miRNA Card

miRNA General Information
miRNA ID hsa-miR-3163
Description Homo sapiens miR-3163 stem-loop
Comment None
Experiment Illumina [1]
Sequence UAUAAAAUGAGGGCAGUAAGAC
miRNA Expression in different cancers



circRNA-miRNA-gene regulatory network

Note about Netwrok:
This is a network diagram with miRNA (purple circle) as the center.
We used three tools(PITA, miRanda, targetScan) to predict the binding sites of circrna (green circle) and miRNA. Accordingly, for this miRNA that binds to circrna, we have three confidence levels, namely confident 1, confident 2 and confident 3. Confidence value indicates how many tools can deduce these results. For each confidence, we use different kinds of dashed lines.

Target circRNA with confidence

Confidence 3 (3 of 3 tools predicted)

CircID miRNA PITA miRanda targetScan

Confidence 1 (1 of 3 tools predicted)

CircID miRNA PITA miRanda targetScan
chr7:128305692|128305955 hsa-miR-3163 0 1 0
chrX:49174893|49175004 hsa-miR-3163 0 1 0
chr1:108796267|108796644 hsa-miR-3163 0 1 0
chr1:107572648|107572808 hsa-miR-3163 0 1 0
chr5:172768503|172768706 hsa-miR-3163 0 1 0
chr10:28682234|28682405 hsa-miR-3163 0 1 0
chr7:6690796|6691187 hsa-miR-3163 0 1 0
chr2:25239499|25239581 hsa-miR-3163 0 1 0
chr1:151403030|151403129 hsa-miR-3163 0 1 0
chr1:27649473|27649584 hsa-miR-3163 1 0 0
chr14:69771056|69771283 hsa-miR-3163 1 0 0
chr5:179112280|179112391 hsa-miR-3163 1 0 0
chr5:134741069|134741202 hsa-miR-3163 1 0 0
chrX:152972734|152972902 hsa-miR-3163 0 1 0
chr11:34659055|34659323 hsa-miR-3163 0 1 0
chr7:32587331|32587519 hsa-miR-3163 0 1 0
chr19:38947849|38947932 hsa-miR-3163 0 1 0
chr3:141963812|141963963 hsa-miR-3163 0 1 0
chr8:119841811|119841948 hsa-miR-3163 0 1 0
chr2:55544242|55544363 hsa-miR-3163 0 1 0
chr17:29551131|29551241 hsa-miR-3163 0 1 0
chr3:172634715|172634857 hsa-miR-3163 0 1 0
chr11:76797819|76797901 hsa-miR-3163 0 1 0
chr1:64883321|64883457 hsa-miR-3163 0 1 0
chr11:6450573|6450959 hsa-miR-3163 0 1 0
chrX:49174893~49175004 hsa-miR-3163 0 1 0
chr1:153747943~153748084 hsa-miR-3163 0 1 0
chr4:105237094~105237264 hsa-miR-3163 0 1 0
chr8:80037102~80037223 hsa-miR-3163 0 1 0
chr19:52386312~52386456 hsa-miR-3163 0 1 0
chr1:107572648~107572808 hsa-miR-3163 0 1 0
chr17:55392687~55392807 hsa-miR-3163 0 1 0
chr1:52918510~52918739 hsa-miR-3163 0 1 0
chr5:159098931~159099151 hsa-miR-3163 0 1 0
chr15:30770034|30770205 hsa-miR-3163 0 1 0
chr4:140621728~140621836 hsa-miR-3163 0 1 0
chr14:69771056~69771283 hsa-miR-3163 0 1 0
chr17:5628304~5628414 hsa-miR-3163 0 1 0
chr11:119305576~119305817 hsa-miR-3163 0 1 0
chr20:53494905~53495029 hsa-miR-3163 0 1 0
chr8:80037102|80037223 hsa-miR-3163 0 1 0
chr2:96253088~96253284 hsa-miR-3163 0 1 0
chr5:179112280~179112391 hsa-miR-3163 0 1 0
chr15:65196537~65196713 hsa-miR-3163 0 1 0
chr5:134741069~134741202 hsa-miR-3163 0 1 0
chr6:31863369~31863598 hsa-miR-3163 0 1 0
chr15:74799524|74799760 hsa-miR-3163 0 1 0
chr5:68236102|68236239 hsa-miR-3163 0 1 0
chr17:20126244|20126340 hsa-miR-3163 0 1 0
chr4:139046266|139046407 hsa-miR-3163 0 1 0
chr8:38973699|38973832 hsa-miR-3163 0 1 0
chr15:30769966|30770205 hsa-miR-3163 0 1 0
chr2:10322351|10322432 hsa-miR-3163 0 1 0
chr16:50317691|50317861 hsa-miR-3163 0 1 0
chr19:40321321|40321449 hsa-miR-3163 1 0 0
chr1:27649446|27649584 hsa-miR-3163 1 0 0
chr14:102194938|102197847 hsa-miR-3163 1 0 0
chr5:77708242|77708313 hsa-miR-3163 1 0 0
chr1:27649482|27649584 hsa-miR-3163 1 0 0
chr1:27649479|27649584 hsa-miR-3163 1 0 0
chrX:107555220|107555380 hsa-miR-3163 0 1 0
chr1:151403266|151403387 hsa-miR-3163 0 1 0
chr1:43281629|43281791 hsa-miR-3163 0 1 0
chr1:236899256|236899366 hsa-miR-3163 0 1 0
chr9:110169578|110169765 hsa-miR-3163 0 1 0
chr17:29551108|29551387 hsa-miR-3163 0 1 0
chr6:31863462|31863587 hsa-miR-3163 0 1 0
chr8:123206125|123206293 hsa-miR-3163 0 1 0
chr13:46751844|46752026 hsa-miR-3163 0 1 0
chr2:237327052|237327141 hsa-miR-3163 0 1 0
chr15:55829803|55829921 hsa-miR-3163 0 1 0
chr17:55392675|55392798 hsa-miR-3163 0 1 0
chr7:100036298|100036440 hsa-miR-3163 0 1 0
chr17:55392703|55392809 hsa-miR-3163 0 1 0
chr20:6076927|6077042 hsa-miR-3163 0 1 0
chr2:69145957|69146147 hsa-miR-3163 0 1 0
chr11:34659227|34659401 hsa-miR-3163 0 1 0
chr15:90643549|90643698 hsa-miR-3163 0 1 0
chr5:172768493|172768672 hsa-miR-3163 0 1 0
chr16:85675930|85676040 hsa-miR-3163 0 1 0
chr7:92563994|92564106 hsa-miR-3163 0 1 0
chr3:15045948|15046228 hsa-miR-3163 0 1 0
chr15:65196537|65196713 hsa-miR-3163 0 1 0
chr2:127763669|127763760 hsa-miR-3163 0 1 0
chr8:80037102|80037276 hsa-miR-3163 0 1 0
chr1:47050085|47050227 hsa-miR-3163 -14 1 0
chr1:236899254|236899366 hsa-miR-3163 -9 1 0
chr1:27762365|27762544 hsa-miR-3163 0 1 0
chr1:27649470|27649584 hsa-miR-3163 1 0 0
chr1:27649443|27649584 hsa-miR-3163 1 0 0
chr4:9776162|9776337 hsa-miR-3163 1 0 0
chr12:46358767|46358866 hsa-miR-3163 1 0 0
chr16:77200880|77201062 hsa-miR-3163 1 0 0
chr1:27649435|27649584 hsa-miR-3163 1 0 0
chr10:68341247|68341384 hsa-miR-3163 0 1 0
chr2:55544048|55544369 hsa-miR-3163 0 1 0
chr12:120700567|120700844 hsa-miR-3163 0 1 0
chr10:68341253|68341644 hsa-miR-3163 0 1 0
chr16:64944087|64944266 hsa-miR-3163 0 1 0
chr2:173196905|173197089 hsa-miR-3163 0 1 0
chr8:119841818|119841948 hsa-miR-3163 0 1 0
chr5:151489266|151489399 hsa-miR-3163 0 1 0
chr6:31863369|31863598 hsa-miR-3163 0 1 0
chr10:28682039|28682405 hsa-miR-3163 0 1 0
chr5:128161660|128161800 hsa-miR-3163 0 1 0
chr1:212620193|212620281 hsa-miR-3163 0 1 0
chr8:43130252|43130399 hsa-miR-3163 0 1 0
chr18:12343874|12344060 hsa-miR-3163 0 1 0
chr14:22773110|22773333 hsa-miR-3163 0 1 0
chr13:75596777|75596919 hsa-miR-3163 0 1 0
chr1:212620226|212620281 hsa-miR-3163 0 1 0
chr14:55673234|55675918 hsa-miR-3163 0 1 0
chr9:110169594|110169765 hsa-miR-3163 0 1 0
chr19:52386312|52386456 hsa-miR-3163 0 1 0
chr4:99061191|99061395 hsa-miR-3163 0 1 0
chr15:90981002|90981636 hsa-miR-3163 0 1 0
chr11:86808797|86808916 hsa-miR-3163 0 1 0
chr9:127941779|127941944 hsa-miR-3163 1 0 0
chr14:69770995|69771324 hsa-miR-3163 1 0 0
chr5:77708242|77708347 hsa-miR-3163 1 0 0
chr7:100036313|100036440 hsa-miR-3163 1 0 0
chr1:27649461|27649584 hsa-miR-3163 1 0 0
chr16:81711260|81711520 hsa-miR-3163 1 0 0
chr3:108138108|108138248 hsa-miR-3163 1 0 0
chr7:6461433|6461615 hsa-miR-3163 1 0 0
chr2:30350504|30350720 hsa-miR-3163 1 0 0
Target genes
miRNA Gene Gene Description HGNC ID details
hsa-miR-3163 CNKSR3 CNKSR family member 3 HGNC:23034 details
hsa-miR-3163 FRS2 fibroblast growth factor receptor substrate 2 HGNC:16971 details
hsa-miR-3163 MTX3 metaxin 3 HGNC:24812 details
hsa-miR-3163 MAPK8 mitogen-activated protein kinase 8 HGNC:6881 details
hsa-miR-3163 DSCC1 DNA replication and sister chromatid cohesion 1 HGNC:24453 details
hsa-miR-3163 IPPK inositol-pentakisphosphate 2-kinase HGNC:14645 details
hsa-miR-3163 ARHGAP29 Rho GTPase activating protein 29 HGNC:30207 details
hsa-miR-3163 TMX1 thioredoxin related transmembrane protein 1 HGNC:15487 details
hsa-miR-3163 CHML CHM like Rab escort protein HGNC:1941 details
hsa-miR-3163 ANP32B acidic nuclear phosphoprotein 32 family member B HGNC:16677 details
hsa-miR-3163 PHIP pleckstrin homology domain interacting protein HGNC:15673 details
hsa-miR-3163 INTS8 integrator complex subunit 8 HGNC:26048 details
hsa-miR-3163 FCHO2 FCH and mu domain containing endocytic adaptor 2 HGNC:25180 details
hsa-miR-3163 CMSS1 cms1 ribosomal small subunit homolog HGNC:28666 details
hsa-miR-3163 TMEM251 transmembrane protein 251 HGNC:20218 details
hsa-miR-3163 CWC27 CWC27 spliceosome associated cyclophilin HGNC:10664 details
hsa-miR-3163 KL klotho HGNC:6344 details
hsa-miR-3163 HSPA14 heat shock protein family A (Hsp70) member 14 HGNC:29526 details
hsa-miR-3163 HMGN4 high mobility group nucleosomal binding domain 4 HGNC:4989 details
hsa-miR-3163 CLIC4 chloride intracellular channel 4 HGNC:13518 details
hsa-miR-3163 ZFAND4 zinc finger AN1-type containing 4 HGNC:23504 details
hsa-miR-3163 ARGFX arginine-fifty homeobox HGNC:30146 details
hsa-miR-3163 ATAD5 ATPase family AAA domain containing 5 HGNC:25752 details
hsa-miR-3163 TPCN2 two pore segment channel 2 HGNC:20820 details
hsa-miR-3163 WDR35 WD repeat domain 35 HGNC:29250 details
hsa-miR-3163 LNPK lunapark, ER junction formation factor HGNC:21610 details
hsa-miR-3163 BRMS1L BRMS1 like transcriptional repressor HGNC:20512 details
hsa-miR-3163 SMC3 structural maintenance of chromosomes 3 HGNC:2468 details
hsa-miR-3163 RHEBP1 RHEB pseudogene 1 HGNC:10010 details
hsa-miR-3163 TRAF6 TNF receptor associated factor 6 HGNC:12036 details
hsa-miR-3163 PALM2 paralemmin 2 HGNC:15845 details
hsa-miR-3163 ARSK arylsulfatase family member K HGNC:25239 details
hsa-miR-3163 ELAVL4 ELAV like RNA binding protein 4 HGNC:3315 details
hsa-miR-3163 ST8SIA5 ST8 alpha-N-acetyl-neuraminide alpha-2,8-sialyltransferase 5 HGNC:17827 details
hsa-miR-3163 IMP3 IMP U3 small nucleolar ribonucleoprotein 3 HGNC:14497 details
hsa-miR-3163 GABRB3 gamma-aminobutyric acid type A receptor subunit beta3 HGNC:4083 details
hsa-miR-3163 MSI2 musashi RNA binding protein 2 HGNC:18585 details
hsa-miR-3163 TRMT5 tRNA methyltransferase 5 HGNC:23141 details
hsa-miR-3163 AADAC arylacetamide deacetylase HGNC:17 details
hsa-miR-3163 NECTIN3 nectin cell adhesion molecule 3 HGNC:17664 details
hsa-miR-3163 HMGN2 high mobility group nucleosomal binding domain 2 HGNC:4986 details
hsa-miR-3163 ATAD2 ATPase family AAA domain containing 2 HGNC:30123 details
hsa-miR-3163 GRK2 G protein-coupled receptor kinase 2 HGNC:289 details
hsa-miR-3163 GPBP1L1 GC-rich promoter binding protein 1 like 1 HGNC:28843 details
hsa-miR-3163 ZFHX3 zinc finger homeobox 3 HGNC:777 details
hsa-miR-3163 WEE1 WEE1 G2 checkpoint kinase HGNC:12761 details
hsa-miR-3163 VGLL4 vestigial like family member 4 HGNC:28966 details
hsa-miR-3163 VEGFA vascular endothelial growth factor A HGNC:12680 details
hsa-miR-3163 UBN2 ubinuclein 2 HGNC:21931 details
hsa-miR-3163 details
hsa-miR-3163 TNRC6A trinucleotide repeat containing adaptor 6A HGNC:11969 details
hsa-miR-3163 TM9SF3 transmembrane 9 superfamily member 3 HGNC:21529 details
hsa-miR-3163 KLHL11 kelch like family member 11 HGNC:19008 details
hsa-miR-3163 KDELR1 KDEL endoplasmic reticulum protein retention receptor 1 HGNC:6304 details
hsa-miR-3163 ITPR1 inositol 1,4,5-trisphosphate receptor type 1 HGNC:6180 details
hsa-miR-3163 HNRNPU heterogeneous nuclear ribonucleoprotein U HGNC:5048 details
hsa-miR-3163 CTTN cortactin HGNC:3338 details
hsa-miR-3163 CCNT2 cyclin T2 HGNC:1600 details
hsa-miR-3163 details
hsa-miR-3163 BTF3L4 basic transcription factor 3 like 4 HGNC:30547 details
hsa-miR-3163 BTBD3 BTB domain containing 3 HGNC:15854 details
hsa-miR-3163 BBX BBX high mobility group box domain containing HGNC:14422 details
hsa-miR-3163 FOXB1 forkhead box B1 HGNC:3799 details
hsa-miR-3163 TYRP1 tyrosinase related protein 1 HGNC:12450 details
hsa-miR-3163 THBS1 thrombospondin 1 HGNC:11785 details
hsa-miR-3163 SOX4 SRY-box transcription factor 4 HGNC:11200 details
hsa-miR-3163 details
hsa-miR-3163 IGF1R insulin like growth factor 1 receptor HGNC:5465 details
hsa-miR-3163 PPIL4 peptidylprolyl isomerase like 4 HGNC:15702 details
hsa-miR-3163 DUSP7 dual specificity phosphatase 7 HGNC:3073 details
hsa-miR-3163 CPEB2 cytoplasmic polyadenylation element binding protein 2 HGNC:21745 details
hsa-miR-3163 GCK glucokinase HGNC:4195 details
hsa-miR-3163 PTMA prothymosin alpha HGNC:9623 details
hsa-miR-3163 RPSAP58 ribosomal protein SA pseudogene 58 HGNC:36809 details
hsa-miR-3163 ZNF606 zinc finger protein 606 HGNC:25879 details
hsa-miR-3163 RBFOX2 RNA binding fox-1 homolog 2 HGNC:9906 details
hsa-miR-3163 POM121C POM121 transmembrane nucleoporin C HGNC:34005 details
hsa-miR-3163 E2F7 E2F transcription factor 7 HGNC:23820 details
hsa-miR-3163 RAB3B RAB3B, member RAS oncogene family HGNC:9778 details
hsa-miR-3163 ZIC5 Zic family member 5 HGNC:20322 details
hsa-miR-3163 USP6NL USP6 N-terminal like HGNC:16858 details
hsa-miR-3163 STMN1 stathmin 1 HGNC:6510 details
hsa-miR-3163 details
hsa-miR-3163 RNF11 ring finger protein 11 HGNC:10056 details
hsa-miR-3163 PFKP phosphofructokinase, platelet HGNC:8878 details
hsa-miR-3163 NUFIP2 nuclear FMR1 interacting protein 2 HGNC:17634 details
hsa-miR-3163 METAP2 methionyl aminopeptidase 2 HGNC:16672 details
hsa-miR-3163 KIF23 kinesin family member 23 HGNC:6392 details
hsa-miR-3163 HNRNPUL1 heterogeneous nuclear ribonucleoprotein U like 1 HGNC:17011 details
hsa-miR-3163 details
hsa-miR-3163 GAN gigaxonin HGNC:4137 details
hsa-miR-3163 EMC7 ER membrane protein complex subunit 7 HGNC:24301 details
hsa-miR-3163 DEPDC1 DEP domain containing 1 HGNC:22949 details
hsa-miR-3163 BTG3 BTG anti-proliferation factor 3 HGNC:1132 details
hsa-miR-3163 ATP13A3 ATPase 13A3 HGNC:24113 details
hsa-miR-3163 ARL5B ADP ribosylation factor like GTPase 5B HGNC:23052 details
hsa-miR-3163 NRIP1 nuclear receptor interacting protein 1 HGNC:8001 details
hsa-miR-3163 ETV6 ETS variant transcription factor 6 HGNC:3495 details
hsa-miR-3163 ELF2 E74 like ETS transcription factor 2 HGNC:3317 details
hsa-miR-3163 TMCO1 transmembrane and coiled-coil domains 1 HGNC:18188 details
hsa-miR-3163 CUL2 cullin 2 HGNC:2552 details
hsa-miR-3163 EFHC1 EF-hand domain containing 1 HGNC:16406 details
hsa-miR-3163 LARP1 La ribonucleoprotein 1, translational regulator HGNC:29531 details
hsa-miR-3163 WDR76 WD repeat domain 76 HGNC:25773 details
hsa-miR-3163 ZNF264 zinc finger protein 264 HGNC:13057 details
hsa-miR-3163 YWHAZ tyrosine 3-monooxygenase/tryptophan 5-monooxygenase activation protein zeta HGNC:12855 details
hsa-miR-3163 TMED7 transmembrane p24 trafficking protein 7 HGNC:24253 details
hsa-miR-3163 SENP3 SUMO specific peptidase 3 HGNC:17862 details
hsa-miR-3163 details
hsa-miR-3163 MRGBP MRG domain binding protein HGNC:15866 details
hsa-miR-3163 HMGXB4 HMG-box containing 4 HGNC:5003 details
hsa-miR-3163 ID4 inhibitor of DNA binding 4, HLH protein HGNC:5363 details
hsa-miR-3163 TRPM6 transient receptor potential cation channel subfamily M member 6 HGNC:17995 details
hsa-miR-3163 OSBPL3 oxysterol binding protein like 3 HGNC:16370 details
hsa-miR-3163 ACER3 alkaline ceramidase 3 HGNC:16066 details
hsa-miR-3163 CABP4 calcium binding protein 4 HGNC:1386 details
hsa-miR-3163 MYBPC1 myosin binding protein C1 HGNC:7549 details
hsa-miR-3163 AJAP1 adherens junctions associated protein 1 HGNC:30801 details
hsa-miR-3163 GLRX2 glutaredoxin 2 HGNC:16065 details
hsa-miR-3163 COPS8 COP9 signalosome subunit 8 HGNC:24335 details
hsa-miR-3163 SCIN scinderin HGNC:21695 details
hsa-miR-3163 ZNF609 zinc finger protein 609 HGNC:29003 details
hsa-miR-3163 TBCEL tubulin folding cofactor E like HGNC:28115 details
hsa-miR-3163 PRDX3 peroxiredoxin 3 HGNC:9354 details
hsa-miR-3163 PCGF2 polycomb group ring finger 2 HGNC:12929 details
hsa-miR-3163 MYBL1 MYB proto-oncogene like 1 HGNC:7547 details
hsa-miR-3163 KLF7 Kruppel like factor 7 HGNC:6350 details
hsa-miR-3163 ITPRIPL2 ITPRIP like 2 HGNC:27257 details
hsa-miR-3163 CDCA4 cell division cycle associated 4 HGNC:14625 details
hsa-miR-3163 CALM1 calmodulin 1 HGNC:1442 details
hsa-miR-3163 C1orf50 chromosome 1 open reading frame 50 HGNC:28795 details
hsa-miR-3163 ARSJ arylsulfatase family member J HGNC:26286 details
hsa-miR-3163 ZNF253 zinc finger protein 253 HGNC:13497 details
hsa-miR-3163 C4orf17 chromosome 4 open reading frame 17 HGNC:25274 details
hsa-miR-3163 USP51 ubiquitin specific peptidase 51 HGNC:23086 details
hsa-miR-3163 FAM71F2 family with sequence similarity 71 member F2 HGNC:27998 details
hsa-miR-3163 POU5F1B POU class 5 homeobox 1B HGNC:9223 details
hsa-miR-3163 ZNF223 zinc finger protein 223 HGNC:13016 details
hsa-miR-3163 MEAF6 MYST/Esa1 associated factor 6 HGNC:25674 details
hsa-miR-3163 AVPI1 arginine vasopressin induced 1 HGNC:30898 details
hsa-miR-3163 ISLR2 immunoglobulin superfamily containing leucine rich repeat 2 HGNC:29286 details
hsa-miR-3163 ATRNL1 attractin like 1 HGNC:29063 details
hsa-miR-3163 TMLHE trimethyllysine hydroxylase, epsilon HGNC:18308 details
hsa-miR-3163 NSUN7 NOP2/Sun RNA methyltransferase family member 7 HGNC:25857 details
hsa-miR-3163 POLR3K RNA polymerase III subunit K HGNC:14121 details
hsa-miR-3163 TXNDC16 thioredoxin domain containing 16 HGNC:19965 details
hsa-miR-3163 details
hsa-miR-3163 NOL11 nucleolar protein 11 HGNC:24557 details
hsa-miR-3163 WIPF2 WAS/WASL interacting protein family member 2 HGNC:30923 details
hsa-miR-3163 TBL1X transducin beta like 1 X-linked HGNC:11585 details
hsa-miR-3163 SCML2 Scm polycomb group protein like 2 HGNC:10581 details
hsa-miR-3163 PFN1 profilin 1 HGNC:8881 details
hsa-miR-3163 PARD6B par-6 family cell polarity regulator beta HGNC:16245 details
hsa-miR-3163 PAK2 p21 (RAC1) activated kinase 2 HGNC:8591 details
hsa-miR-3163 LRIG2 leucine rich repeats and immunoglobulin like domains 2 HGNC:20889 details
hsa-miR-3163 LMOD2 leiomodin 2 HGNC:6648 details
hsa-miR-3163 TMEM131L transmembrane 131 like HGNC:29146 details
hsa-miR-3163 INIP INTS3 and NABP interacting protein HGNC:24994 details
hsa-miR-3163 HIVEP1 HIVEP zinc finger 1 HGNC:4920 details
hsa-miR-3163 HAS3 hyaluronan synthase 3 HGNC:4820 details
hsa-miR-3163 FAM102B family with sequence similarity 102 member B HGNC:27637 details
hsa-miR-3163 ELK3 ETS transcription factor ELK3 HGNC:3325 details
hsa-miR-3163 EFNB2 ephrin B2 HGNC:3227 details
hsa-miR-3163 DLC1 DLC1 Rho GTPase activating protein HGNC:2897 details
hsa-miR-3163 DGKH diacylglycerol kinase eta HGNC:2854 details
hsa-miR-3163 CSNK2A1 casein kinase 2 alpha 1 HGNC:2457 details
hsa-miR-3163 C17orf75 chromosome 17 open reading frame 75 HGNC:30173 details
hsa-miR-3163 PPP2R5E protein phosphatase 2 regulatory subunit B'epsilon HGNC:9313 details
hsa-miR-3163 HSPA1B heat shock protein family A (Hsp70) member 1B HGNC:5233 details
hsa-miR-3163 HSBP1 heat shock factor binding protein 1 HGNC:5203 details
hsa-miR-3163 ZNF556 zinc finger protein 556 HGNC:25669 details
hsa-miR-3163 COCH cochlin HGNC:2180 details
hsa-miR-3163 APIP APAF1 interacting protein HGNC:17581 details
hsa-miR-3163 ZNF860 zinc finger protein 860 HGNC:34513 details
hsa-miR-3163 ZNF383 zinc finger protein 383 HGNC:18609 details
hsa-miR-3163 PTBP1 polypyrimidine tract binding protein 1 HGNC:9583 details
hsa-miR-3163 ZNF224 zinc finger protein 224 HGNC:13017 details
hsa-miR-3163 CSTF2T cleavage stimulation factor subunit 2 tau variant HGNC:17086 details
hsa-miR-3163 SGPP2 sphingosine-1-phosphate phosphatase 2 HGNC:19953 details
hsa-miR-3163 C15orf40 chromosome 15 open reading frame 40 HGNC:28443 details
hsa-miR-3163 SLC39A6 solute carrier family 39 member 6 HGNC:18607 details
hsa-miR-3163 RSL24D1 ribosomal L24 domain containing 1 HGNC:18479 details
hsa-miR-3163 GIMAP4 GTPase, IMAP family member 4 HGNC:21872 details
hsa-miR-3163 ZC3H4 zinc finger CCCH-type containing 4 HGNC:17808 details
hsa-miR-3163 XKR4 XK related 4 HGNC:29394 details
hsa-miR-3163 USP13 ubiquitin specific peptidase 13 HGNC:12611 details
hsa-miR-3163 TRIAP1 TP53 regulated inhibitor of apoptosis 1 HGNC:26937 details
hsa-miR-3163 SLC6A8 solute carrier family 6 member 8 HGNC:11055 details
hsa-miR-3163 RUNX1T1 RUNX1 partner transcriptional co-repressor 1 HGNC:1535 details
hsa-miR-3163 RNPS1 RNA binding protein with serine rich domain 1 HGNC:10080 details
hsa-miR-3163 PIGW phosphatidylinositol glycan anchor biosynthesis class W HGNC:23213 details
hsa-miR-3163 PDZD8 PDZ domain containing 8 HGNC:26974 details
hsa-miR-3163 NUMB NUMB endocytic adaptor protein HGNC:8060 details
hsa-miR-3163 MORF4L1 mortality factor 4 like 1 HGNC:16989 details
hsa-miR-3163 MED13 mediator complex subunit 13 HGNC:22474 details
hsa-miR-3163 LRRFIP2 LRR binding FLII interacting protein 2 HGNC:6703 details
hsa-miR-3163 LRIG3 leucine rich repeats and immunoglobulin like domains 3 HGNC:30991 details
hsa-miR-3163 LIN28B lin-28 homolog B HGNC:32207 details
hsa-miR-3163 details
hsa-miR-3163 HOXA9 homeobox A9 HGNC:5109 details
hsa-miR-3163 GOLIM4 golgi integral membrane protein 4 HGNC:15448 details
hsa-miR-3163 GFPT1 glutamine--fructose-6-phosphate transaminase 1 HGNC:4241 details
hsa-miR-3163 DCTN6 dynactin subunit 6 HGNC:16964 details
hsa-miR-3163 CRK CRK proto-oncogene, adaptor protein HGNC:2362 details
hsa-miR-3163 CHIC1 cysteine rich hydrophobic domain 1 HGNC:1934 details
hsa-miR-3163 CCND2 cyclin D2 HGNC:1583 details
hsa-miR-3163 CBX3 chromobox 3 HGNC:1553 details
hsa-miR-3163 BEND4 BEN domain containing 4 HGNC:23815 details
hsa-miR-3163 ARC activity regulated cytoskeleton associated protein HGNC:648 details
hsa-miR-3163 ACSL4 acyl-CoA synthetase long chain family member 4 HGNC:3571 details
hsa-miR-3163 TLE3 TLE family member 3, transcriptional corepressor HGNC:11839 details
hsa-miR-3163 APOL6 apolipoprotein L6 HGNC:14870 details
hsa-miR-3163 SLC39A7 solute carrier family 39 member 7 HGNC:4927 details
hsa-miR-3163 SPPL3 signal peptide peptidase like 3 HGNC:30424 details
hsa-miR-3163 SART3 spliceosome associated factor 3, U4/U6 recycling protein HGNC:16860 details
hsa-miR-3163 ZNF608 zinc finger protein 608 HGNC:29238 details
hsa-miR-3163 USP28 ubiquitin specific peptidase 28 HGNC:12625 details
hsa-miR-3163 TRIB1 tribbles pseudokinase 1 HGNC:16891 details
hsa-miR-3163 TGIF1 TGFB induced factor homeobox 1 HGNC:11776 details
hsa-miR-3163 SLX4 SLX4 structure-specific endonuclease subunit HGNC:23845 details
hsa-miR-3163 RRAGD Ras related GTP binding D HGNC:19903 details
hsa-miR-3163 RRAGC Ras related GTP binding C HGNC:19902 details
hsa-miR-3163 RGMB repulsive guidance molecule BMP co-receptor b HGNC:26896 details
hsa-miR-3163 REL REL proto-oncogene, NF-kB subunit HGNC:9954 details
hsa-miR-3163 PTPRD protein tyrosine phosphatase receptor type D HGNC:9668 details
hsa-miR-3163 PNRC2 proline rich nuclear receptor coactivator 2 HGNC:23158 details
hsa-miR-3163 PAFAH1B2 platelet activating factor acetylhydrolase 1b catalytic subunit 2 HGNC:8575 details
hsa-miR-3163 MTF2 metal response element binding transcription factor 2 HGNC:29535 details
hsa-miR-3163 KLF13 Kruppel like factor 13 HGNC:13672 details
hsa-miR-3163 details
hsa-miR-3163 FAM217B family with sequence similarity 217 member B HGNC:16170 details
hsa-miR-3163 EIF5A2 eukaryotic translation initiation factor 5A2 HGNC:3301 details
hsa-miR-3163 EFCAB14 EF-hand calcium binding domain 14 HGNC:29051 details
hsa-miR-3163 CLIP1 CAP-Gly domain containing linker protein 1 HGNC:10461 details
hsa-miR-3163 BTN3A3 butyrophilin subfamily 3 member A3 HGNC:1140 details
hsa-miR-3163 ATG14 autophagy related 14 HGNC:19962 details
hsa-miR-3163 ZNF680 zinc finger protein 680 HGNC:26897 details
hsa-miR-3163 HIPK1 homeodomain interacting protein kinase 1 HGNC:19006 details
hsa-miR-3163 RAB18 RAB18, member RAS oncogene family HGNC:14244 details
hsa-miR-3163 RAC3 Rac family small GTPase 3 HGNC:9803 details
hsa-miR-3163 NOM1 nucleolar protein with MIF4G domain 1 HGNC:13244 details
hsa-miR-3163 SKP2 S-phase kinase associated protein 2 HGNC:10901 details
hsa-miR-3163 CCNB1 cyclin B1 HGNC:1579 details
hsa-miR-3163 TUBB2A tubulin beta 2A class IIa HGNC:12412 details
hsa-miR-3163 TCERG1 transcription elongation regulator 1 HGNC:15630 details
hsa-miR-3163 SON SON DNA and RNA binding protein HGNC:11183 details
hsa-miR-3163 MYLIP myosin regulatory light chain interacting protein HGNC:21155 details
hsa-miR-3163 MSANTD4 Myb/SANT DNA binding domain containing 4 with coiled-coils HGNC:29383 details
hsa-miR-3163 LMNB2 lamin B2 HGNC:6638 details
hsa-miR-3163 KLHL15 kelch like family member 15 HGNC:29347 details
hsa-miR-3163 ANP32A acidic nuclear phosphoprotein 32 family member A HGNC:13233 details
hsa-miR-3163 C17orf58 chromosome 17 open reading frame 58 HGNC:27568 details
hsa-miR-3163 PNMA2 PNMA family member 2 HGNC:9159 details
hsa-miR-3163 TNIP2 TNFAIP3 interacting protein 2 HGNC:19118 details
hsa-miR-3163 U2AF2 U2 small nuclear RNA auxiliary factor 2 HGNC:23156 details
hsa-miR-3163 NOLC1 nucleolar and coiled-body phosphoprotein 1 HGNC:15608 details
hsa-miR-3163 ORC4 origin recognition complex subunit 4 HGNC:8490 details
hsa-miR-3163 SPIN4 spindlin family member 4 HGNC:27040 details
hsa-miR-3163 details
hsa-miR-3163 SSBP4 single stranded DNA binding protein 4 HGNC:15676 details
hsa-miR-3163 TLR3 toll like receptor 3 HGNC:11849 details
hsa-miR-3163 HSD17B12 hydroxysteroid 17-beta dehydrogenase 12 HGNC:18646 details
hsa-miR-3163 SDE2 SDE2 telomere maintenance homolog HGNC:26643 details
hsa-miR-3163 ZCCHC14 zinc finger CCHC-type containing 14 HGNC:24134 details
hsa-miR-3163 XPOT exportin for tRNA HGNC:12826 details
hsa-miR-3163 NHS NHS actin remodeling regulator HGNC:7820 details
hsa-miR-3163 RHOB ras homolog family member B HGNC:668 details
hsa-miR-3163 REV3L REV3 like, DNA directed polymerase zeta catalytic subunit HGNC:9968 details
hsa-miR-3163 PURA purine rich element binding protein A HGNC:9701 details
hsa-miR-3163 PPP3R1 protein phosphatase 3 regulatory subunit B, alpha HGNC:9317 details
hsa-miR-3163 POU2F1 POU class 2 homeobox 1 HGNC:9212 details
hsa-miR-3163 PIM3 Pim-3 proto-oncogene, serine/threonine kinase HGNC:19310 details
hsa-miR-3163 PDCD4 programmed cell death 4 HGNC:8763 details
hsa-miR-3163 PANK3 pantothenate kinase 3 HGNC:19365 details
hsa-miR-3163 NUP50 nucleoporin 50 HGNC:8065 details
hsa-miR-3163 NFATC3 nuclear factor of activated T cells 3 HGNC:7777 details
hsa-miR-3163 LMNB1 lamin B1 HGNC:6637 details
hsa-miR-3163 DDX3X DEAD-box helicase 3 X-linked HGNC:2745 details
hsa-miR-3163 DAZAP2 DAZ associated protein 2 HGNC:2684 details
hsa-miR-3163 SLC7A11 solute carrier family 7 member 11 HGNC:11059 details
hsa-miR-3163 RBM12B RNA binding motif protein 12B HGNC:32310 details
hsa-miR-3163 STX7 syntaxin 7 HGNC:11442 details
hsa-miR-3163 HNRNPDL heterogeneous nuclear ribonucleoprotein D like HGNC:5037 details
hsa-miR-3163 PDE12 phosphodiesterase 12 HGNC:25386 details
hsa-miR-3163 IGSF11 immunoglobulin superfamily member 11 HGNC:16669 details
hsa-miR-3163 PCK1 phosphoenolpyruvate carboxykinase 1 HGNC:8724 details
hsa-miR-3163 CACNG2 calcium voltage-gated channel auxiliary subunit gamma 2 HGNC:1406 details
hsa-miR-3163 details
hsa-miR-3163 GTDC1 glycosyltransferase like domain containing 1 HGNC:20887 details
hsa-miR-3163 ABCC12 ATP binding cassette subfamily C member 12 HGNC:14640 details
hsa-miR-3163 WEE2 WEE2 oocyte meiosis inhibiting kinase HGNC:19684 details
hsa-miR-3163 SPOP speckle type BTB/POZ protein HGNC:11254 details
hsa-miR-3163 MKX mohawk homeobox HGNC:23729 details
hsa-miR-3163 ZWINT ZW10 interacting kinetochore protein HGNC:13195 details
hsa-miR-3163 DUSP10 dual specificity phosphatase 10 HGNC:3065 details
hsa-miR-3163 CENPL centromere protein L HGNC:17879 details
hsa-miR-3163 TRIP10 thyroid hormone receptor interactor 10 HGNC:12304 details
hsa-miR-3163 ZNF582 zinc finger protein 582 HGNC:26421 details
hsa-miR-3163 ADAMTS18 ADAM metallopeptidase with thrombospondin type 1 motif 18 HGNC:17110 details
hsa-miR-3163 CD68 CD68 molecule HGNC:1693 details
hsa-miR-3163 TIGD2 tigger transposable element derived 2 HGNC:18333 details
hsa-miR-3163 PSPH phosphoserine phosphatase HGNC:9577 details
hsa-miR-3163 ELK4 ETS transcription factor ELK4 HGNC:3326 details
hsa-miR-3163 CDON cell adhesion associated, oncogene regulated HGNC:17104 details
hsa-miR-3163 KLHL42 kelch like family member 42 HGNC:29252 details
hsa-miR-3163 CHD9 chromodomain helicase DNA binding protein 9 HGNC:25701 details
hsa-miR-3163 RPL37A ribosomal protein L37a HGNC:10348 details
hsa-miR-3163 PIK3CG phosphatidylinositol-4,5-bisphosphate 3-kinase catalytic subunit gamma HGNC:8978 details
hsa-miR-3163 AQP3 aquaporin 3 (Gill blood group) HGNC:636 details
hsa-miR-3163 ZBTB7A zinc finger and BTB domain containing 7A HGNC:18078 details
hsa-miR-3163 TM4SF1 transmembrane 4 L six family member 1 HGNC:11853 details
hsa-miR-3163 MYPN myopalladin HGNC:23246 details
hsa-miR-3163 HERPUD2 HERPUD family member 2 HGNC:21915 details
hsa-miR-3163 GPR21 G protein-coupled receptor 21 HGNC:4476 details
hsa-miR-3163 PRRC2C proline rich coiled-coil 2C HGNC:24903 details
hsa-miR-3163 APOL4 apolipoprotein L4 HGNC:14867 details
hsa-miR-3163 SULT1B1 sulfotransferase family 1B member 1 HGNC:17845 details
hsa-miR-3163 details
hsa-miR-3163 AXL AXL receptor tyrosine kinase HGNC:905 details
hsa-miR-3163 FAM118A family with sequence similarity 118 member A HGNC:1313 details
hsa-miR-3163 PNISR PNN interacting serine and arginine rich protein HGNC:21222 details
hsa-miR-3163 OTUD4 OTU deubiquitinase 4 HGNC:24949 details
hsa-miR-3163 ADD2 adducin 2 HGNC:244 details
hsa-miR-3163 EXOSC6 exosome component 6 HGNC:19055 details
hsa-miR-3163 RWDD2A RWD domain containing 2A HGNC:21385 details
hsa-miR-3163 MLLT1 MLLT1 super elongation complex subunit HGNC:7134 details
hsa-miR-3163 NCKAP1 NCK associated protein 1 HGNC:7666 details
hsa-miR-3163 LRP2BP LRP2 binding protein HGNC:25434 details
hsa-miR-3163 PICALM phosphatidylinositol binding clathrin assembly protein HGNC:15514 details
hsa-miR-3163 MSH2 mutS homolog 2 HGNC:7325 details
hsa-miR-3163 MSH3 mutS homolog 3 HGNC:7326 details
hsa-miR-3163 CGN cingulin HGNC:17429 details
hsa-miR-3163 PLEKHA6 pleckstrin homology domain containing A6 HGNC:17053 details
hsa-miR-3163 PRRC2B proline rich coiled-coil 2B HGNC:28121 details
hsa-miR-3163 RGP1 RGP1 homolog, RAB6A GEF complex partner 1 HGNC:21965 details
hsa-miR-3163 AGAP9 ArfGAP with GTPase domain, ankyrin repeat and PH domain 9 HGNC:23463 details
hsa-miR-3163 DTWD1 DTW domain containing 1 HGNC:30926 details
hsa-miR-3163 GINS2 GINS complex subunit 2 HGNC:24575 details
hsa-miR-3163 NBPF11 NBPF member 11 HGNC:31993 details
hsa-miR-3163 TPM3 tropomyosin 3 HGNC:12012 details
hsa-miR-3163 NRP2 neuropilin 2 HGNC:8005 details
hsa-miR-3163 SNX2 sorting nexin 2 HGNC:11173 details
hsa-miR-3163 TRAM2 translocation associated membrane protein 2 HGNC:16855 details