miRNA Card

miRNA General Information
miRNA ID hsa-miR-3129-3p
Description Homo sapiens miR-3129 stem-loop
Comment None
Experiment Illumina [3]
Sequence AAACUAAUCUCUACACUGCUGC
miRNA Expression in different cancers

    by mir_boxplot.py

circRNA-miRNA-gene regulatory network

Note about Netwrok:
This is a network diagram with miRNA (purple circle) as the center.
We used three tools(PITA, miRanda, targetScan) to predict the binding sites of circrna (green circle) and miRNA. Accordingly, for this miRNA that binds to circrna, we have three confidence levels, namely confident 1, confident 2 and confident 3. Confidence value indicates how many tools can deduce these results. For each confidence, we use different kinds of dashed lines.

Target circRNA with confidence

Confidence 3 (3 of 3 tools predicted)

CircID miRNA PITA miRanda targetScan

Confidence 2 (2 of 3 tools predicted)

CircID miRNA PITA miRanda targetScan
chr12:54341372|54341529 hsa-miR-3129-3p 1 1 0

Confidence 1 (1 of 3 tools predicted)

CircID miRNA PITA miRanda targetScan
chr2:149471664|149471801 hsa-miR-3129-3p 0 1 0
chr12:1493822|1494030 hsa-miR-3129-3p 0 1 0
chr1:633888|634031 hsa-miR-3129-3p 0 1 0
chr2:203138209|203138315 hsa-miR-3129-3p 0 1 0
chr20:37983254|37983454 hsa-miR-3129-3p 0 1 0
chr1:7781142|7781273 hsa-miR-3129-3p 0 1 0
chr7:100099121|100099307 hsa-miR-3129-3p 0 1 0
chr6:33891764|33891888 hsa-miR-3129-3p 0 1 0
chr9:12823969|12824074 hsa-miR-3129-3p 0 1 0
chr2:149471664|149471814 hsa-miR-3129-3p 0 1 0
chr16:67148487|67148636 hsa-miR-3129-3p 0 1 0
chr17:7669266|7669396 hsa-miR-3129-3p 0 1 0
chr16:67148466|67148633 hsa-miR-3129-3p 0 1 0
chr2:149023652|149023764 hsa-miR-3129-3p 0 1 0
chr7:100099145~100099307 hsa-miR-3129-3p 0 1 0
chr20:37983254~37983454 hsa-miR-3129-3p 0 1 0
chr5:6756728~6756849 hsa-miR-3129-3p 0 1 0
chr10:17235846~17236358 hsa-miR-3129-3p 0 1 0
chr15:67621002|67621149 hsa-miR-3129-3p 0 1 0
chr5:6756703|6756849 hsa-miR-3129-3p 0 1 0
chr3:131363983|131364121 hsa-miR-3129-3p 0 1 0
chr6:122443429|122443575 hsa-miR-3129-3p 0 1 0
chr6:43640243|43640440 hsa-miR-3129-3p 0 1 0
chr4:139404939|139405144 hsa-miR-3129-3p 0 1 0
chr10:113912559|113912742 hsa-miR-3129-3p 0 1 0
chr20:32435774|32435920 hsa-miR-3129-3p 0 1 0
chr1:154270689|154270842 hsa-miR-3129-3p 0 1 0
chrX:45148679|45148946 hsa-miR-3129-3p 0 1 0
chr5:6756728|6756849 hsa-miR-3129-3p 0 1 0
chr1:7781116|7781300 hsa-miR-3129-3p 0 1 0
chr1:7781116|7781363 hsa-miR-3129-3p 0 1 0
chr3:187076110|187076278 hsa-miR-3129-3p 0 1 0
chrX:71224867|71225001 hsa-miR-3129-3p 0 1 0
chr8:97727555|97727708 hsa-miR-3129-3p 0 1 0
chr12:1493828|1494030 hsa-miR-3129-3p 0 1 0
chr1:7781142|7781300 hsa-miR-3129-3p 0 1 0
chr1:7781116|7781293 hsa-miR-3129-3p 0 1 0
chr1:204221244|204221393 hsa-miR-3129-3p 0 1 0
chr1:7781075|7781300 hsa-miR-3129-3p 0 1 0
chr14:103701279|103701417 hsa-miR-3129-3p 0 1 0
chr11:65021889|65022045 hsa-miR-3129-3p 1 0 0
Target genes
miRNA Gene Gene Description HGNC ID details
hsa-miR-3129-3p DTWD2 DTW domain containing 2 HGNC:19334 details
hsa-miR-3129-3p GSTCD glutathione S-transferase C-terminal domain containing HGNC:25806 details
hsa-miR-3129-3p SRSF3 serine and arginine rich splicing factor 3 HGNC:10785 details
hsa-miR-3129-3p SRSF1 serine and arginine rich splicing factor 1 HGNC:10780 details
hsa-miR-3129-3p TMEM245 transmembrane protein 245 HGNC:1363 details
hsa-miR-3129-3p ABI2 abl interactor 2 HGNC:24011 details
hsa-miR-3129-3p PDE12 phosphodiesterase 12 HGNC:25386 details
hsa-miR-3129-3p TLE3 TLE family member 3, transcriptional corepressor HGNC:11839 details
hsa-miR-3129-3p ZBTB18 zinc finger and BTB domain containing 18 HGNC:13030 details
hsa-miR-3129-3p PPIG peptidylprolyl isomerase G HGNC:14650 details
hsa-miR-3129-3p PMAIP1 phorbol-12-myristate-13-acetate-induced protein 1 HGNC:9108 details
hsa-miR-3129-3p BCAT1 branched chain amino acid transaminase 1 HGNC:976 details
hsa-miR-3129-3p EIF1AX eukaryotic translation initiation factor 1A X-linked HGNC:3250 details
hsa-miR-3129-3p SGO1 shugoshin 1 HGNC:25088 details
hsa-miR-3129-3p ZNF675 zinc finger protein 675 HGNC:30768 details
hsa-miR-3129-3p SMARCAD1 SWI/SNF-related, matrix-associated actin-dependent regulator of chromatin, subfamily a, containing DEAD/H box 1 HGNC:18398 details
hsa-miR-3129-3p POF1B POF1B actin binding protein HGNC:13711 details
hsa-miR-3129-3p SYT4 synaptotagmin 4 HGNC:11512 details
hsa-miR-3129-3p TMX3 thioredoxin related transmembrane protein 3 HGNC:24718 details
hsa-miR-3129-3p SGTB small glutamine rich tetratricopeptide repeat co-chaperone beta HGNC:23567 details
hsa-miR-3129-3p PYGO1 pygopus family PHD finger 1 HGNC:30256 details
hsa-miR-3129-3p CLOCK clock circadian regulator HGNC:2082 details
hsa-miR-3129-3p EGLN1 egl-9 family hypoxia inducible factor 1 HGNC:1232 details
hsa-miR-3129-3p TMEM97 transmembrane protein 97 HGNC:28106 details
hsa-miR-3129-3p SRP9 signal recognition particle 9 HGNC:11304 details
hsa-miR-3129-3p RBBP6 RB binding protein 6, ubiquitin ligase HGNC:9889 details
hsa-miR-3129-3p PBRM1 polybromo 1 HGNC:30064 details
hsa-miR-3129-3p KLHL15 kelch like family member 15 HGNC:29347 details
hsa-miR-3129-3p EPHA4 EPH receptor A4 HGNC:3388 details
hsa-miR-3129-3p details
hsa-miR-3129-3p KIAA1143 KIAA1143 HGNC:29198 details
hsa-miR-3129-3p SLC35A5 solute carrier family 35 member A5 HGNC:20792 details
hsa-miR-3129-3p RAB33B RAB33B, member RAS oncogene family HGNC:16075 details
hsa-miR-3129-3p FCHO2 FCH and mu domain containing endocytic adaptor 2 HGNC:25180 details
hsa-miR-3129-3p CHRDL1 chordin like 1 HGNC:29861 details
hsa-miR-3129-3p details
hsa-miR-3129-3p JAZF1 JAZF zinc finger 1 HGNC:28917 details
hsa-miR-3129-3p GDNF glial cell derived neurotrophic factor HGNC:4232 details
hsa-miR-3129-3p SLC33A1 solute carrier family 33 member 1 HGNC:95 details
hsa-miR-3129-3p SIX4 SIX homeobox 4 HGNC:10890 details
hsa-miR-3129-3p FZD9 frizzled class receptor 9 HGNC:4047 details
hsa-miR-3129-3p ARID1A AT-rich interaction domain 1A HGNC:11110 details
hsa-miR-3129-3p UGT2B28 UDP glucuronosyltransferase family 2 member B28 HGNC:13479 details
hsa-miR-3129-3p EPDR1 ependymin related 1 HGNC:17572 details
hsa-miR-3129-3p LONRF3 LON peptidase N-terminal domain and ring finger 3 HGNC:21152 details
hsa-miR-3129-3p DYNC1I2 dynein cytoplasmic 1 intermediate chain 2 HGNC:2964 details
hsa-miR-3129-3p CAMSAP1 calmodulin regulated spectrin associated protein 1 HGNC:19946 details
hsa-miR-3129-3p C5orf51 chromosome 5 open reading frame 51 HGNC:27750 details
hsa-miR-3129-3p APOL4 apolipoprotein L4 HGNC:14867 details
hsa-miR-3129-3p RAD18 RAD18 E3 ubiquitin protein ligase HGNC:18278 details
hsa-miR-3129-3p SPTSSA serine palmitoyltransferase small subunit A HGNC:20361 details
hsa-miR-3129-3p SHOX2 short stature homeobox 2 HGNC:10854 details
hsa-miR-3129-3p ARL6IP1 ADP ribosylation factor like GTPase 6 interacting protein 1 HGNC:697 details
hsa-miR-3129-3p GNPTAB N-acetylglucosamine-1-phosphate transferase subunits alpha and beta HGNC:29670 details
hsa-miR-3129-3p NSL1 NSL1 component of MIS12 kinetochore complex HGNC:24548 details
© 2021 Arieh Warshel Institute of Computational Biology, CUHK(SZ) | Designed by : Biomics Lab