CircNet

miRNA General Information

Basic
Network

miRNA ID	hsa-miR-3140-5p
Description	Homo sapiens miR-3140 stem-loop
Comment	None
Experiment	Illumina [3-4]
Sequence	ACCUGAAUUACCAAAAGCUUU

miRNA Expression in different cancers

circRNA-miRNA-gene regulatory network

Note about Netwrok:
This is a network diagram with miRNA (purple circle) as the center.
We used three tools(PITA, miRanda, targetScan) to predict the binding sites of circrna (green circle) and miRNA. Accordingly, for this miRNA that binds to circrna, we have three confidence levels, namely confident 1, confident 2 and confident 3. Confidence value indicates how many tools can deduce these results. For each confidence, we use different kinds of dashed lines.

Target circRNA with confidence

Confidence 3 (3 of 3 tools predicted)

CircID	miRNA	PITA	miRanda	targetScan

Confidence 2 (2 of 3 tools predicted)

CircID	miRNA	PITA	miRanda	targetScan

Confidence 1 (1 of 3 tools predicted)

CircID	miRNA	PITA	miRanda
chr17:64782043\|64782205	hsa-miR-3140-5p	0	1
chr3:4831731\|4831850	hsa-miR-3140-5p	0	1
chr3:49028248\|49028508	hsa-miR-3140-5p	0	1
chr1:7780832\|7781021	hsa-miR-3140-5p	0	1
chr11:118601527\|118601645	hsa-miR-3140-5p	0	1
chr7:106257674\|106257810	hsa-miR-3140-5p	0	1
chr12:54237553\|54237686	hsa-miR-3140-5p	0	1
chr19:38383421\|38383622	hsa-miR-3140-5p	0	1
chr9:120419788\|120419949	hsa-miR-3140-5p	0	1
chr2:127706099\|127706332	hsa-miR-3140-5p	0	1
chr1:155947472\|155947619	hsa-miR-3140-5p	0	1
chr11:118601510\|118601645	hsa-miR-3140-5p	0	1
chr19:6713295\|6713489	hsa-miR-3140-5p	0	1
chr12:113392577\|113392771	hsa-miR-3140-5p	0	1
chr19:6713277\|6713489	hsa-miR-3140-5p	0	1
chr1:156737413\|156737708	hsa-miR-3140-5p	0	1
chr12:1592873\|1593019	hsa-miR-3140-5p	0	1
chr5:150658342\|150658534	hsa-miR-3140-5p	0	1
chr3:9911275\|9911597	hsa-miR-3140-5p	0	1
chr11:14499209\|14499394	hsa-miR-3140-5p	0	1
chr10:71828955\|71829062	hsa-miR-3140-5p	0	1
chr22:30975666\|30975788	hsa-miR-3140-5p	0	1
chr11:118601527~118601645	hsa-miR-3140-5p	0	1
chr15:38454205~38464169	hsa-miR-3140-5p	0	1
chr9:121085526\|121085734	hsa-miR-3140-5p	0	1
chr12:57056191\|57056378	hsa-miR-3140-5p	0	1
chr10:71828952\|71829062	hsa-miR-3140-5p	0	1
chr1:180381465\|180381622	hsa-miR-3140-5p	0	1
chr15:55237277\|55237410	hsa-miR-3140-5p	0	1
chr8:13085177\|13085309	hsa-miR-3140-5p	0	1
chr9:5112543\|5112759	hsa-miR-3140-5p	0	1
chr2:197045513\|197045598	hsa-miR-3140-5p	0	1
chr20:51337241\|51337488	hsa-miR-3140-5p	0	1
chr22:42879048\|42879156	hsa-miR-3140-5p	0	1
chr4:87892784\|87893002	hsa-miR-3140-5p	0	1
chr7:99532798\|99533016	hsa-miR-3140-5p	0	1
chr12:113392583\|113392783	hsa-miR-3140-5p	0	1
chr12:1592915\|1593142	hsa-miR-3140-5p	0	1
chr11:34324341\|34324469	hsa-miR-3140-5p	0	1
chr18:671384\|671598	hsa-miR-3140-5p	0	1
chr5:83583495\|83583638	hsa-miR-3140-5p	0	1
chr22:38739115\|38739302	hsa-miR-3140-5p	0	1
chr22:38739141\|38739302	hsa-miR-3140-5p	0	1
chr2:127706099\|127706244	hsa-miR-3140-5p	0	1
chr19:17209972\|17210323	hsa-miR-3140-5p	0	1
chr1:52914603\|52914715	hsa-miR-3140-5p	0	1
chr2:113182724\|113182905	hsa-miR-3140-5p	0	1
chr11:118505983\|118506087	hsa-miR-3140-5p	0	1
chr19:6713277\|6713493	hsa-miR-3140-5p	0	1
chr11:46286834\|46287009	hsa-miR-3140-5p	0	1
chr6:33710067\|33710172	hsa-miR-3140-5p	0	1
chr12:120221035\|120221221	hsa-miR-3140-5p	0	1
chr5:132272410\|132272569	hsa-miR-3140-5p	0	1
chr4:87892732\|87893002	hsa-miR-3140-5p	0	1
chr10:71828877\|71829026	hsa-miR-3140-5p	0	1
chr15:52582159\|52582231	hsa-miR-3140-5p	0	1
chr9:93678213\|93678354	hsa-miR-3140-5p	-4	1
chr19:6713262\|6713454	hsa-miR-3140-5p	-4	1
chr11:118897437\|118897601	hsa-miR-3140-5p	-5	1
chr19:55094661\|55094791	hsa-miR-3140-5p	-5	1
chr10:71828877\|71829013	hsa-miR-3140-5p	0	1
chr19:39389489\|39389712	hsa-miR-3140-5p	0	1
chr19:8302476\|8302819	hsa-miR-3140-5p	0	1
chr17:29056371\|29056501	hsa-miR-3140-5p	0	1
chr2:113182598\|113182854	hsa-miR-3140-5p	0	1
chr7:99456856\|99457064	hsa-miR-3140-5p	0	1
chr19:6713262\|6713489	hsa-miR-3140-5p	0	1
chr19:1611704\|1611847	hsa-miR-3140-5p	0	1
chr17:29056353\|29056501	hsa-miR-3140-5p	0	1
chr8:76866551\|76866677	hsa-miR-3140-5p	0	1
chr5:176507742\|176507958	hsa-miR-3140-5p	0	1

Target genes

miRNA	Gene	Gene Description	HGNC ID	details
hsa-miR-3140-5p	SRP68	signal recognition particle 68	HGNC:11302	details
hsa-miR-3140-5p	FPR2	formyl peptide receptor 2	HGNC:3827	details
hsa-miR-3140-5p	MRPL12	mitochondrial ribosomal protein L12	HGNC:10378	details
hsa-miR-3140-5p	ZNF740	zinc finger protein 740	HGNC:27465	details
hsa-miR-3140-5p	SERPINH1	serpin family H member 1	HGNC:1546	details
hsa-miR-3140-5p	SCD	stearoyl-CoA desaturase	HGNC:10571	details
hsa-miR-3140-5p	AKIRIN1	akirin 1	HGNC:25744	details
hsa-miR-3140-5p	TMEM59	transmembrane protein 59	HGNC:1239	details
hsa-miR-3140-5p	NRARP	NOTCH regulated ankyrin repeat protein	HGNC:33843	details
hsa-miR-3140-5p				details
hsa-miR-3140-5p	ARL6IP6	ADP ribosylation factor like GTPase 6 interacting protein 6	HGNC:24048	details
hsa-miR-3140-5p	FEM1C	fem-1 homolog C	HGNC:16933	details
hsa-miR-3140-5p	PEX13	peroxisomal biogenesis factor 13	HGNC:8855	details
hsa-miR-3140-5p	PDPK1	3-phosphoinositide dependent protein kinase 1	HGNC:8816	details
hsa-miR-3140-5p	SKIL	SKI like proto-oncogene	HGNC:10897	details
hsa-miR-3140-5p	SLC39A14	solute carrier family 39 member 14	HGNC:20858	details
hsa-miR-3140-5p	SP1	Sp1 transcription factor	HGNC:11205	details
hsa-miR-3140-5p	CLDN12	claudin 12	HGNC:2034	details
hsa-miR-3140-5p	PRR14L	proline rich 14 like	HGNC:28738	details
hsa-miR-3140-5p	DLC1	DLC1 Rho GTPase activating protein	HGNC:2897	details
hsa-miR-3140-5p	BHLHE40	basic helix-loop-helix family member e40	HGNC:1046	details
hsa-miR-3140-5p	POU3F3	POU class 3 homeobox 3	HGNC:9216	details
hsa-miR-3140-5p	CACNG8	calcium voltage-gated channel auxiliary subunit gamma 8	HGNC:13628	details
hsa-miR-3140-5p	NEGR1	neuronal growth regulator 1	HGNC:17302	details
hsa-miR-3140-5p	PIP4P2	phosphatidylinositol-4,5-bisphosphate 4-phosphatase 2	HGNC:25452	details
hsa-miR-3140-5p	HID1	HID1 domain containing	HGNC:15736	details
hsa-miR-3140-5p	PDE4C	phosphodiesterase 4C	HGNC:8782	details
hsa-miR-3140-5p	GATAD1	GATA zinc finger domain containing 1	HGNC:29941	details
hsa-miR-3140-5p	LGALS8	galectin 8	HGNC:6569	details
hsa-miR-3140-5p	PANK1	pantothenate kinase 1	HGNC:8598	details
hsa-miR-3140-5p	ENTHD1	ENTH domain containing 1	HGNC:26352	details
hsa-miR-3140-5p	CYLD	CYLD lysine 63 deubiquitinase	HGNC:2584	details
hsa-miR-3140-5p	TEAD1	TEA domain transcription factor 1	HGNC:11714	details
hsa-miR-3140-5p	RANBP2	RAN binding protein 2	HGNC:9848	details
hsa-miR-3140-5p	FNBP1L	formin binding protein 1 like	HGNC:20851	details
hsa-miR-3140-5p	SMARCC1	SWI/SNF related, matrix associated, actin dependent regulator of chromatin subfamily c member 1	HGNC:11104	details
hsa-miR-3140-5p	OTOG	otogelin	HGNC:8516	details
hsa-miR-3140-5p	KDELR1	KDEL endoplasmic reticulum protein retention receptor 1	HGNC:6304	details
hsa-miR-3140-5p	E2F2	E2F transcription factor 2	HGNC:3114	details
hsa-miR-3140-5p	PHTF2	putative homeodomain transcription factor 2	HGNC:13411	details
hsa-miR-3140-5p	GPRC5A	G protein-coupled receptor class C group 5 member A	HGNC:9836	details
hsa-miR-3140-5p	SCAMP2	secretory carrier membrane protein 2	HGNC:10564	details
hsa-miR-3140-5p	DHODH	dihydroorotate dehydrogenase (quinone)	HGNC:2867	details
hsa-miR-3140-5p	BICD2	BICD cargo adaptor 2	HGNC:17208	details
hsa-miR-3140-5p	SIRPB2	signal regulatory protein beta 2	HGNC:16247	details
hsa-miR-3140-5p	MOGAT1	monoacylglycerol O-acyltransferase 1	HGNC:18210	details
hsa-miR-3140-5p	GABRB1	gamma-aminobutyric acid type A receptor subunit beta1	HGNC:4081	details
hsa-miR-3140-5p	RAB6B	RAB6B, member RAS oncogene family	HGNC:14902	details
hsa-miR-3140-5p	ATP6V0E1	ATPase H+ transporting V0 subunit e1	HGNC:863	details
hsa-miR-3140-5p	VPS35	VPS35 retromer complex component	HGNC:13487	details
hsa-miR-3140-5p	GABARAP	GABA type A receptor-associated protein	HGNC:4067	details
hsa-miR-3140-5p	MTHFD1	methylenetetrahydrofolate dehydrogenase, cyclohydrolase and formyltetrahydrofolate synthetase 1	HGNC:7432	details
hsa-miR-3140-5p	PRELID2	PRELI domain containing 2	HGNC:28306	details

miRNA Card

Confidence 3 (3 of 3 tools predicted)

Confidence 2 (2 of 3 tools predicted)

Confidence 1 (1 of 3 tools predicted)