miRNA Card

miRNA General Information
miRNA ID hsa-miR-3529-3p
Description Homo sapiens miR-3529 stem-loop
Comment None
Experiment
Sequence AACAACAAAAUCACUAGUCUUCCA
miRNA Expression in different cancers

    by mir_boxplot.py

circRNA-miRNA-gene regulatory network

Note about Netwrok:
This is a network diagram with miRNA (purple circle) as the center.
We used three tools(PITA, miRanda, targetScan) to predict the binding sites of circrna (green circle) and miRNA. Accordingly, for this miRNA that binds to circrna, we have three confidence levels, namely confident 1, confident 2 and confident 3. Confidence value indicates how many tools can deduce these results. For each confidence, we use different kinds of dashed lines.

Target circRNA with confidence

Confidence 3 (3 of 3 tools predicted)

CircID miRNA PITA miRanda targetScan

Confidence 2 (2 of 3 tools predicted)

CircID miRNA PITA miRanda targetScan
chr1:119914288|119914474 hsa-miR-3529-3p 1 1 0
chr11:115209574|115209657 hsa-miR-3529-3p 1 1 0

Confidence 1 (1 of 3 tools predicted)

CircID miRNA PITA miRanda targetScan
chr3:129436443|129436538 hsa-miR-3529-3p 0 1 0
chr13:37017245|37019360 hsa-miR-3529-3p 0 1 0
chr7:40065977|40066110 hsa-miR-3529-3p 0 1 0
chr19:45687586|45687681 hsa-miR-3529-3p 0 1 0
chr1:119914411|119914518 hsa-miR-3529-3p 0 1 0
chr7:5527456|5527594 hsa-miR-3529-3p 0 1 0
chr6:21596164|21596337 hsa-miR-3529-3p 0 1 0
chr10:72275465|72275671 hsa-miR-3529-3p 0 1 0
chr20:9529873|9530058 hsa-miR-3529-3p 0 1 0
chr12:91151654|91153114 hsa-miR-3529-3p 0 1 0
chr2:231795208|231795481 hsa-miR-3529-3p 0 1 0
chr12:91151654|91153137 hsa-miR-3529-3p 0 1 0
chr1:114424738|114425539 hsa-miR-3529-3p 0 1 0
chr16:634516|634644 hsa-miR-3529-3p 0 1 0
chr11:61303910|61304035 hsa-miR-3529-3p 0 1 0
chr7:139420785|139420869 hsa-miR-3529-3p 0 1 0
chr2:157737357|157737540 hsa-miR-3529-3p 0 1 0
chr15:61922489~61922589 hsa-miR-3529-3p 0 1 0
chr19:39469267|39469398 hsa-miR-3529-3p 0 1 0
chr13:37012276~37017357 hsa-miR-3529-3p 0 1 0
chr16:634516~634644 hsa-miR-3529-3p 0 1 0
chr19:45687586~45687672 hsa-miR-3529-3p 0 1 0
chr19:48603800|48603917 hsa-miR-3529-3p 0 1 0
chr19:45687586~45687681 hsa-miR-3529-3p 0 1 0
chr18:23296286~23296419 hsa-miR-3529-3p 0 1 0
chr6:139179707~139179906 hsa-miR-3529-3p 0 1 0
chr10:72275504~72275703 hsa-miR-3529-3p 0 1 0
chr7:74229160|74229276 hsa-miR-3529-3p 1 0 0
chr5:135338890|135339036 hsa-miR-3529-3p 0 1 0
chr11:47618851|47618993 hsa-miR-3529-3p 0 1 0
chr16:70123351|70123486 hsa-miR-3529-3p 0 1 0
chr5:137752690|137752785 hsa-miR-3529-3p 0 1 0
chr19:3954839|3954985 hsa-miR-3529-3p 0 1 0
chr16:74580751|74580857 hsa-miR-3529-3p 0 1 0
chr17:50356801|50356927 hsa-miR-3529-3p 0 1 0
chr19:48190994|48191183 hsa-miR-3529-3p 0 1 0
chr13:95695066|95695260 hsa-miR-3529-3p 0 1 0
chr17:17326027|17326144 hsa-miR-3529-3p 0 1 0
chr11:123519335|123519499 hsa-miR-3529-3p 0 1 0
chrX:48989972|48990966 hsa-miR-3529-3p 0 1 0
chr17:2842975|2843176 hsa-miR-3529-3p 0 1 0
chr1:153957253|153957423 hsa-miR-3529-3p 0 1 0
chr3:16317061|16317185 hsa-miR-3529-3p 1 0 0
chr13:111303911|111304092 hsa-miR-3529-3p 0 1 0
chr1:51287770|51287945 hsa-miR-3529-3p 0 1 0
chr1:168201397|168201579 hsa-miR-3529-3p 0 1 0
chr12:91151654|91151771 hsa-miR-3529-3p 0 1 0
chr10:128013767|128013912 hsa-miR-3529-3p 0 1 0
chr20:49114662|49114771 hsa-miR-3529-3p 0 1 0
chr17:42125839|42125970 hsa-miR-3529-3p 0 1 0
chr6:3304762|3304924 hsa-miR-3529-3p 0 1 0
chr2:190960679|190960851 hsa-miR-3529-3p 0 1 0
chr16:67082309|67098755 hsa-miR-3529-3p 0 1 0
chr14:75863768|75863862 hsa-miR-3529-3p 0 1 0
chr2:23823258|23823569 hsa-miR-3529-3p 0 1 0
chr19:54311457|54311716 hsa-miR-3529-3p 0 1 0
chr8:23261339|23261519 hsa-miR-3529-3p 0 1 0
chr14:75863749|75863845 hsa-miR-3529-3p 0 1 0
chr11:65352525|65352686 hsa-miR-3529-3p 0 1 0
chr12:91151654|91151792 hsa-miR-3529-3p 0 1 0
chr20:23639864|23640043 hsa-miR-3529-3p 0 1 0
chr13:111303890|111304062 hsa-miR-3529-3p -14 1 0
chr14:52004215|52004527 hsa-miR-3529-3p 0 1 0
chr20:49114573|49114723 hsa-miR-3529-3p 0 1 0
chr19:12948774|12949159 hsa-miR-3529-3p 0 1 0
chr8:23261354|23261586 hsa-miR-3529-3p 0 1 0
chr1:18907808|18907967 hsa-miR-3529-3p 0 1 0
chr11:65629520|65629671 hsa-miR-3529-3p 0 1 0
chr2:62206003|62206134 hsa-miR-3529-3p 0 1 0
chr1:207767661|207767823 hsa-miR-3529-3p 0 1 0
chr16:67082309|67098749 hsa-miR-3529-3p 0 1 0
chrX:48989972|48991075 hsa-miR-3529-3p 0 1 0
chr13:27962245|27962371 hsa-miR-3529-3p 0 1 0
chr12:89589486|89589564 hsa-miR-3529-3p 0 1 0
chr8:23261388|23261586 hsa-miR-3529-3p 0 1 0
chr5:6756145|6756382 hsa-miR-3529-3p 0 1 0
chr17:48927942|48928221 hsa-miR-3529-3p 0 1 0
chr12:91151664|91151792 hsa-miR-3529-3p 0 1 0
chr6:35022884|35023007 hsa-miR-3529-3p 0 1 0
chr1:43360540|43360826 hsa-miR-3529-3p 0 1 0
chr4:24537588|24537790 hsa-miR-3529-3p 0 1 0
chr3:37053527|37053684 hsa-miR-3529-3p 0 1 0
chr19:18867217|18867400 hsa-miR-3529-3p 0 1 0
chr6:13620258|13620438 hsa-miR-3529-3p 0 1 0
chr9:134142363|134142712 hsa-miR-3529-3p 0 1 0
chr11:130196585|130196694 hsa-miR-3529-3p 0 1 0
chr9:34338713|34338814 hsa-miR-3529-3p 0 1 0
chr7:143292401|143292663 hsa-miR-3529-3p 1 0 0
Target genes
miRNA Gene Gene Description HGNC ID details
hsa-miR-3529-3p TMPRSS4 transmembrane serine protease 4 HGNC:11878 details
hsa-miR-3529-3p ZSWIM1 zinc finger SWIM-type containing 1 HGNC:16155 details
hsa-miR-3529-3p TM4SF1 transmembrane 4 L six family member 1 HGNC:11853 details
hsa-miR-3529-3p SPATA13 spermatogenesis associated 13 HGNC:23222 details
hsa-miR-3529-3p RAB14 RAB14, member RAS oncogene family HGNC:16524 details
hsa-miR-3529-3p POU2F1 POU class 2 homeobox 1 HGNC:9212 details
hsa-miR-3529-3p NOLC1 nucleolar and coiled-body phosphoprotein 1 HGNC:15608 details
hsa-miR-3529-3p MDM4 MDM4 regulator of p53 HGNC:6974 details
hsa-miR-3529-3p FYTTD1 forty-two-three domain containing 1 HGNC:25407 details
hsa-miR-3529-3p ACTB actin beta HGNC:132 details
hsa-miR-3529-3p KRTAP4-9 keratin associated protein 4-9 HGNC:18910 details
hsa-miR-3529-3p ZNF169 zinc finger protein 169 HGNC:12957 details
hsa-miR-3529-3p PBX2P1 PBX homeobox 2 pseudogene 1 HGNC:8635 details
hsa-miR-3529-3p THBS1 thrombospondin 1 HGNC:11785 details
hsa-miR-3529-3p SYPL1 synaptophysin like 1 HGNC:11507 details
hsa-miR-3529-3p C1orf147 chromosome 1 open reading frame 147 HGNC:32061 details
hsa-miR-3529-3p TUSC1 tumor suppressor candidate 1 HGNC:31010 details
hsa-miR-3529-3p SPATA2 spermatogenesis associated 2 HGNC:14681 details
hsa-miR-3529-3p RSBN1 round spermatid basic protein 1 HGNC:25642 details
hsa-miR-3529-3p HMGA2 high mobility group AT-hook 2 HGNC:5009 details
hsa-miR-3529-3p CLEC4E C-type lectin domain family 4 member E HGNC:14555 details
hsa-miR-3529-3p YTHDF1 YTH N6-methyladenosine RNA binding protein 1 HGNC:15867 details
hsa-miR-3529-3p NCAM2 neural cell adhesion molecule 2 HGNC:7657 details
hsa-miR-3529-3p SIGLEC14 sialic acid binding Ig like lectin 14 HGNC:32926 details
hsa-miR-3529-3p TNFRSF10D TNF receptor superfamily member 10d HGNC:11907 details
hsa-miR-3529-3p DUSP4 dual specificity phosphatase 4 HGNC:3070 details
hsa-miR-3529-3p HOXA13 homeobox A13 HGNC:5102 details
hsa-miR-3529-3p WASF3 WASP family member 3 HGNC:12734 details
hsa-miR-3529-3p UBE2D4 ubiquitin conjugating enzyme E2 D4 (putative) HGNC:21647 details
hsa-miR-3529-3p SOWAHC sosondowah ankyrin repeat domain family member C HGNC:26149 details
hsa-miR-3529-3p SAR1B secretion associated Ras related GTPase 1B HGNC:10535 details
hsa-miR-3529-3p FGF2 fibroblast growth factor 2 HGNC:3676 details
hsa-miR-3529-3p FAM169A family with sequence similarity 169 member A HGNC:29138 details
hsa-miR-3529-3p DNAJB6 DnaJ heat shock protein family (Hsp40) member B6 HGNC:14888 details
hsa-miR-3529-3p ANTXR2 ANTXR cell adhesion molecule 2 HGNC:21732 details
hsa-miR-3529-3p GFPT1 glutamine--fructose-6-phosphate transaminase 1 HGNC:4241 details
hsa-miR-3529-3p FCF1 FCF1 rRNA-processing protein HGNC:20220 details
hsa-miR-3529-3p MPRIP myosin phosphatase Rho interacting protein HGNC:30321 details
hsa-miR-3529-3p CRKL CRK like proto-oncogene, adaptor protein HGNC:2363 details
hsa-miR-3529-3p GAB2 GRB2 associated binding protein 2 HGNC:14458 details
hsa-miR-3529-3p SLC35D1 solute carrier family 35 member D1 HGNC:20800 details
hsa-miR-3529-3p RAB39B RAB39B, member RAS oncogene family HGNC:16499 details
hsa-miR-3529-3p LRRC8B leucine rich repeat containing 8 VRAC subunit B HGNC:30692 details
hsa-miR-3529-3p CRAMP1 cramped chromatin regulator homolog 1 HGNC:14122 details
hsa-miR-3529-3p FZD6 frizzled class receptor 6 HGNC:4044 details
hsa-miR-3529-3p DDIT4 DNA damage inducible transcript 4 HGNC:24944 details
hsa-miR-3529-3p CMIP c-Maf inducing protein HGNC:24319 details
hsa-miR-3529-3p ITGB1 integrin subunit beta 1 HGNC:6153 details
hsa-miR-3529-3p GATAD2A GATA zinc finger domain containing 2A HGNC:29989 details
hsa-miR-3529-3p ZDHHC7 zinc finger DHHC-type palmitoyltransferase 7 HGNC:18459 details
hsa-miR-3529-3p WEE1 WEE1 G2 checkpoint kinase HGNC:12761 details
hsa-miR-3529-3p SOX4 SRY-box transcription factor 4 HGNC:11200 details
hsa-miR-3529-3p SON SON DNA and RNA binding protein HGNC:11183 details
hsa-miR-3529-3p HNRNPA2B1 heterogeneous nuclear ribonucleoprotein A2/B1 HGNC:5033 details
hsa-miR-3529-3p SMAD3 SMAD family member 3 HGNC:6769 details
hsa-miR-3529-3p SOX5 SRY-box transcription factor 5 HGNC:11201 details
hsa-miR-3529-3p MTX3 metaxin 3 HGNC:24812 details
hsa-miR-3529-3p TFAP2A transcription factor AP-2 alpha HGNC:11742 details
hsa-miR-3529-3p TGFBR3 transforming growth factor beta receptor 3 HGNC:11774 details
hsa-miR-3529-3p SEMA6D semaphorin 6D HGNC:16770 details
hsa-miR-3529-3p TCEAL4 transcription elongation factor A like 4 HGNC:26121 details
hsa-miR-3529-3p HOOK3 hook microtubule tethering protein 3 HGNC:23576 details
hsa-miR-3529-3p TP53 tumor protein p53 HGNC:11998 details
hsa-miR-3529-3p TNFRSF21 TNF receptor superfamily member 21 HGNC:13469 details
hsa-miR-3529-3p HERC5 HECT and RLD domain containing E3 ubiquitin protein ligase 5 HGNC:24368 details
hsa-miR-3529-3p CXCL5 C-X-C motif chemokine ligand 5 HGNC:10642 details
hsa-miR-3529-3p CDC14B cell division cycle 14B HGNC:1719 details
hsa-miR-3529-3p IBA57 iron-sulfur cluster assembly factor IBA57 HGNC:27302 details
hsa-miR-3529-3p PTP4A2 protein tyrosine phosphatase 4A2 HGNC:9635 details
hsa-miR-3529-3p TTC26 tetratricopeptide repeat domain 26 HGNC:21882 details
hsa-miR-3529-3p GORASP1 golgi reassembly stacking protein 1 HGNC:16769 details
hsa-miR-3529-3p ZNF736 zinc finger protein 736 HGNC:32467 details
hsa-miR-3529-3p STEAP4 STEAP4 metalloreductase HGNC:21923 details
hsa-miR-3529-3p NINJ1 ninjurin 1 HGNC:7824 details
hsa-miR-3529-3p HIPK1 homeodomain interacting protein kinase 1 HGNC:19006 details
hsa-miR-3529-3p INTS7 integrator complex subunit 7 HGNC:24484 details
hsa-miR-3529-3p ATP7A ATPase copper transporting alpha HGNC:869 details
hsa-miR-3529-3p GABRA4 gamma-aminobutyric acid type A receptor subunit alpha4 HGNC:4078 details
hsa-miR-3529-3p DIP2C disco interacting protein 2 homolog C HGNC:29150 details
hsa-miR-3529-3p SLC22A17 solute carrier family 22 member 17 HGNC:23095 details
hsa-miR-3529-3p SIK1 salt inducible kinase 1 HGNC:11142 details
hsa-miR-3529-3p CSE1L chromosome segregation 1 like HGNC:2431 details
hsa-miR-3529-3p IDE insulin degrading enzyme HGNC:5381 details
hsa-miR-3529-3p POLR3F RNA polymerase III subunit F HGNC:15763 details
hsa-miR-3529-3p STX12 syntaxin 12 HGNC:11430 details
hsa-miR-3529-3p SPAG9 sperm associated antigen 9 HGNC:14524 details
hsa-miR-3529-3p GNG12 G protein subunit gamma 12 HGNC:19663 details
hsa-miR-3529-3p MKLN1 muskelin 1 HGNC:7109 details
hsa-miR-3529-3p TARDBP TAR DNA binding protein HGNC:11571 details
hsa-miR-3529-3p KBTBD6 kelch repeat and BTB domain containing 6 HGNC:25340 details
hsa-miR-3529-3p RPF2 ribosome production factor 2 homolog HGNC:20870 details
hsa-miR-3529-3p U2SURP U2 snRNP associated SURP domain containing HGNC:30855 details
hsa-miR-3529-3p KCNK5 potassium two pore domain channel subfamily K member 5 HGNC:6280 details
hsa-miR-3529-3p SYDE2 synapse defective Rho GTPase homolog 2 HGNC:25841 details
hsa-miR-3529-3p PDP2 pyruvate dehyrogenase phosphatase catalytic subunit 2 HGNC:30263 details
hsa-miR-3529-3p FBXO31 F-box protein 31 HGNC:16510 details
hsa-miR-3529-3p HSPA4L heat shock protein family A (Hsp70) member 4 like HGNC:17041 details
hsa-miR-3529-3p TPCN2 two pore segment channel 2 HGNC:20820 details
hsa-miR-3529-3p GOLPH3 golgi phosphoprotein 3 HGNC:15452 details
hsa-miR-3529-3p NDUFAF7 NADH:ubiquinone oxidoreductase complex assembly factor 7 HGNC:28816 details
hsa-miR-3529-3p FBXW7 F-box and WD repeat domain containing 7 HGNC:16712 details
hsa-miR-3529-3p GMEB2 glucocorticoid modulatory element binding protein 2 HGNC:4371 details
hsa-miR-3529-3p NPM1 nucleophosmin 1 HGNC:7910 details
hsa-miR-3529-3p U2AF2 U2 small nuclear RNA auxiliary factor 2 HGNC:23156 details
hsa-miR-3529-3p ARL6IP1 ADP ribosylation factor like GTPase 6 interacting protein 1 HGNC:697 details
hsa-miR-3529-3p FREM1 FRAS1 related extracellular matrix 1 HGNC:23399 details
hsa-miR-3529-3p ZNF614 zinc finger protein 614 HGNC:24722 details
hsa-miR-3529-3p AAK1 AP2 associated kinase 1 HGNC:19679 details
hsa-miR-3529-3p FIGN fidgetin, microtubule severing factor HGNC:13285 details
hsa-miR-3529-3p GNPTAB N-acetylglucosamine-1-phosphate transferase subunits alpha and beta HGNC:29670 details
hsa-miR-3529-3p LZTFL1 leucine zipper transcription factor like 1 HGNC:6741 details
hsa-miR-3529-3p MTMR9 myotubularin related protein 9 HGNC:14596 details
hsa-miR-3529-3p ST6GAL2 ST6 beta-galactoside alpha-2,6-sialyltransferase 2 HGNC:10861 details
hsa-miR-3529-3p details
hsa-miR-3529-3p ZNF607 zinc finger protein 607 HGNC:28192 details
hsa-miR-3529-3p ZNF678 zinc finger protein 678 HGNC:28652 details
hsa-miR-3529-3p ZNF774 zinc finger protein 774 HGNC:33108 details
© 2021 Arieh Warshel Institute of Computational Biology, CUHK(SZ) | Designed by : Biomics Lab