miRNA Card

miRNA General Information
miRNA ID hsa-miR-3606-3p
Description Homo sapiens miR-3606 stem-loop
Comment None
Experiment
Sequence AAAAUUUCUUUCACUACUUAG
miRNA Expression in different cancers

    by mir_boxplot.py

circRNA-miRNA-gene regulatory network

Note about Netwrok:
This is a network diagram with miRNA (purple circle) as the center.
We used three tools(PITA, miRanda, targetScan) to predict the binding sites of circrna (green circle) and miRNA. Accordingly, for this miRNA that binds to circrna, we have three confidence levels, namely confident 1, confident 2 and confident 3. Confidence value indicates how many tools can deduce these results. For each confidence, we use different kinds of dashed lines.

Target circRNA with confidence

Confidence 3 (3 of 3 tools predicted)

CircID miRNA PITA miRanda targetScan

Confidence 2 (2 of 3 tools predicted)

CircID miRNA PITA miRanda targetScan
Target genes
miRNA Gene Gene Description HGNC ID details
hsa-miR-3606-3p ZNF75A zinc finger protein 75a HGNC:13146 details
hsa-miR-3606-3p CHD8 chromodomain helicase DNA binding protein 8 HGNC:20153 details
hsa-miR-3606-3p XPR1 xenotropic and polytropic retrovirus receptor 1 HGNC:12827 details
hsa-miR-3606-3p AVPR1A arginine vasopressin receptor 1A HGNC:895 details
hsa-miR-3606-3p TRPS1 transcriptional repressor GATA binding 1 HGNC:12340 details
hsa-miR-3606-3p LOH12CR2 loss of heterozygosity on chromosome 12, region 2 HGNC:26524 details
hsa-miR-3606-3p ZNF37A zinc finger protein 37A HGNC:13102 details
hsa-miR-3606-3p GOLGA8B golgin A8 family member B HGNC:31973 details
hsa-miR-3606-3p FIBIN fin bud initiation factor homolog HGNC:33747 details
hsa-miR-3606-3p KCNAB1 potassium voltage-gated channel subfamily A regulatory beta subunit 1 HGNC:6228 details
hsa-miR-3606-3p ZNF704 zinc finger protein 704 HGNC:32291 details
hsa-miR-3606-3p TP53INP1 tumor protein p53 inducible nuclear protein 1 HGNC:18022 details
hsa-miR-3606-3p PLCG1 phospholipase C gamma 1 HGNC:9065 details
hsa-miR-3606-3p GOLGA8A golgin A8 family member A HGNC:31972 details
hsa-miR-3606-3p ZNF555 zinc finger protein 555 HGNC:28382 details
hsa-miR-3606-3p EHD3 EH domain containing 3 HGNC:3244 details
hsa-miR-3606-3p LHFPL3 LHFPL tetraspan subfamily member 3 HGNC:6589 details
hsa-miR-3606-3p ZNF654 zinc finger protein 654 HGNC:25612 details
hsa-miR-3606-3p SGIP1 SH3GL interacting endocytic adaptor 1 HGNC:25412 details
hsa-miR-3606-3p SUMO1 small ubiquitin like modifier 1 HGNC:12502 details
hsa-miR-3606-3p RREB1 ras responsive element binding protein 1 HGNC:10449 details
hsa-miR-3606-3p NUFIP2 nuclear FMR1 interacting protein 2 HGNC:17634 details
hsa-miR-3606-3p KANSL1 KAT8 regulatory NSL complex subunit 1 HGNC:24565 details
hsa-miR-3606-3p CDK6 cyclin dependent kinase 6 HGNC:1777 details
hsa-miR-3606-3p ALG9 ALG9 alpha-1,2-mannosyltransferase HGNC:15672 details
hsa-miR-3606-3p DICER1 dicer 1, ribonuclease III HGNC:17098 details
hsa-miR-3606-3p GLUD1 glutamate dehydrogenase 1 HGNC:4335 details
hsa-miR-3606-3p TMEM245 transmembrane protein 245 HGNC:1363 details
hsa-miR-3606-3p EDN3 endothelin 3 HGNC:3178 details
hsa-miR-3606-3p CREB1 cAMP responsive element binding protein 1 HGNC:2345 details
hsa-miR-3606-3p YWHAZ tyrosine 3-monooxygenase/tryptophan 5-monooxygenase activation protein zeta HGNC:12855 details
hsa-miR-3606-3p NHLRC3 NHL repeat containing 3 HGNC:33751 details
hsa-miR-3606-3p CREBZF CREB/ATF bZIP transcription factor HGNC:24905 details
hsa-miR-3606-3p GSK3B glycogen synthase kinase 3 beta HGNC:4617 details
hsa-miR-3606-3p YWHAB tyrosine 3-monooxygenase/tryptophan 5-monooxygenase activation protein beta HGNC:12849 details
hsa-miR-3606-3p ZXDA zinc finger X-linked duplicated A HGNC:13198 details
hsa-miR-3606-3p TPPP tubulin polymerization promoting protein HGNC:24164 details
hsa-miR-3606-3p SLC8A1 solute carrier family 8 member A1 HGNC:11068 details
hsa-miR-3606-3p NIPA1 NIPA magnesium transporter 1 HGNC:17043 details
hsa-miR-3606-3p CD164 CD164 molecule HGNC:1632 details
hsa-miR-3606-3p ZNF333 zinc finger protein 333 HGNC:15624 details
hsa-miR-3606-3p FTH1 ferritin heavy chain 1 HGNC:3976 details
hsa-miR-3606-3p POU2F2 POU class 2 homeobox 2 HGNC:9213 details
hsa-miR-3606-3p details
hsa-miR-3606-3p FZD9 frizzled class receptor 9 HGNC:4047 details
hsa-miR-3606-3p CDCA7 cell division cycle associated 7 HGNC:14628 details
hsa-miR-3606-3p ATP6V0E2 ATPase H+ transporting V0 subunit e2 HGNC:21723 details
hsa-miR-3606-3p TRIM4 tripartite motif containing 4 HGNC:16275 details
hsa-miR-3606-3p ENPP6 ectonucleotide pyrophosphatase/phosphodiesterase 6 HGNC:23409 details
hsa-miR-3606-3p PLA2G4D phospholipase A2 group IVD HGNC:30038 details
hsa-miR-3606-3p USP46 ubiquitin specific peptidase 46 HGNC:20075 details
hsa-miR-3606-3p TNPO1 transportin 1 HGNC:6401 details
hsa-miR-3606-3p PSD3 pleckstrin and Sec7 domain containing 3 HGNC:19093 details
hsa-miR-3606-3p PIGA phosphatidylinositol glycan anchor biosynthesis class A HGNC:8957 details
hsa-miR-3606-3p NUP37 nucleoporin 37 HGNC:29929 details
hsa-miR-3606-3p MBOAT2 membrane bound O-acyltransferase domain containing 2 HGNC:25193 details
hsa-miR-3606-3p JMJD1C jumonji domain containing 1C HGNC:12313 details
hsa-miR-3606-3p IPO7 importin 7 HGNC:9852 details
hsa-miR-3606-3p FJX1 four-jointed box kinase 1 HGNC:17166 details
hsa-miR-3606-3p FAM104A family with sequence similarity 104 member A HGNC:25918 details
hsa-miR-3606-3p ETNK1 ethanolamine kinase 1 HGNC:24649 details
hsa-miR-3606-3p C3orf52 chromosome 3 open reading frame 52 HGNC:26255 details
hsa-miR-3606-3p C16orf87 chromosome 16 open reading frame 87 HGNC:33754 details
hsa-miR-3606-3p BTG1 BTG anti-proliferation factor 1 HGNC:1130 details
hsa-miR-3606-3p AFF4 AF4/FMR2 family member 4 HGNC:17869 details
hsa-miR-3606-3p UTP14C UTP14C small subunit processome component HGNC:20321 details
hsa-miR-3606-3p ZNF529 zinc finger protein 529 HGNC:29328 details
hsa-miR-3606-3p NAP1L1 nucleosome assembly protein 1 like 1 HGNC:7637 details
hsa-miR-3606-3p ZCCHC9 zinc finger CCHC-type containing 9 HGNC:25424 details
hsa-miR-3606-3p UHRF1BP1 UHRF1 binding protein 1 HGNC:21216 details
hsa-miR-3606-3p ZNF264 zinc finger protein 264 HGNC:13057 details
hsa-miR-3606-3p TNFRSF21 TNF receptor superfamily member 21 HGNC:13469 details
hsa-miR-3606-3p SAR1A secretion associated Ras related GTPase 1A HGNC:10534 details
hsa-miR-3606-3p PEG10 paternally expressed 10 HGNC:14005 details
hsa-miR-3606-3p MOB1A MOB kinase activator 1A HGNC:16015 details
hsa-miR-3606-3p KLHDC10 kelch domain containing 10 HGNC:22194 details
hsa-miR-3606-3p HSPA13 heat shock protein family A (Hsp70) member 13 HGNC:11375 details
hsa-miR-3606-3p FKBP1A FKBP prolyl isomerase 1A HGNC:3711 details
hsa-miR-3606-3p DCUN1D3 defective in cullin neddylation 1 domain containing 3 HGNC:28734 details
hsa-miR-3606-3p CNOT6L CCR4-NOT transcription complex subunit 6 like HGNC:18042 details
hsa-miR-3606-3p ZNF598 zinc finger protein 598, E3 ubiquitin ligase HGNC:28079 details
hsa-miR-3606-3p ZFP30 ZFP30 zinc finger protein HGNC:29555 details
hsa-miR-3606-3p TWF1 twinfilin actin binding protein 1 HGNC:9620 details
hsa-miR-3606-3p RNF6 ring finger protein 6 HGNC:10069 details
hsa-miR-3606-3p RC3H1 ring finger and CCCH-type domains 1 HGNC:29434 details
hsa-miR-3606-3p PRKACB protein kinase cAMP-activated catalytic subunit beta HGNC:9381 details
hsa-miR-3606-3p CHIC1 cysteine rich hydrophobic domain 1 HGNC:1934 details
hsa-miR-3606-3p BTN3A3 butyrophilin subfamily 3 member A3 HGNC:1140 details
hsa-miR-3606-3p NOM1 nucleolar protein with MIF4G domain 1 HGNC:13244 details
hsa-miR-3606-3p EIF4A3 eukaryotic translation initiation factor 4A3 HGNC:18683 details
hsa-miR-3606-3p ATP2B1 ATPase plasma membrane Ca2+ transporting 1 HGNC:814 details
hsa-miR-3606-3p KRAS KRAS proto-oncogene, GTPase HGNC:6407 details
hsa-miR-3606-3p NACA2 nascent polypeptide associated complex subunit alpha 2 HGNC:23290 details
hsa-miR-3606-3p FLVCR1 FLVCR heme transporter 1 HGNC:24682 details
hsa-miR-3606-3p FMN1 formin 1 HGNC:3768 details
hsa-miR-3606-3p DUSP3 dual specificity phosphatase 3 HGNC:3069 details
hsa-miR-3606-3p ZRANB1 zinc finger RANBP2-type containing 1 HGNC:18224 details
hsa-miR-3606-3p ZNF644 zinc finger protein 644 HGNC:29222 details
hsa-miR-3606-3p ZNF207 zinc finger protein 207 HGNC:12998 details
hsa-miR-3606-3p TFDP1 transcription factor Dp-1 HGNC:11749 details
hsa-miR-3606-3p SIX1 SIX homeobox 1 HGNC:10887 details
hsa-miR-3606-3p MBNL1 muscleblind like splicing regulator 1 HGNC:6923 details
hsa-miR-3606-3p LIMS1 LIM zinc finger domain containing 1 HGNC:6616 details
hsa-miR-3606-3p details
hsa-miR-3606-3p CPEB3 cytoplasmic polyadenylation element binding protein 3 HGNC:21746 details
hsa-miR-3606-3p BACH1 BTB domain and CNC homolog 1 HGNC:935 details
hsa-miR-3606-3p SF1 splicing factor 1 HGNC:12950 details
hsa-miR-3606-3p ATP8B4 ATPase phospholipid transporting 8B4 (putative) HGNC:13536 details
hsa-miR-3606-3p NACA nascent polypeptide associated complex subunit alpha HGNC:7629 details
hsa-miR-3606-3p DYNC1LI1 dynein cytoplasmic 1 light intermediate chain 1 HGNC:18745 details
hsa-miR-3606-3p REEP5 receptor accessory protein 5 HGNC:30077 details
hsa-miR-3606-3p ITIH5 inter-alpha-trypsin inhibitor heavy chain 5 HGNC:21449 details
hsa-miR-3606-3p ZNF486 zinc finger protein 486 HGNC:20807 details
hsa-miR-3606-3p HS3ST5 heparan sulfate-glucosamine 3-sulfotransferase 5 HGNC:19419 details
hsa-miR-3606-3p TCF7L2 transcription factor 7 like 2 HGNC:11641 details
hsa-miR-3606-3p C1orf56 chromosome 1 open reading frame 56 HGNC:26045 details
hsa-miR-3606-3p NDUFS1 NADH:ubiquinone oxidoreductase core subunit S1 HGNC:7707 details
hsa-miR-3606-3p details
hsa-miR-3606-3p PRDM10 PR/SET domain 10 HGNC:13995 details
hsa-miR-3606-3p PIP4P2 phosphatidylinositol-4,5-bisphosphate 4-phosphatase 2 HGNC:25452 details
hsa-miR-3606-3p OTUD7B OTU deubiquitinase 7B HGNC:16683 details
hsa-miR-3606-3p CADM2 cell adhesion molecule 2 HGNC:29849 details
hsa-miR-3606-3p TNNC1 troponin C1, slow skeletal and cardiac type HGNC:11943 details
hsa-miR-3606-3p ZNF562 zinc finger protein 562 HGNC:25950 details
hsa-miR-3606-3p HOXD12 homeobox D12 HGNC:5135 details
hsa-miR-3606-3p PUS3 pseudouridine synthase 3 HGNC:25461 details
hsa-miR-3606-3p details
hsa-miR-3606-3p FYB1 FYN binding protein 1 HGNC:4036 details
hsa-miR-3606-3p ATXN7L1 ataxin 7 like 1 HGNC:22210 details
hsa-miR-3606-3p PTPRB protein tyrosine phosphatase receptor type B HGNC:9665 details
hsa-miR-3606-3p STC2 stanniocalcin 2 HGNC:11374 details
hsa-miR-3606-3p GTDC1 glycosyltransferase like domain containing 1 HGNC:20887 details
hsa-miR-3606-3p SNTG1 syntrophin gamma 1 HGNC:13740 details
hsa-miR-3606-3p SPOP speckle type BTB/POZ protein HGNC:11254 details
hsa-miR-3606-3p IFNB1 interferon beta 1 HGNC:5434 details
hsa-miR-3606-3p CEP68 centrosomal protein 68 HGNC:29076 details
hsa-miR-3606-3p ZNF582 zinc finger protein 582 HGNC:26421 details
hsa-miR-3606-3p ASCL1 achaete-scute family bHLH transcription factor 1 HGNC:738 details
hsa-miR-3606-3p NEDD1 NEDD1 gamma-tubulin ring complex targeting factor HGNC:7723 details
hsa-miR-3606-3p SC5D sterol-C5-desaturase HGNC:10547 details
hsa-miR-3606-3p GALC galactosylceramidase HGNC:4115 details
hsa-miR-3606-3p CACNG6 calcium voltage-gated channel auxiliary subunit gamma 6 HGNC:13625 details
hsa-miR-3606-3p ZMAT4 zinc finger matrin-type 4 HGNC:25844 details
hsa-miR-3606-3p VASP vasodilator stimulated phosphoprotein HGNC:12652 details
hsa-miR-3606-3p UBN2 ubinuclein 2 HGNC:21931 details
hsa-miR-3606-3p TMEM107 transmembrane protein 107 HGNC:28128 details
hsa-miR-3606-3p SRPK2 SRSF protein kinase 2 HGNC:11306 details
hsa-miR-3606-3p RORB RAR related orphan receptor B HGNC:10259 details
hsa-miR-3606-3p RASAL2 RAS protein activator like 2 HGNC:9874 details
hsa-miR-3606-3p NGDN neuroguidin HGNC:20271 details
hsa-miR-3606-3p KIF5A kinesin family member 5A HGNC:6323 details
hsa-miR-3606-3p HHIP hedgehog interacting protein HGNC:14866 details
hsa-miR-3606-3p HDAC4 histone deacetylase 4 HGNC:14063 details
hsa-miR-3606-3p DTX3L deltex E3 ubiquitin ligase 3L HGNC:30323 details
hsa-miR-3606-3p CCDC71L coiled-coil domain containing 71 like HGNC:26685 details
hsa-miR-3606-3p ABHD10 abhydrolase domain containing 10, depalmitoylase HGNC:25656 details
hsa-miR-3606-3p NXPE1 neurexophilin and PC-esterase domain family member 1 HGNC:28527 details
hsa-miR-3606-3p TFDP2 transcription factor Dp-2 HGNC:11751 details
hsa-miR-3606-3p VN1R1 vomeronasal 1 receptor 1 HGNC:13548 details
hsa-miR-3606-3p ZBTB37 zinc finger and BTB domain containing 37 HGNC:28365 details
hsa-miR-3606-3p MAP3K2 mitogen-activated protein kinase kinase kinase 2 HGNC:6854 details
hsa-miR-3606-3p CREG2 cellular repressor of E1A stimulated genes 2 HGNC:14272 details
hsa-miR-3606-3p C4orf36 chromosome 4 open reading frame 36 HGNC:28386 details
hsa-miR-3606-3p ZNF451 zinc finger protein 451 HGNC:21091 details
hsa-miR-3606-3p SNX4 sorting nexin 4 HGNC:11175 details
hsa-miR-3606-3p NEGR1 neuronal growth regulator 1 HGNC:17302 details
hsa-miR-3606-3p MYO1B myosin IB HGNC:7596 details
hsa-miR-3606-3p MCFD2 multiple coagulation factor deficiency 2, ER cargo receptor complex subunit HGNC:18451 details
hsa-miR-3606-3p LMNB1 lamin B1 HGNC:6637 details
hsa-miR-3606-3p ZBTB7A zinc finger and BTB domain containing 7A HGNC:18078 details
hsa-miR-3606-3p TRDN triadin HGNC:12261 details
hsa-miR-3606-3p SLC2A11 solute carrier family 2 member 11 HGNC:14239 details
hsa-miR-3606-3p SRSF12 serine and arginine rich splicing factor 12 HGNC:21220 details
hsa-miR-3606-3p PDLIM5 PDZ and LIM domain 5 HGNC:17468 details
hsa-miR-3606-3p WDR33 WD repeat domain 33 HGNC:25651 details
hsa-miR-3606-3p DYRK4 dual specificity tyrosine phosphorylation regulated kinase 4 HGNC:3095 details
hsa-miR-3606-3p DCC DCC netrin 1 receptor HGNC:2701 details
hsa-miR-3606-3p SH2D1A SH2 domain containing 1A HGNC:10820 details
hsa-miR-3606-3p CLPB caseinolytic mitochondrial matrix peptidase chaperone subunit B HGNC:30664 details
hsa-miR-3606-3p HOXC11 homeobox C11 HGNC:5123 details
hsa-miR-3606-3p CCSER2 coiled-coil serine rich protein 2 HGNC:29197 details
hsa-miR-3606-3p GTF3C4 general transcription factor IIIC subunit 4 HGNC:4667 details
hsa-miR-3606-3p MAP7 microtubule associated protein 7 HGNC:6869 details
hsa-miR-3606-3p details
hsa-miR-3606-3p EIF2AK2 eukaryotic translation initiation factor 2 alpha kinase 2 HGNC:9437 details
hsa-miR-3606-3p MCM8 minichromosome maintenance 8 homologous recombination repair factor HGNC:16147 details
hsa-miR-3606-3p SETD5 SET domain containing 5 HGNC:25566 details
hsa-miR-3606-3p SLC25A37 solute carrier family 25 member 37 HGNC:29786 details
hsa-miR-3606-3p TNC tenascin C HGNC:5318 details
© 2021 Arieh Warshel Institute of Computational Biology, CUHK(SZ) | Designed by : Biomics Lab