miRNA Card

miRNA General Information
miRNA ID hsa-miR-3611
Description Homo sapiens miR-3611 stem-loop
Comment None
Experiment Illumina [1]
Sequence UUGUGAAGAAAGAAAUUCUUA
miRNA Expression in different cancers

    by mir_boxplot.py

circRNA-miRNA-gene regulatory network

Note about Netwrok:
This is a network diagram with miRNA (purple circle) as the center.
We used three tools(PITA, miRanda, targetScan) to predict the binding sites of circrna (green circle) and miRNA. Accordingly, for this miRNA that binds to circrna, we have three confidence levels, namely confident 1, confident 2 and confident 3. Confidence value indicates how many tools can deduce these results. For each confidence, we use different kinds of dashed lines.

Target circRNA with confidence

Confidence 3 (3 of 3 tools predicted)

CircID miRNA PITA miRanda targetScan

Confidence 2 (2 of 3 tools predicted)

Confidence 1 (1 of 3 tools predicted)

CircID miRNA PITA miRanda targetScan
chr16:30623740|30623945 hsa-miR-3611 0 1 0
chr1:184795413|184795521 hsa-miR-3611 0 1 0
chr14:22875178|22875532 hsa-miR-3611 0 1 0
chr5:172768327|172768439 hsa-miR-3611 0 1 0
chr1:1756258|1756608 hsa-miR-3611 0 1 0
chr16:75654312|75654391 hsa-miR-3611 0 1 0
chr5:172768350|172768439 hsa-miR-3611 0 1 0
chr1:232803703|232803996 hsa-miR-3611 0 1 0
chr1:167415720|167415845 hsa-miR-3611 0 1 0
chr12:46183507|46183592 hsa-miR-3611 0 1 0
chr12:9099381|9181132 hsa-miR-3611 0 1 0
chr10:79353747|79353985 hsa-miR-3611 0 1 0
chr11:133900923|133901048 hsa-miR-3611 0 1 0
chr12:46361188|46362381 hsa-miR-3611 0 1 0
chr16:75654309|75654391 hsa-miR-3611 0 1 0
chr19:288240|288351 hsa-miR-3611 0 1 0
chr1:52355398|52355666 hsa-miR-3611 0 1 0
chr1:184795394|184795519 hsa-miR-3611 0 1 0
chr20:38650402|38650547 hsa-miR-3611 0 1 0
chr19:288240|288361 hsa-miR-3611 0 1 0
chr12:9074740|9076799 hsa-miR-3611 0 1 0
chr16:31715316|31715436 hsa-miR-3611 0 1 0
chr10:79353745|79353894 hsa-miR-3611 0 1 0
chr10:79353720|79353894 hsa-miR-3611 0 1 0
chr11:75009193|75009347 hsa-miR-3611 0 1 0
chr8:94372858|94372973 hsa-miR-3611 0 1 0
chr14:23948074|23948193 hsa-miR-3611 0 1 0
chr2:28398807~28398957 hsa-miR-3611 0 1 0
chr12:9099381~9181132 hsa-miR-3611 0 1 0
chr1:52355398~52355666 hsa-miR-3611 0 1 0
chr1:1756503~1756608 hsa-miR-3611 0 1 0
chr5:140528924~140529066 hsa-miR-3611 0 1 0
chr16:30756633~30756855 hsa-miR-3611 0 1 0
chr2:36847436~36847548 hsa-miR-3611 0 1 0
chrX:63655546~63655692 hsa-miR-3611 0 1 0
chr7:43866894~43866977 hsa-miR-3611 0 1 0
chr12:56102442~56102535 hsa-miR-3611 0 1 0
chr8:142664736~142664864 hsa-miR-3611 0 1 0
chr17:45081644~45086652 hsa-miR-3611 0 1 0
chr5:140528960~140529066 hsa-miR-3611 0 1 0
chr12:125142559~125142761 hsa-miR-3611 0 1 0
chr5:172768327|172768408 hsa-miR-3611 0 1 0
chr3:172162488|172162655 hsa-miR-3611 0 1 0
chr5:172768327|172768591 hsa-miR-3611 0 1 0
chr7:151233736|151233907 hsa-miR-3611 0 1 0
chr3:172429137|172429243 hsa-miR-3611 0 1 0
chr8:70583164|70583701 hsa-miR-3611 0 1 0
chr5:172768327|172768435 hsa-miR-3611 0 1 0
chr19:41864900|41865066 hsa-miR-3611 0 1 0
chr11:62677927|62678096 hsa-miR-3611 1 0 0
chr12:125086342|125086439 hsa-miR-3611 1 0 0
chr12:9074740|9076875 hsa-miR-3611 0 1 0
chr19:15111313|15111686 hsa-miR-3611 0 1 0
chr20:58691511|58691793 hsa-miR-3611 0 1 0
chr11:61299594|61299695 hsa-miR-3611 0 1 0
chr22:31278592|31278790 hsa-miR-3611 0 1 0
chr1:1756258|1756568 hsa-miR-3611 0 1 0
chr22:31433925|31434040 hsa-miR-3611 0 1 0
chr6:41599365|41599539 hsa-miR-3611 0 1 0
chr3:47347707|47347871 hsa-miR-3611 0 1 0
chr17:45081644|45086652 hsa-miR-3611 0 1 0
chr12:2888217|2888330 hsa-miR-3611 0 1 0
chr16:75654287|75654391 hsa-miR-3611 0 1 0
chr12:54351466|54351668 hsa-miR-3611 0 1 0
chr4:25678372|25678512 hsa-miR-3611 0 1 0
chr15:43184816|43184896 hsa-miR-3611 0 1 0
chr22:40410927|40411047 hsa-miR-3611 0 1 0
chr7:99564171|99564383 hsa-miR-3611 0 1 0
chr22:31433872|31434164 hsa-miR-3611 0 1 0
chr4:25678372|25678472 hsa-miR-3611 0 1 0
chr22:36467149|36467327 hsa-miR-3611 0 1 0
chr7:105038126|105041023 hsa-miR-3611 0 1 0
chr18:49363161|49379758 hsa-miR-3611 0 1 0
chr8:120693692|120693908 hsa-miR-3611 0 1 0
chr10:79353747|79353894 hsa-miR-3611 0 1 0
chrX:116461063|116461218 hsa-miR-3611 0 1 0
chr19:48873826|48874006 hsa-miR-3611 0 1 0
chr11:133900833|133900987 hsa-miR-3611 0 1 0
chr2:127643527|127643661 hsa-miR-3611 0 1 0
chr22:40410764|40411062 hsa-miR-3611 0 1 0
chr2:38069527|38069674 hsa-miR-3611 0 1 0
chr3:146121112|146124229 hsa-miR-3611 0 1 0
chr15:69562622|69562844 hsa-miR-3611 0 1 0
chr12:56102442|56102535 hsa-miR-3611 0 1 0
chr10:79353707|79353920 hsa-miR-3611 -4 1 0
chr15:43184704|43184896 hsa-miR-3611 -8 1 0
chr17:73235577|73235749 hsa-miR-3611 -17 1 0
chrX:46419766|46419887 hsa-miR-3611 -8 1 0
chr19:48873799|48873951 hsa-miR-3611 0 1 0
chr16:24919867|24919996 hsa-miR-3611 0 1 0
chr12:46361180|46362513 hsa-miR-3611 0 1 0
chr11:117205051|117205317 hsa-miR-3611 0 1 0
chr2:36847436|36847548 hsa-miR-3611 0 1 0
chr19:1207109|1218437 hsa-miR-3611 0 1 0
chr14:60283087|60283271 hsa-miR-3611 0 1 0
chr22:38686668|38686774 hsa-miR-3611 0 1 0
chr15:43184813|43184896 hsa-miR-3611 0 1 0
chr14:22875141|22875511 hsa-miR-3611 0 1 0
chr10:79353745|79353936 hsa-miR-3611 0 1 0
chr18:12717561|12717772 hsa-miR-3611 0 1 0
chr1:145826536|145826709 hsa-miR-3611 0 1 0
chr1:184795413|184795519 hsa-miR-3611 0 1 0
chr12:46183507|46183607 hsa-miR-3611 0 1 0
chr11:61299576|61299698 hsa-miR-3611 0 1 0
chr12:125142559|125142763 hsa-miR-3611 0 1 0
chr3:25609183|25609331 hsa-miR-3611 0 1 0
chr11:61299594|61299704 hsa-miR-3611 0 1 0
chr6:41599365|41599459 hsa-miR-3611 0 1 0
chr16:15782385|15786653 hsa-miR-3611 0 1 0
chr5:76834014|76834265 hsa-miR-3611 0 1 0
chr2:197551899|197552125 hsa-miR-3611 0 1 0
chr15:39598374|39598539 hsa-miR-3611 0 1 0
chr7:32872986|32873291 hsa-miR-3611 1 0 0
chr11:130914853|130914969 hsa-miR-3611 1 0 0
Target genes
miRNA Gene Gene Description HGNC ID details
hsa-miR-3611 EDAR ectodysplasin A receptor HGNC:2895 details
hsa-miR-3611 CASP5 caspase 5 HGNC:1506 details
hsa-miR-3611 MTMR6 myotubularin related protein 6 HGNC:7453 details
hsa-miR-3611 GCG glucagon HGNC:4191 details
hsa-miR-3611 STOX2 storkhead box 2 HGNC:25450 details
hsa-miR-3611 CDC14B cell division cycle 14B HGNC:1719 details
hsa-miR-3611 AKR7A2 aldo-keto reductase family 7 member A2 HGNC:389 details
hsa-miR-3611 TMEM70 transmembrane protein 70 HGNC:26050 details
hsa-miR-3611 ZNF460 zinc finger protein 460 HGNC:21628 details
hsa-miR-3611 LSM1 LSM1 homolog, mRNA degradation associated HGNC:20472 details
hsa-miR-3611 WEE1 WEE1 G2 checkpoint kinase HGNC:12761 details
hsa-miR-3611 UCK2 uridine-cytidine kinase 2 HGNC:12562 details
hsa-miR-3611 TXNRD1 thioredoxin reductase 1 HGNC:12437 details
hsa-miR-3611 TOB2 transducer of ERBB2, 2 HGNC:11980 details
hsa-miR-3611 SLC7A5 solute carrier family 7 member 5 HGNC:11063 details
hsa-miR-3611 SHOC2 SHOC2 leucine rich repeat scaffold protein HGNC:15454 details
hsa-miR-3611 RNF41 ring finger protein 41 HGNC:18401 details
hsa-miR-3611 REL REL proto-oncogene, NF-kB subunit HGNC:9954 details
hsa-miR-3611 COASY Coenzyme A synthase HGNC:29932 details
hsa-miR-3611 PHF13 PHD finger protein 13 HGNC:22983 details
hsa-miR-3611 HMGA1 high mobility group AT-hook 1 HGNC:5010 details
hsa-miR-3611 EIF4H eukaryotic translation initiation factor 4H HGNC:12741 details
hsa-miR-3611 DAZAP2 DAZ associated protein 2 HGNC:2684 details
hsa-miR-3611 CRTAP cartilage associated protein HGNC:2379 details
hsa-miR-3611 CCNT1 cyclin T1 HGNC:1599 details
hsa-miR-3611 ACTB actin beta HGNC:132 details
hsa-miR-3611 RAD23B RAD23 homolog B, nucleotide excision repair protein HGNC:9813 details
hsa-miR-3611 ALG9 ALG9 alpha-1,2-mannosyltransferase HGNC:15672 details
hsa-miR-3611 COL9A2 collagen type IX alpha 2 chain HGNC:2218 details
hsa-miR-3611 HOXA13 homeobox A13 HGNC:5102 details
hsa-miR-3611 TOR1AIP2 torsin 1A interacting protein 2 HGNC:24055 details
hsa-miR-3611 AKR1B10 aldo-keto reductase family 1 member B10 HGNC:382 details
hsa-miR-3611 RBM12B RNA binding motif protein 12B HGNC:32310 details
hsa-miR-3611 ZCCHC3 zinc finger CCHC-type containing 3 HGNC:16230 details
hsa-miR-3611 MRO maestro HGNC:24121 details
hsa-miR-3611 CCNE2 cyclin E2 HGNC:1590 details
hsa-miR-3611 HNRNPU heterogeneous nuclear ribonucleoprotein U HGNC:5048 details
hsa-miR-3611 ARID3B AT-rich interaction domain 3B HGNC:14350 details
hsa-miR-3611 TBRG1 transforming growth factor beta regulator 1 HGNC:29551 details
hsa-miR-3611 GOLT1B golgi transport 1B HGNC:20175 details
hsa-miR-3611 SOD2 superoxide dismutase 2 HGNC:11180 details
hsa-miR-3611 HGFAC HGF activator HGNC:4894 details
hsa-miR-3611 details
hsa-miR-3611 SULT1B1 sulfotransferase family 1B member 1 HGNC:17845 details
hsa-miR-3611 EXO5 exonuclease 5 HGNC:26115 details
hsa-miR-3611 VKORC1L1 vitamin K epoxide reductase complex subunit 1 like 1 HGNC:21492 details
hsa-miR-3611 RORA RAR related orphan receptor A HGNC:10258 details
hsa-miR-3611 FZD5 frizzled class receptor 5 HGNC:4043 details
hsa-miR-3611 ARHGAP35 Rho GTPase activating protein 35 HGNC:4591 details
hsa-miR-3611 WIPI2 WD repeat domain, phosphoinositide interacting 2 HGNC:32225 details
hsa-miR-3611 KLHL24 kelch like family member 24 HGNC:25947 details
hsa-miR-3611 SALL1 spalt like transcription factor 1 HGNC:10524 details
hsa-miR-3611 PURB purine rich element binding protein B HGNC:9702 details
hsa-miR-3611 NR1D2 nuclear receptor subfamily 1 group D member 2 HGNC:7963 details
hsa-miR-3611 HSPA13 heat shock protein family A (Hsp70) member 13 HGNC:11375 details
hsa-miR-3611 CTSE cathepsin E HGNC:2530 details
hsa-miR-3611 PPP2R5C protein phosphatase 2 regulatory subunit B'gamma HGNC:9311 details
hsa-miR-3611 HOXA10 homeobox A10 HGNC:5100 details
hsa-miR-3611 RBM23 RNA binding motif protein 23 HGNC:20155 details
hsa-miR-3611 PA2G4 proliferation-associated 2G4 HGNC:8550 details
hsa-miR-3611 CNGA3 cyclic nucleotide gated channel subunit alpha 3 HGNC:2150 details
hsa-miR-3611 SFT2D2 SFT2 domain containing 2 HGNC:25140 details
hsa-miR-3611 SLC5A3 solute carrier family 5 member 3 HGNC:11038 details
hsa-miR-3611 SLC30A1 solute carrier family 30 member 1 HGNC:11012 details
hsa-miR-3611 PAWR pro-apoptotic WT1 regulator HGNC:8614 details
hsa-miR-3611 EXOSC2 exosome component 2 HGNC:17097 details
hsa-miR-3611 NDUFA12 NADH:ubiquinone oxidoreductase subunit A12 HGNC:23987 details
hsa-miR-3611 ZNF611 zinc finger protein 611 HGNC:28766 details
hsa-miR-3611 SLFN11 schlafen family member 11 HGNC:26633 details
hsa-miR-3611 TFDP1 transcription factor Dp-1 HGNC:11749 details
hsa-miR-3611 POC1B-GALNT4 POC1B-GALNT4 readthrough HGNC:42957 details
hsa-miR-3611 GALNT4 polypeptide N-acetylgalactosaminyltransferase 4 HGNC:4126 details
hsa-miR-3611 MAP1B microtubule associated protein 1B HGNC:6836 details
hsa-miR-3611 CA8 carbonic anhydrase 8 HGNC:1382 details
hsa-miR-3611 REEP3 receptor accessory protein 3 HGNC:23711 details
hsa-miR-3611 TG thyroglobulin HGNC:11764 details
hsa-miR-3611 RBM27 RNA binding motif protein 27 HGNC:29243 details
hsa-miR-3611 WSCD2 WSC domain containing 2 HGNC:29117 details
hsa-miR-3611 MX2 MX dynamin like GTPase 2 HGNC:7533 details
hsa-miR-3611 TLR6 toll like receptor 6 HGNC:16711 details
hsa-miR-3611 SRD5A3 steroid 5 alpha-reductase 3 HGNC:25812 details
hsa-miR-3611 ANGEL1 angel homolog 1 HGNC:19961 details
hsa-miR-3611 SPAG9 sperm associated antigen 9 HGNC:14524 details
hsa-miR-3611 RABGEF1 RAB guanine nucleotide exchange factor 1 HGNC:17676 details
hsa-miR-3611 PDE4D phosphodiesterase 4D HGNC:8783 details
hsa-miR-3611 SLC25A21 solute carrier family 25 member 21 HGNC:14411 details
hsa-miR-3611 MED8 mediator complex subunit 8 HGNC:19971 details
hsa-miR-3611 PLCE1 phospholipase C epsilon 1 HGNC:17175 details
hsa-miR-3611 AHCY adenosylhomocysteinase HGNC:343 details
hsa-miR-3611 AURKA aurora kinase A HGNC:11393 details
hsa-miR-3611 CELF1 CUGBP Elav-like family member 1 HGNC:2549 details
hsa-miR-3611 CHD3 chromodomain helicase DNA binding protein 3 HGNC:1918 details
hsa-miR-3611 LARP1 La ribonucleoprotein 1, translational regulator HGNC:29531 details
hsa-miR-3611 SIAH2 siah E3 ubiquitin protein ligase 2 HGNC:10858 details
hsa-miR-3611 SLC25A23 solute carrier family 25 member 23 HGNC:19375 details
hsa-miR-3611 ZBTB37 zinc finger and BTB domain containing 37 HGNC:28365 details
hsa-miR-3611 PCGF3 polycomb group ring finger 3 HGNC:10066 details
hsa-miR-3611 ZC3H12D zinc finger CCCH-type containing 12D HGNC:21175 details
hsa-miR-3611 ZNF268 zinc finger protein 268 HGNC:13061 details
hsa-miR-3611 CSNK1G1 casein kinase 1 gamma 1 HGNC:2454 details
© 2021 Arieh Warshel Institute of Computational Biology, CUHK(SZ) | Designed by : Biomics Lab