 details
hsa-miR-30c-5p details
hsa-miR-30c-5p SEMA6A semaphorin 6A HGNC:10738 details
hsa-miR-30c-5p SCN11A sodium voltage-gated channel alpha subunit 11 HGNC:10583 details
hsa-miR-30c-5p E2F3 E2F transcription factor 3 HGNC:3115 details
hsa-miR-30c-5p UBXN1 UBX domain protein 1 HGNC:18402 details
hsa-miR-30c-5p TRA2B transformer 2 beta homolog HGNC:10781 details
hsa-miR-30c-5p PAM peptidylglycine alpha-amidating monooxygenase HGNC:8596 details
hsa-miR-30c-5p CHD1 chromodomain helicase DNA binding protein 1 HGNC:1915 details
hsa-miR-30c-5p UBE3C ubiquitin protein ligase E3C HGNC:16803 details
hsa-miR-30c-5p MED1 mediator complex subunit 1 HGNC:9234 details
hsa-miR-30c-5p TTC19 tetratricopeptide repeat domain 19 HGNC:26006 details
hsa-miR-30c-5p TM9SF3 transmembrane 9 superfamily member 3 HGNC:21529 details
hsa-miR-30c-5p PNKD PNKD metallo-beta-lactamase domain containing HGNC:9153 details
hsa-miR-30c-5p FEM1B fem-1 homolog B HGNC:3649 details
hsa-miR-30c-5p CSDE1 cold shock domain containing E1 HGNC:29905 details
hsa-miR-30c-5p RTN4 reticulon 4 HGNC:14085 details
hsa-miR-30c-5p TBL1XR1 TBL1X receptor 1 HGNC:29529 details
hsa-miR-30c-5p PRKAB2 protein kinase AMP-activated non-catalytic subunit beta 2 HGNC:9379 details
hsa-miR-30c-5p CPOX coproporphyrinogen oxidase HGNC:2321 details
hsa-miR-30c-5p ABCE1 ATP binding cassette subfamily E member 1 HGNC:69 details
hsa-miR-30c-5p IKZF4 IKAROS family zinc finger 4 HGNC:13179 details
hsa-miR-30c-5p SLC25A12 solute carrier family 25 member 12 HGNC:10982 details
hsa-miR-30c-5p LACTB2 lactamase beta 2 HGNC:18512 details
hsa-miR-30c-5p RNPS1 RNA binding protein with serine rich domain 1 HGNC:10080 details
hsa-miR-30c-5p HNRNPDL heterogeneous nuclear ribonucleoprotein D like HGNC:5037 details
hsa-miR-30c-5p CSF1 colony stimulating factor 1 HGNC:2432 details
hsa-miR-30c-5p CAPZA1 capping actin protein of muscle Z-line subunit alpha 1 HGNC:1488 details
hsa-miR-30c-5p UBE2D2 ubiquitin conjugating enzyme E2 D2 HGNC:12475 details
hsa-miR-30c-5p GDI2 GDP dissociation inhibitor 2 HGNC:4227 details
hsa-miR-30c-5p LIMA1 LIM domain and actin binding 1 HGNC:24636 details
hsa-miR-30c-5p PKM pyruvate kinase M1/2 HGNC:9021 details
hsa-miR-30c-5p DPYSL2 dihydropyrimidinase like 2 HGNC:3014 details
hsa-miR-30c-5p CEP152 centrosomal protein 152 HGNC:29298 details
hsa-miR-30c-5p GTF3C3 general transcription factor IIIC subunit 3 HGNC:4666 details
hsa-miR-30c-5p OTP orthopedia homeobox HGNC:8518 details
hsa-miR-30c-5p EEF1A1 eukaryotic translation elongation factor 1 alpha 1 HGNC:3189 details
hsa-miR-30c-5p AGPAT5 1-acylglycerol-3-phosphate O-acyltransferase 5 HGNC:20886 details
hsa-miR-30c-5p details
hsa-miR-30c-5p HUS1 HUS1 checkpoint clamp component HGNC:5309 details
hsa-miR-30c-5p CDH1 cadherin 1 HGNC:1748 details
hsa-miR-30c-5p ABI2 abl interactor 2 HGNC:24011 details
hsa-miR-30c-5p TNRC6A trinucleotide repeat containing adaptor 6A HGNC:11969 details
hsa-miR-30c-5p ATP6V1C1 ATPase H+ transporting V1 subunit C1 HGNC:856 details
hsa-miR-30c-5p RPL39 ribosomal protein L39 HGNC:10350 details
hsa-miR-30c-5p TMEM120B transmembrane protein 120B HGNC:32008 details
hsa-miR-30c-5p MGLL monoglyceride lipase HGNC:17038 details
hsa-miR-30c-5p details
hsa-miR-30c-5p SUZ12 SUZ12 polycomb repressive complex 2 subunit HGNC:17101 details
hsa-miR-30c-5p EIF2S3 eukaryotic translation initiation factor 2 subunit gamma HGNC:3267 details
hsa-miR-30c-5p SNX2 sorting nexin 2 HGNC:11173 details
hsa-miR-30c-5p MGAT2 alpha-1,6-mannosyl-glycoprotein 2-beta-N-acetylglucosaminyltransferase HGNC:7045 details
hsa-miR-30c-5p DNAJB14 DnaJ heat shock protein family (Hsp40) member B14 HGNC:25881 details
hsa-miR-30c-5p RRM2 ribonucleotide reductase regulatory subunit M2 HGNC:10452 details
hsa-miR-30c-5p PARVG parvin gamma HGNC:14654 details
hsa-miR-30c-5p BLMH bleomycin hydrolase HGNC:1059 details
hsa-miR-30c-5p HERC4 HECT and RLD domain containing E3 ubiquitin protein ligase 4 HGNC:24521 details
hsa-miR-30c-5p ARF1 ADP ribosylation factor 1 HGNC:652 details
hsa-miR-30c-5p SCD5 stearoyl-CoA desaturase 5 HGNC:21088 details
hsa-miR-30c-5p SOX4 SRY-box transcription factor 4 HGNC:11200 details
hsa-miR-30c-5p PPP1R12A protein phosphatase 1 regulatory subunit 12A HGNC:7618 details
hsa-miR-30c-5p PTAR1 protein prenyltransferase alpha subunit repeat containing 1 HGNC:30449 details
hsa-miR-30c-5p AIFM1 apoptosis inducing factor mitochondria associated 1 HGNC:8768 details
hsa-miR-30c-5p KREMEN1 kringle containing transmembrane protein 1 HGNC:17550 details
hsa-miR-30c-5p RASA1 RAS p21 protein activator 1 HGNC:9871 details
hsa-miR-30c-5p ZNF506 zinc finger protein 506 HGNC:23780 details
hsa-miR-30c-5p STARD7 StAR related lipid transfer domain containing 7 HGNC:18063 details
hsa-miR-30c-5p details
hsa-miR-30c-5p MRPS16 mitochondrial ribosomal protein S16 HGNC:14048 details
hsa-miR-30c-5p PRCP prolylcarboxypeptidase HGNC:9344 details
hsa-miR-30c-5p HNRNPC heterogeneous nuclear ribonucleoprotein C HGNC:5035 details
hsa-miR-30c-5p ZNF668 zinc finger protein 668 HGNC:25821 details
hsa-miR-30c-5p RAB18 RAB18, member RAS oncogene family HGNC:14244 details
hsa-miR-30c-5p MXI1 MAX interactor 1, dimerization protein HGNC:7534 details
hsa-miR-30c-5p ETS1 ETS proto-oncogene 1, transcription factor HGNC:3488 details
hsa-miR-30c-5p CTSC cathepsin C HGNC:2528 details
hsa-miR-30c-5p RPL27A ribosomal protein L27a HGNC:10329 details
hsa-miR-30c-5p KMT2D lysine methyltransferase 2D HGNC:7133 details
hsa-miR-30c-5p RPS3 ribosomal protein S3 HGNC:10420 details
hsa-miR-30c-5p TKT transketolase HGNC:11834 details
hsa-miR-30c-5p MATR3 matrin 3 HGNC:6912 details
hsa-miR-30c-5p KLHL15 kelch like family member 15 HGNC:29347 details
hsa-miR-30c-5p NEDD9 neural precursor cell expressed, developmentally down-regulated 9 HGNC:7733 details
hsa-miR-30c-5p DHX8 DEAH-box helicase 8 HGNC:2749 details
hsa-miR-30c-5p MAP2K1 mitogen-activated protein kinase kinase 1 HGNC:6840 details
hsa-miR-30c-5p UXT ubiquitously expressed prefoldin like chaperone HGNC:12641 details
hsa-miR-30c-5p HMGA1 high mobility group AT-hook 1 HGNC:5010 details
hsa-miR-30c-5p CSNK1E casein kinase 1 epsilon HGNC:2453 details
hsa-miR-30c-5p USP37 ubiquitin specific peptidase 37 HGNC:20063 details
hsa-miR-30c-5p MTPAP mitochondrial poly(A) polymerase HGNC:25532 details
hsa-miR-30c-5p APLN apelin HGNC:16665 details
hsa-miR-30c-5p IPO9 importin 9 HGNC:19425 details
hsa-miR-30c-5p RBM3 RNA binding motif protein 3 HGNC:9900 details
hsa-miR-30c-5p JUP junction plakoglobin HGNC:6207 details
hsa-miR-30c-5p DDOST dolichyl-diphosphooligosaccharide--protein glycosyltransferase non-catalytic subunit HGNC:2728 details
hsa-miR-30c-5p PFN1 profilin 1 HGNC:8881 details
hsa-miR-30c-5p ARFGAP1 ADP ribosylation factor GTPase activating protein 1 HGNC:15852 details
hsa-miR-30c-5p REXO2 RNA exonuclease 2 HGNC:17851 details
hsa-miR-30c-5p PPM1H protein phosphatase, Mg2+/Mn2+ dependent 1H HGNC:18583 details
hsa-miR-30c-5p CCDC117 coiled-coil domain containing 117 HGNC:26599 details
hsa-miR-30c-5p AGO1 argonaute RISC component 1 HGNC:3262 details
hsa-miR-30c-5p HMGXB4 HMG-box containing 4 HGNC:5003 details
hsa-miR-30c-5p SMARCE1 SWI/SNF related, matrix associated, actin dependent regulator of chromatin, subfamily e, member 1 HGNC:11109 details
hsa-miR-30c-5p NFYB nuclear transcription factor Y subunit beta HGNC:7805 details
hsa-miR-30c-5p RPL32 ribosomal protein L32 HGNC:10336 details
hsa-miR-30c-5p SLC39A1 solute carrier family 39 member 1 HGNC:12876 details
hsa-miR-30c-5p BIRC5 baculoviral IAP repeat containing 5 HGNC:593 details
hsa-miR-30c-5p WDR5 WD repeat domain 5 HGNC:12757 details
hsa-miR-30c-5p DDB1 damage specific DNA binding protein 1 HGNC:2717 details
hsa-miR-30c-5p SNRNP40 small nuclear ribonucleoprotein U5 subunit 40 HGNC:30857 details
hsa-miR-30c-5p KLC2 kinesin light chain 2 HGNC:20716 details
hsa-miR-30c-5p MTCH2 mitochondrial carrier 2 HGNC:17587 details
hsa-miR-30c-5p STARD5 StAR related lipid transfer domain containing 5 HGNC:18065 details
hsa-miR-30c-5p RAPGEFL1 Rap guanine nucleotide exchange factor like 1 HGNC:17428 details
hsa-miR-30c-5p EP300 E1A binding protein p300 HGNC:3373 details
hsa-miR-30c-5p CFL2 cofilin 2 HGNC:1875 details
hsa-miR-30c-5p SDF2L1 stromal cell derived factor 2 like 1 HGNC:10676 details
hsa-miR-30c-5p LYRM2 LYR motif containing 2 HGNC:25229 details
hsa-miR-30c-5p SUN2 Sad1 and UNC84 domain containing 2 HGNC:14210 details
hsa-miR-30c-5p HSP90AA1 heat shock protein 90 alpha family class A member 1 HGNC:5253 details
hsa-miR-30c-5p ZNF687 zinc finger protein 687 HGNC:29277 details
hsa-miR-30c-5p ESYT1 extended synaptotagmin 1 HGNC:29534 details
hsa-miR-30c-5p details
hsa-miR-30c-5p ZNF829 zinc finger protein 829 HGNC:34032 details
hsa-miR-30c-5p details
hsa-miR-30c-5p LLPH LLP homolog, long-term synaptic facilitation factor HGNC:28229 details
hsa-miR-30c-5p HMGN2 high mobility group nucleosomal binding domain 2 HGNC:4986 details
hsa-miR-30c-5p MARK4 microtubule affinity regulating kinase 4 HGNC:13538 details
hsa-miR-30c-5p CKAP4 cytoskeleton associated protein 4 HGNC:16991 details
hsa-miR-30c-5p UTP15 UTP15 small subunit processome component HGNC:25758 details
hsa-miR-30c-5p KLHL42 kelch like family member 42 HGNC:29252 details
hsa-miR-30c-5p ARF3 ADP ribosylation factor 3 HGNC:654 details
hsa-miR-30c-5p YTHDC2 YTH domain containing 2 HGNC:24721 details
hsa-miR-30c-5p LIN9 lin-9 DREAM MuvB core complex component HGNC:30830 details
hsa-miR-30c-5p NFE2L1 nuclear factor, erythroid 2 like 1 HGNC:7781 details
hsa-miR-30c-5p SLC25A38 solute carrier family 25 member 38 HGNC:26054 details
hsa-miR-30c-5p MED13 mediator complex subunit 13 HGNC:22474 details
hsa-miR-30c-5p ZNF780B zinc finger protein 780B HGNC:33109 details
hsa-miR-30c-5p MTDH metadherin HGNC:29608 details
hsa-miR-30c-5p ALDH5A1 aldehyde dehydrogenase 5 family member A1 HGNC:408 details
hsa-miR-30c-5p HNRNPU heterogeneous nuclear ribonucleoprotein U HGNC:5048 details
hsa-miR-30c-5p ERLIN1 ER lipid raft associated 1 HGNC:16947 details
hsa-miR-30c-5p CADPS2 calcium dependent secretion activator 2 HGNC:16018 details
hsa-miR-30c-5p SIAH2 siah E3 ubiquitin protein ligase 2 HGNC:10858 details
hsa-miR-30c-5p GAPVD1 GTPase activating protein and VPS9 domains 1 HGNC:23375 details
hsa-miR-30c-5p RBM14 RNA binding motif protein 14 HGNC:14219 details
hsa-miR-30c-5p RPS27A ribosomal protein S27a HGNC:10417 details
hsa-miR-30c-5p ERLIN2 ER lipid raft associated 2 HGNC:1356 details
hsa-miR-30c-5p RNF34 ring finger protein 34 HGNC:17297 details
hsa-miR-30c-5p RPS12 ribosomal protein S12 HGNC:10385 details
hsa-miR-30c-5p TMCO3 transmembrane and coiled-coil domains 3 HGNC:20329 details
hsa-miR-30c-5p GZF1 GDNF inducible zinc finger protein 1 HGNC:15808 details
hsa-miR-30c-5p ARCN1 archain 1 HGNC:649 details
hsa-miR-30c-5p RAC1 Rac family small GTPase 1 HGNC:9801 details
hsa-miR-30c-5p CBY1 chibby family member 1, beta catenin antagonist HGNC:1307 details
hsa-miR-30c-5p POLQ DNA polymerase theta HGNC:9186 details
hsa-miR-30c-5p POU2F1 POU class 2 homeobox 1 HGNC:9212 details
hsa-miR-30c-5p PLCB1 phospholipase C beta 1 HGNC:15917 details
hsa-miR-30c-5p SDE2 SDE2 telomere maintenance homolog HGNC:26643 details
hsa-miR-30c-5p ERI1 exoribonuclease 1 HGNC:23994 details
hsa-miR-30c-5p details
hsa-miR-30c-5p B3GNT5 UDP-GlcNAc:betaGal beta-1,3-N-acetylglucosaminyltransferase 5 HGNC:15684 details
hsa-miR-30c-5p PTBP3 polypyrimidine tract binding protein 3 HGNC:10253 details
hsa-miR-30c-5p ARHGEF12 Rho guanine nucleotide exchange factor 12 HGNC:14193 details
hsa-miR-30c-5p DIS3 DIS3 homolog, exosome endoribonuclease and 3'-5' exoribonuclease HGNC:20604 details
hsa-miR-30c-5p OTUD7A OTU deubiquitinase 7A HGNC:20718 details
hsa-miR-30c-5p MRPL38 mitochondrial ribosomal protein L38 HGNC:14033 details
hsa-miR-30c-5p C1QBP complement C1q binding protein HGNC:1243 details
hsa-miR-30c-5p NUDT11 nudix hydrolase 11 HGNC:18011 details
hsa-miR-30c-5p INPP5F inositol polyphosphate-5-phosphatase F HGNC:17054 details
hsa-miR-30c-5p SENP3 SUMO specific peptidase 3 HGNC:17862 details
hsa-miR-30c-5p ZNF146 zinc finger protein 146 HGNC:12931 details
hsa-miR-30c-5p POM121 POM121 transmembrane nucleoporin HGNC:19702 details
hsa-miR-30c-5p BCCIP BRCA2 and CDKN1A interacting protein HGNC:978 details
hsa-miR-30c-5p ARHGAP44 Rho GTPase activating protein 44 HGNC:29096 details
hsa-miR-30c-5p HNRNPA2B1 heterogeneous nuclear ribonucleoprotein A2/B1 HGNC:5033 details
hsa-miR-30c-5p HSPH1 heat shock protein family H (Hsp110) member 1 HGNC:16969 details
hsa-miR-30c-5p UBE2NL ubiquitin conjugating enzyme E2 N like (gene/pseudogene) HGNC:31710 details
hsa-miR-30c-5p HPRT1 hypoxanthine phosphoribosyltransferase 1 HGNC:5157 details
hsa-miR-30c-5p EIF2A eukaryotic translation initiation factor 2A HGNC:3254 details
hsa-miR-30c-5p DLC1 DLC1 Rho GTPase activating protein HGNC:2897 details
hsa-miR-30c-5p SNAPC4 small nuclear RNA activating complex polypeptide 4 HGNC:11137 details
hsa-miR-30c-5p BLOC1S4 biogenesis of lysosomal organelles complex 1 subunit 4 HGNC:24206 details
hsa-miR-30c-5p UQCRC1 ubiquinol-cytochrome c reductase core protein 1 HGNC:12585 details
hsa-miR-30c-5p EED embryonic ectoderm development HGNC:3188 details
hsa-miR-30c-5p ELOVL4 ELOVL fatty acid elongase 4 HGNC:14415 details
hsa-miR-30c-5p NLE1 notchless homolog 1 HGNC:19889 details
hsa-miR-30c-5p details
hsa-miR-30c-5p CELSR3 cadherin EGF LAG seven-pass G-type receptor 3 HGNC:3230 details
hsa-miR-30c-5p MTA1 metastasis associated 1 HGNC:7410 details
hsa-miR-30c-5p IL11 interleukin 11 HGNC:5966 details
hsa-miR-30c-5p DDIT4 DNA damage inducible transcript 4 HGNC:24944 details
hsa-miR-30c-5p DLL4 delta like canonical Notch ligand 4 HGNC:2910 details
hsa-miR-30c-5p BCL9 BCL9 transcription coactivator HGNC:1008 details
hsa-miR-30c-5p IDH1 isocitrate dehydrogenase (NADP(+)) 1 HGNC:5382 details
hsa-miR-30c-5p RARB retinoic acid receptor beta HGNC:9865 details
hsa-miR-30c-5p NCOR2 nuclear receptor corepressor 2 HGNC:7673 details
hsa-miR-30c-5p RFX6 regulatory factor X6 HGNC:21478 details
hsa-miR-30c-5p CCND2 cyclin D2 HGNC:1583 details
hsa-miR-30c-5p ZEB2 zinc finger E-box binding homeobox 2 HGNC:14881 details
hsa-miR-30c-5p MYC MYC proto-oncogene, bHLH transcription factor HGNC:7553 details
hsa-miR-30c-5p ZSCAN29 zinc finger and SCAN domain containing 29 HGNC:26673 details
hsa-miR-30c-5p ZNRF1 zinc and ring finger 1 HGNC:18452 details
hsa-miR-30c-5p ZNF507 zinc finger protein 507 HGNC:23783 details
hsa-miR-30c-5p ZNF200 zinc finger protein 200 HGNC:12993 details
hsa-miR-30c-5p ZMYND8 zinc finger MYND-type containing 8 HGNC:9397 details
hsa-miR-30c-5p ZFAND5 zinc finger AN1-type containing 5 HGNC:13008 details
hsa-miR-30c-5p ZCRB1 zinc finger CCHC-type and RNA binding motif containing 1 HGNC:29620 details
hsa-miR-30c-5p ZBTB39 zinc finger and BTB domain containing 39 HGNC:29014 details
hsa-miR-30c-5p WDFY2 WD repeat and FYVE domain containing 2 HGNC:20482 details
hsa-miR-30c-5p VPS41 VPS41 subunit of HOPS complex HGNC:12713 details
hsa-miR-30c-5p VAPA VAMP associated protein A HGNC:12648 details
hsa-miR-30c-5p UBXN4 UBX domain protein 4 HGNC:14860 details
hsa-miR-30c-5p UBN1 ubinuclein 1 HGNC:12506 details
hsa-miR-30c-5p TXNDC5 thioredoxin domain containing 5 HGNC:21073 details
hsa-miR-30c-5p TRIM23 tripartite motif containing 23 HGNC:660 details
hsa-miR-30c-5p TPRG1L tumor protein p63 regulated 1 like HGNC:27007 details
hsa-miR-30c-5p TNFRSF10B TNF receptor superfamily member 10b HGNC:11905 details
hsa-miR-30c-5p TBC1D10B TBC1 domain family member 10B HGNC:24510 details
hsa-miR-30c-5p TAOK1 TAO kinase 1 HGNC:29259 details
hsa-miR-30c-5p TANK TRAF family member associated NFKB activator HGNC:11562 details
hsa-miR-30c-5p TAF4B TATA-box binding protein associated factor 4b HGNC:11538 details
hsa-miR-30c-5p STX12 syntaxin 12 HGNC:11430 details
hsa-miR-30c-5p STAU1 staufen double-stranded RNA binding protein 1 HGNC:11370 details
hsa-miR-30c-5p SP4 Sp4 transcription factor HGNC:11209 details
hsa-miR-30c-5p SOX12 SRY-box transcription factor 12 HGNC:11198 details
hsa-miR-30c-5p SLC4A7 solute carrier family 4 member 7 HGNC:11033 details
hsa-miR-30c-5p SLC38A7 solute carrier family 38 member 7 HGNC:25582 details
hsa-miR-30c-5p SLC35C1 solute carrier family 35 member C1 HGNC:20197 details
hsa-miR-30c-5p SH3PXD2A SH3 and PX domains 2A HGNC:23664 details
hsa-miR-30c-5p SH3GL1 SH3 domain containing GRB2 like 1, endophilin A2 HGNC:10830 details
hsa-miR-30c-5p SRSF7 serine and arginine rich splicing factor 7 HGNC:10789 details
hsa-miR-30c-5p SETD3 SET domain containing 3, actin histidine methyltransferase HGNC:20493 details
hsa-miR-30c-5p SEC24A SEC24 homolog A, COPII coat complex component HGNC:10703 details
hsa-miR-30c-5p SBF1 SET binding factor 1 HGNC:10542 details
hsa-miR-30c-5p SACS sacsin molecular chaperone HGNC:10519 details
hsa-miR-30c-5p S100PBP S100P binding protein HGNC:25768 details
hsa-miR-30c-5p RPA2 replication protein A2 HGNC:10290 details
hsa-miR-30c-5p details
hsa-miR-30c-5p RNF220 ring finger protein 220 HGNC:25552 details
hsa-miR-30c-5p RNF138 ring finger protein 138 HGNC:17765 details
hsa-miR-30c-5p RNF135 ring finger protein 135 HGNC:21158 details
hsa-miR-30c-5p RNF122 ring finger protein 122 HGNC:21147 details
hsa-miR-30c-5p REV3L REV3 like, DNA directed polymerase zeta catalytic subunit HGNC:9968 details
hsa-miR-30c-5p RASGRP3 RAS guanyl releasing protein 3 HGNC:14545 details
hsa-miR-30c-5p RAD23B RAD23 homolog B, nucleotide excision repair protein HGNC:9813 details
hsa-miR-30c-5p PTP4A1 protein tyrosine phosphatase 4A1 HGNC:9634 details
hsa-miR-30c-5p PREPL prolyl endopeptidase like HGNC:30228 details
hsa-miR-30c-5p PRDM1 PR/SET domain 1 HGNC:9346 details
hsa-miR-30c-5p PPTC7 protein phosphatase targeting COQ7 HGNC:30695 details
hsa-miR-30c-5p PPP1R2 protein phosphatase 1 regulatory inhibitor subunit 2 HGNC:9288 details
hsa-miR-30c-5p PPARGC1B PPARG coactivator 1 beta HGNC:30022 details
hsa-miR-30c-5p PNMA1 PNMA family member 1 HGNC:9158 details
hsa-miR-30c-5p PLXNA1 plexin A1 HGNC:9099 details
hsa-miR-30c-5p PLEKHO2 pleckstrin homology domain containing O2 HGNC:30026 details
hsa-miR-30c-5p PIK3C2B phosphatidylinositol-4-phosphate 3-kinase catalytic subunit type 2 beta HGNC:8972 details
hsa-miR-30c-5p PICALM phosphatidylinositol binding clathrin assembly protein HGNC:15514 details
hsa-miR-30c-5p PHTF2 putative homeodomain transcription factor 2 HGNC:13411 details
hsa-miR-30c-5p JADE3 jade family PHD finger 3 HGNC:22982 details
hsa-miR-30c-5p PER2 period circadian regulator 2 HGNC:8846 details
hsa-miR-30c-5p PCMTD2 protein-L-isoaspartate (D-aspartate) O-methyltransferase domain containing 2 HGNC:15882 details
hsa-miR-30c-5p PCGF5 polycomb group ring finger 5 HGNC:28264 details
hsa-miR-30c-5p PCDH10 protocadherin 10 HGNC:13404 details
hsa-miR-30c-5p PAWR pro-apoptotic WT1 regulator HGNC:8614 details
hsa-miR-30c-5p details
hsa-miR-30c-5p OTUD4 OTU deubiquitinase 4 HGNC:24949 details
hsa-miR-30c-5p NRBP1 nuclear receptor binding protein 1 HGNC:7993 details
hsa-miR-30c-5p NFAT5 nuclear factor of activated T cells 5 HGNC:7774 details
hsa-miR-30c-5p NDEL1 nudE neurodevelopment protein 1 like 1 HGNC:17620 details
hsa-miR-30c-5p NAP1L1 nucleosome assembly protein 1 like 1 HGNC:7637 details
hsa-miR-30c-5p MYBL2 MYB proto-oncogene like 2 HGNC:7548 details
hsa-miR-30c-5p MTR 5-methyltetrahydrofolate-homocysteine methyltransferase HGNC:7468 details
hsa-miR-30c-5p MLXIP MLX interacting protein HGNC:17055 details
hsa-miR-30c-5p MIER3 MIER family member 3 HGNC:26678 details
hsa-miR-30c-5p MIB1 MIB E3 ubiquitin protein ligase 1 HGNC:21086 details
hsa-miR-30c-5p MIA3 MIA SH3 domain ER export factor 3 HGNC:24008 details
hsa-miR-30c-5p MAST3 microtubule associated serine/threonine kinase 3 HGNC:19036 details
hsa-miR-30c-5p details
hsa-miR-30c-5p LRRC8D leucine rich repeat containing 8 VRAC subunit D HGNC:16992 details
hsa-miR-30c-5p LPCAT1 lysophosphatidylcholine acyltransferase 1 HGNC:25718 details
hsa-miR-30c-5p LMBR1L limb development membrane protein 1 like HGNC:18268 details
hsa-miR-30c-5p LIN7C lin-7 homolog C, crumbs cell polarity complex component HGNC:17789 details
hsa-miR-30c-5p LIN28B lin-28 homolog B HGNC:32207 details
hsa-miR-30c-5p LHFPL2 LHFPL tetraspan subfamily member 2 HGNC:6588 details
hsa-miR-30c-5p LDLR low density lipoprotein receptor HGNC:6547 details
hsa-miR-30c-5p LCP1 lymphocyte cytosolic protein 1 HGNC:6528 details
hsa-miR-30c-5p KPNA6 karyopherin subunit alpha 6 HGNC:6399 details
hsa-miR-30c-5p KLHDC10 kelch domain containing 10 HGNC:22194 details
hsa-miR-30c-5p KLF10 Kruppel like factor 10 HGNC:11810 details
hsa-miR-30c-5p MSANTD4 Myb/SANT DNA binding domain containing 4 with coiled-coils HGNC:29383 details
hsa-miR-30c-5p EPG5 ectopic P-granules autophagy protein 5 homolog HGNC:29331 details
hsa-miR-30c-5p JOSD1 Josephin domain containing 1 HGNC:28953 details
hsa-miR-30c-5p KDM3A lysine demethylase 3A HGNC:20815 details
hsa-miR-30c-5p JDP2 Jun dimerization protein 2 HGNC:17546 details
hsa-miR-30c-5p JAK1 Janus kinase 1 HGNC:6190 details
hsa-miR-30c-5p IREB2 iron responsive element binding protein 2 HGNC:6115 details
hsa-miR-30c-5p IQCB1 IQ motif containing B1 HGNC:28949 details
hsa-miR-30c-5p IP6K3 inositol hexakisphosphate kinase 3 HGNC:17269 details
hsa-miR-30c-5p IL21R interleukin 21 receptor HGNC:6006 details
hsa-miR-30c-5p IL1A interleukin 1 alpha HGNC:5991 details
hsa-miR-30c-5p IKZF2 IKAROS family zinc finger 2 HGNC:13177 details
hsa-miR-30c-5p IFNAR2 interferon alpha and beta receptor subunit 2 HGNC:5433 details
hsa-miR-30c-5p IER5 immediate early response 5 HGNC:5393 details
hsa-miR-30c-5p HIC2 HIC ZBTB transcriptional repressor 2 HGNC:18595 details
hsa-miR-30c-5p GOLGA8B golgin A8 family member B HGNC:31973 details
hsa-miR-30c-5p GOLGA1 golgin A1 HGNC:4424 details
hsa-miR-30c-5p GNAI2 G protein subunit alpha i2 HGNC:4385 details
hsa-miR-30c-5p GXYLT1 glucoside xylosyltransferase 1 HGNC:27482 details
hsa-miR-30c-5p GLCE glucuronic acid epimerase HGNC:17855 details
hsa-miR-30c-5p GCLC glutamate-cysteine ligase catalytic subunit HGNC:4311 details
hsa-miR-30c-5p GCSAM germinal center associated signaling and motility HGNC:20253 details
hsa-miR-30c-5p GALNT1 polypeptide N-acetylgalactosaminyltransferase 1 HGNC:4123 details
hsa-miR-30c-5p GAB1 GRB2 associated binding protein 1 HGNC:4066 details
hsa-miR-30c-5p FUCA1 alpha-L-fucosidase 1 HGNC:4006 details
hsa-miR-30c-5p FBXO45 F-box protein 45 HGNC:29148 details
hsa-miR-30c-5p FANCL FA complementation group L HGNC:20748 details
hsa-miR-30c-5p FAM91A1 family with sequence similarity 91 member A1 HGNC:26306 details
hsa-miR-30c-5p STRIP1 striatin interacting protein 1 HGNC:25916 details
hsa-miR-30c-5p FAM104A family with sequence similarity 104 member A HGNC:25918 details
hsa-miR-30c-5p EPB41 erythrocyte membrane protein band 4.1 HGNC:3377 details
hsa-miR-30c-5p ENTPD1 ectonucleoside triphosphate diphosphohydrolase 1 HGNC:3363 details
hsa-miR-30c-5p ENPP4 ectonucleotide pyrophosphatase/phosphodiesterase 4 HGNC:3359 details
hsa-miR-30c-5p EDC3 enhancer of mRNA decapping 3 HGNC:26114 details
hsa-miR-30c-5p DYNLT3 dynein light chain Tctex-type 3 HGNC:11694 details
hsa-miR-30c-5p DHX40 DEAH-box helicase 40 HGNC:18018 details
hsa-miR-30c-5p DCTN4 dynactin subunit 4 HGNC:15518 details
hsa-miR-30c-5p DBF4 DBF4 zinc finger HGNC:17364 details
hsa-miR-30c-5p CSNK1G1 casein kinase 1 gamma 1 HGNC:2454 details
hsa-miR-30c-5p CREG1 cellular repressor of E1A stimulated genes 1 HGNC:2351 details
hsa-miR-30c-5p CPEB4 cytoplasmic polyadenylation element binding protein 4 HGNC:21747 details
hsa-miR-30c-5p CLCC1 chloride channel CLIC like 1 HGNC:29675 details
hsa-miR-30c-5p CEP350 centrosomal protein 350 HGNC:24238 details
hsa-miR-30c-5p CDC7 cell division cycle 7 HGNC:1745 details
hsa-miR-30c-5p CDC37L1 cell division cycle 37 like 1 HGNC:17179 details
hsa-miR-30c-5p CBX3 chromobox 3 HGNC:1553 details
hsa-miR-30c-5p CASP3 caspase 3 HGNC:1504 details
hsa-miR-30c-5p C8orf76 chromosome 8 open reading frame 76 HGNC:25924 details
hsa-miR-30c-5p BMT2 base methyltransferase of 25S rRNA 2 homolog HGNC:26475 details
hsa-miR-30c-5p details
hsa-miR-30c-5p MZT1 mitotic spindle organizing protein 1 HGNC:33830 details
hsa-miR-30c-5p RUBCNL rubicon like autophagy enhancer HGNC:20420 details
hsa-miR-30c-5p BTBD7 BTB domain containing 7 HGNC:18269 details
hsa-miR-30c-5p BTBD1 BTB domain containing 1 HGNC:1120 details
hsa-miR-30c-5p BECN1 beclin 1 HGNC:1034 details
hsa-miR-30c-5p CFDP1 craniofacial development protein 1 HGNC:1873 details
hsa-miR-30c-5p B4GALT1 beta-1,4-galactosyltransferase 1 HGNC:924 details
hsa-miR-30c-5p AZIN1 antizyme inhibitor 1 HGNC:16432 details
hsa-miR-30c-5p AVL9 AVL9 cell migration associated HGNC:28994 details
hsa-miR-30c-5p ATM ATM serine/threonine kinase HGNC:795 details
hsa-miR-30c-5p ASB3 ankyrin repeat and SOCS box containing 3 HGNC:16013 details
hsa-miR-30c-5p ARID3A AT-rich interaction domain 3A HGNC:3031 details
hsa-miR-30c-5p ANKRA2 ankyrin repeat family A member 2 HGNC:13208 details
hsa-miR-30c-5p AFF4 AF4/FMR2 family member 4 HGNC:17869 details
hsa-miR-30c-5p TGFA transforming growth factor alpha HGNC:11765 details
hsa-miR-30c-5p CHST15 carbohydrate sulfotransferase 15 HGNC:18137 details
hsa-miR-30c-5p SEC61A2 SEC61 translocon subunit alpha 2 HGNC:17702 details
hsa-miR-30c-5p ROCK2 Rho associated coiled-coil containing protein kinase 2 HGNC:10252 details
hsa-miR-30c-5p NCOA3 nuclear receptor coactivator 3 HGNC:7670 details
hsa-miR-30c-5p N4BP2 NEDD4 binding protein 2 HGNC:29851 details
hsa-miR-30c-5p GNA13 G protein subunit alpha 13 HGNC:4381 details
hsa-miR-30c-5p TSPYL1 TSPY like 1 HGNC:12382 details
hsa-miR-30c-5p PGGT1B protein geranylgeranyltransferase type I subunit beta HGNC:8895 details
hsa-miR-30c-5p PPP2R1B protein phosphatase 2 scaffold subunit Abeta HGNC:9303 details
hsa-miR-30c-5p LYPLAL1 lysophospholipase like 1 HGNC:20440 details
hsa-miR-30c-5p ZXDB zinc finger X-linked duplicated B HGNC:13199 details
hsa-miR-30c-5p ZDHHC20 zinc finger DHHC-type palmitoyltransferase 20 HGNC:20749 details
hsa-miR-30c-5p VASH1 vasohibin 1 HGNC:19964 details
hsa-miR-30c-5p SLC7A5 solute carrier family 7 member 5 HGNC:11063 details
hsa-miR-30c-5p SFXN1 sideroflexin 1 HGNC:16085 details
hsa-miR-30c-5p PPP1R15B protein phosphatase 1 regulatory subunit 15B HGNC:14951 details
hsa-miR-30c-5p PHF13 PHD finger protein 13 HGNC:22983 details
hsa-miR-30c-5p NACC2 NACC family member 2 HGNC:23846 details
hsa-miR-30c-5p MARCKSL1 MARCKS like 1 HGNC:7142 details
hsa-miR-30c-5p MAPK8 mitogen-activated protein kinase 8 HGNC:6881 details
hsa-miR-30c-5p LARP1 La ribonucleoprotein 1, translational regulator HGNC:29531 details
hsa-miR-30c-5p HHIPL1 HHIP like 1 HGNC:19710 details
hsa-miR-30c-5p H6PD hexose-6-phosphate dehydrogenase/glucose 1-dehydrogenase HGNC:4795 details
hsa-miR-30c-5p FYTTD1 forty-two-three domain containing 1 HGNC:25407 details
hsa-miR-30c-5p EML4 EMAP like 4 HGNC:1316 details
hsa-miR-30c-5p CCNF cyclin F HGNC:1591 details
hsa-miR-30c-5p ARPP19 cAMP regulated phosphoprotein 19 HGNC:16967 details
hsa-miR-30c-5p ALG9 ALG9 alpha-1,2-mannosyltransferase HGNC:15672 details
hsa-miR-30c-5p AKIRIN1 akirin 1 HGNC:25744 details
hsa-miR-30c-5p ADPRHL1 ADP-ribosylhydrolase like 1 HGNC:21303 details
hsa-miR-30c-5p POLR3E RNA polymerase III subunit E HGNC:30347 details
hsa-miR-30c-5p IFNE interferon epsilon HGNC:18163 details
hsa-miR-30c-5p SETD5 SET domain containing 5 HGNC:25566 details
hsa-miR-30c-5p MKRN3 makorin ring finger protein 3 HGNC:7114 details
hsa-miR-30c-5p MTRNR2L10 MT-RNR2 like 10 HGNC:37167 details
hsa-miR-30c-5p PSMD7 proteasome 26S subunit, non-ATPase 7 HGNC:9565 details
hsa-miR-30c-5p KIF5B kinesin family member 5B HGNC:6324 details
hsa-miR-30c-5p CAND1 cullin associated and neddylation dissociated 1 HGNC:30688 details
hsa-miR-30c-5p BAG4 BAG cochaperone 4 HGNC:940 details
hsa-miR-30c-5p TOMM5 translocase of outer mitochondrial membrane 5 HGNC:31369 details
hsa-miR-30c-5p GIGYF1 GRB10 interacting GYF protein 1 HGNC:9126 details
hsa-miR-30c-5p PGPEP1 pyroglutamyl-peptidase I HGNC:13568 details
hsa-miR-30c-5p ZNF264 zinc finger protein 264 HGNC:13057 details
hsa-miR-30c-5p TFDP1 transcription factor Dp-1 HGNC:11749 details
hsa-miR-30c-5p CXCL11 C-X-C motif chemokine ligand 11 HGNC:10638 details
hsa-miR-30c-5p FAM81B family with sequence similarity 81 member B HGNC:26335 details
hsa-miR-30c-5p SKIDA1 SKI/DACH domain containing 1 HGNC:32697 details
hsa-miR-30c-5p HABP4 hyaluronan binding protein 4 HGNC:17062 details
hsa-miR-30c-5p DDAH1 dimethylarginine dimethylaminohydrolase 1 HGNC:2715 details
hsa-miR-30c-5p TBPL1 TATA-box binding protein like 1 HGNC:11589 details
hsa-miR-30c-5p MFAP3 microfibril associated protein 3 HGNC:7034 details
hsa-miR-30c-5p SIKE1 suppressor of IKBKE 1 HGNC:26119 details
hsa-miR-30c-5p GTF2E2 general transcription factor IIE subunit 2 HGNC:4651 details
hsa-miR-30c-5p ZNF543 zinc finger protein 543 HGNC:25281 details
hsa-miR-30c-5p XPO1 exportin 1 HGNC:12825 details
hsa-miR-30c-5p RAP1B RAP1B, member of RAS oncogene family HGNC:9857 details
hsa-miR-30c-5p PGM3 phosphoglucomutase 3 HGNC:8907 details
hsa-miR-30c-5p PBRM1 polybromo 1 HGNC:30064 details
hsa-miR-30c-5p KBTBD6 kelch repeat and BTB domain containing 6 HGNC:25340 details
hsa-miR-30c-5p FOXA1 forkhead box A1 HGNC:5021 details
hsa-miR-30c-5p ELOVL5 ELOVL fatty acid elongase 5 HGNC:21308 details
hsa-miR-30c-5p CD2AP CD2 associated protein HGNC:14258 details
hsa-miR-30c-5p SLC35G2 solute carrier family 35 member G2 HGNC:28480 details
hsa-miR-30c-5p FAM8A1 family with sequence similarity 8 member A1 HGNC:16372 details
hsa-miR-30c-5p ZNF460 zinc finger protein 460 HGNC:21628 details
hsa-miR-30c-5p VPS33A VPS33A core subunit of CORVET and HOPS complexes HGNC:18179 details
hsa-miR-30c-5p SRPRA SRP receptor subunit alpha HGNC:11307 details
hsa-miR-30c-5p SOBP sine oculis binding protein homolog HGNC:29256 details
hsa-miR-30c-5p SIX4 SIX homeobox 4 HGNC:10890 details
hsa-miR-30c-5p SAE1 SUMO1 activating enzyme subunit 1 HGNC:30660 details
hsa-miR-30c-5p RAB10 RAB10, member RAS oncogene family HGNC:9759 details
hsa-miR-30c-5p PPP3CB protein phosphatase 3 catalytic subunit beta HGNC:9315 details
hsa-miR-30c-5p PDCD10 programmed cell death 10 HGNC:8761 details
hsa-miR-30c-5p NAPG NSF attachment protein gamma HGNC:7642 details
hsa-miR-30c-5p LRRC8B leucine rich repeat containing 8 VRAC subunit B HGNC:30692 details
hsa-miR-30c-5p LIFR LIF receptor subunit alpha HGNC:6597 details
hsa-miR-30c-5p LCOR ligand dependent nuclear receptor corepressor HGNC:29503 details
hsa-miR-30c-5p KIF11 kinesin family member 11 HGNC:6388 details
hsa-miR-30c-5p FYCO1 FYVE and coiled-coil domain autophagy adaptor 1 HGNC:14673 details
hsa-miR-30c-5p FRS2 fibroblast growth factor receptor substrate 2 HGNC:16971 details
hsa-miR-30c-5p FOXN2 forkhead box N2 HGNC:5281 details
hsa-miR-30c-5p FOXG1 forkhead box G1 HGNC:3811 details
hsa-miR-30c-5p DCUN1D1 defective in cullin neddylation 1 domain containing 1 HGNC:18184 details
hsa-miR-30c-5p PEG10 paternally expressed 10 HGNC:14005 details
hsa-miR-30c-5p LCLAT1 lysocardiolipin acyltransferase 1 HGNC:26756 details
hsa-miR-30c-5p NDUFA12 NADH:ubiquinone oxidoreductase subunit A12 HGNC:23987 details
hsa-miR-30c-5p QRFPR pyroglutamylated RFamide peptide receptor HGNC:15565 details
hsa-miR-30c-5p ST3GAL5 ST3 beta-galactoside alpha-2,3-sialyltransferase 5 HGNC:10872 details
hsa-miR-30c-5p UHRF1BP1 UHRF1 binding protein 1 HGNC:21216 details
hsa-miR-30c-5p SCML2 Scm polycomb group protein like 2 HGNC:10581 details
hsa-miR-30c-5p MYLIP myosin regulatory light chain interacting protein HGNC:21155 details
hsa-miR-30c-5p FANCF FA complementation group F HGNC:3587 details
hsa-miR-30c-5p CBX2 chromobox 2 HGNC:1552 details
hsa-miR-30c-5p B4GALT5 beta-1,4-galactosyltransferase 5 HGNC:928 details
hsa-miR-30c-5p ADO 2-aminoethanethiol dioxygenase HGNC:23506 details
hsa-miR-30c-5p MTF2 metal response element binding transcription factor 2 HGNC:29535 details
hsa-miR-30c-5p OPHN1 oligophrenin 1 HGNC:8148 details
hsa-miR-30c-5p STRN striatin HGNC:11424 details
hsa-miR-30c-5p details
hsa-miR-30c-5p PLSCR1 phospholipid scramblase 1 HGNC:9092 details
hsa-miR-30c-5p SERPINC1 serpin family C member 1 HGNC:775 details
hsa-miR-30c-5p MED29 mediator complex subunit 29 HGNC:23074 details
hsa-miR-30c-5p BAHD1 bromo adjacent homology domain containing 1 HGNC:29153 details
hsa-miR-30c-5p STX16 syntaxin 16 HGNC:11431 details
hsa-miR-30c-5p PRKAR1A protein kinase cAMP-dependent type I regulatory subunit alpha HGNC:9388 details
hsa-miR-30c-5p CREM cAMP responsive element modulator HGNC:2352 details
hsa-miR-30c-5p TMED2 transmembrane p24 trafficking protein 2 HGNC:16996 details
hsa-miR-30c-5p CCDC71L coiled-coil domain containing 71 like HGNC:26685 details
hsa-miR-30c-5p ATP2A2 ATPase sarcoplasmic/endoplasmic reticulum Ca2+ transporting 2 HGNC:812 details
hsa-miR-30c-5p APLP2 amyloid beta precursor like protein 2 HGNC:598 details
hsa-miR-30c-5p ADAM9 ADAM metallopeptidase domain 9 HGNC:216 details
hsa-miR-30c-5p MRO maestro HGNC:24121 details
hsa-miR-30c-5p LRRC3C leucine rich repeat containing 3C HGNC:40034 details
hsa-miR-30c-5p MOGAT1 monoacylglycerol O-acyltransferase 1 HGNC:18210 details
hsa-miR-30c-5p SLFN5 schlafen family member 5 HGNC:28286 details
hsa-miR-30c-5p SHROOM3 shroom family member 3 HGNC:30422 details
hsa-miR-30c-5p RUNX2 RUNX family transcription factor 2 HGNC:10472 details
hsa-miR-30c-5p SNAI2 snail family transcriptional repressor 2 HGNC:11094 details
hsa-miR-30c-5p NOTCH1 notch receptor 1 HGNC:7881 details
hsa-miR-30c-5p MTTP microsomal triglyceride transfer protein HGNC:7467 details
hsa-miR-30c-5p TP53 tumor protein p53 HGNC:11998 details
hsa-miR-30c-5p RASAL2 RAS protein activator like 2 HGNC:9874 details
hsa-miR-30c-5p MED23 mediator complex subunit 23 HGNC:2372 details
hsa-miR-30c-5p EIF2S1 eukaryotic translation initiation factor 2 subunit alpha HGNC:3265 details
hsa-miR-30c-5p DNMT1 DNA methyltransferase 1 HGNC:2976 details
hsa-miR-30c-5p CAMK2D calcium/calmodulin dependent protein kinase II delta HGNC:1462 details
hsa-miR-30c-5p IER2 immediate early response 2 HGNC:28871 details
hsa-miR-30c-5p CDC42 cell division cycle 42 HGNC:1736 details
hsa-miR-30c-5p PAK1 p21 (RAC1) activated kinase 1 HGNC:8590 details
hsa-miR-30c-5p FASN fatty acid synthase HGNC:3594 details
hsa-miR-30c-5p MCL1 MCL1 apoptosis regulator, BCL2 family member HGNC:6943 details
hsa-miR-30c-5p FOXO3 forkhead box O3 HGNC:3821 details
hsa-miR-30c-5p details
hsa-miR-30c-5p CELF1 CUGBP Elav-like family member 1 HGNC:2549 details
hsa-miR-30c-5p JADE2 jade family PHD finger 2 HGNC:22984 details
hsa-miR-30c-5p KCTD5 potassium channel tetramerization domain containing 5 HGNC:21423 details
hsa-miR-30c-5p UBE2D3 ubiquitin conjugating enzyme E2 D3 HGNC:12476 details
hsa-miR-30c-5p WDR82 WD repeat domain 82 HGNC:28826 details
hsa-miR-30c-5p ZFP36L1 ZFP36 ring finger protein like 1 HGNC:1107 details
hsa-miR-30c-5p PLAGL2 PLAG1 like zinc finger 2 HGNC:9047 details
hsa-miR-30c-5p RIF1 replication timing regulatory factor 1 HGNC:23207 details
hsa-miR-30c-5p ZMPSTE24 zinc metallopeptidase STE24 HGNC:12877 details
hsa-miR-30c-5p ACTC1 actin alpha cardiac muscle 1 HGNC:143 details
hsa-miR-30c-5p GPR75-ASB3 GPR75-ASB3 readthrough HGNC:40043 details
hsa-miR-30c-5p DPY19L3 dpy-19 like C-mannosyltransferase 3 HGNC:27120 details
© 2021 Arieh Warshel Institute of Computational Biology, CUHK(SZ) | Designed by : Biomics Lab