miRNA Card

miRNA General Information
miRNA ID hsa-miR-3613-3p
Description Homo sapiens miR-3613 stem-loop
Comment None
Experiment Illumina [1]
Sequence ACAAAAAAAAAAGCCCAACCCUUC
miRNA Expression in different cancers

    by mir_boxplot.py

circRNA-miRNA-gene regulatory network

Note about Netwrok:
This is a network diagram with miRNA (purple circle) as the center.
We used three tools(PITA, miRanda, targetScan) to predict the binding sites of circrna (green circle) and miRNA. Accordingly, for this miRNA that binds to circrna, we have three confidence levels, namely confident 1, confident 2 and confident 3. Confidence value indicates how many tools can deduce these results. For each confidence, we use different kinds of dashed lines.

Target circRNA with confidence

Confidence 3 (3 of 3 tools predicted)

CircID miRNA PITA miRanda targetScan

Confidence 2 (2 of 3 tools predicted)

CircID miRNA PITA miRanda targetScan

Confidence 1 (1 of 3 tools predicted)

CircID miRNA PITA miRanda targetScan
chr1:43622353|43622589 hsa-miR-3613-3p 1 0 0
chr14:68787837|68787978 hsa-miR-3613-3p 0 1 0
chr11:114045273|114045460 hsa-miR-3613-3p 0 1 0
chr16:89903737|89903838 hsa-miR-3613-3p 0 1 0
chr11:63818242|63818622 hsa-miR-3613-3p 0 1 0
chr9:37857886|37858118 hsa-miR-3613-3p 0 1 0
chr6:113857381|113857544 hsa-miR-3613-3p 0 1 0
chr2:199270479|199270600 hsa-miR-3613-3p 0 1 0
chr1:201484215|201484374 hsa-miR-3613-3p 0 1 0
chrX:54445161|54445270 hsa-miR-3613-3p 0 1 0
chr19:18170112|18170272 hsa-miR-3613-3p 1 0 0
chrX:54444529|54444635 hsa-miR-3613-3p 0 1 0
chr16:2597870|2597955 hsa-miR-3613-3p 0 1 0
chr6:113857381|113857501 hsa-miR-3613-3p 0 1 0
chr2:216695270|216695415 hsa-miR-3613-3p 0 1 0
chr1:13782451|13782553 hsa-miR-3613-3p 0 1 0
chr22:40770320|40770487 hsa-miR-3613-3p 0 1 0
chr2:150469624|150469701 hsa-miR-3613-3p 0 1 0
chr16:84908186|84908312 hsa-miR-3613-3p 0 1 0
chr9:120764357|120764460 hsa-miR-3613-3p 0 1 0
chr9:107331439|107331731 hsa-miR-3613-3p 0 1 0
chr15:51004843|51004954 hsa-miR-3613-3p 0 1 0
chr6:113857381|113857491 hsa-miR-3613-3p 0 1 0
chr8:30065988|30066359 hsa-miR-3613-3p 0 1 0
chr22:37831084~37831354 hsa-miR-3613-3p 0 1 0
chr18:63329052~63329204 hsa-miR-3613-3p 0 1 0
chrX:78126400~78126569 hsa-miR-3613-3p 0 1 0
chr2:150469624~150469701 hsa-miR-3613-3p 0 1 0
chr1:201484215~201484374 hsa-miR-3613-3p 0 1 0
chr15:70048649~70048716 hsa-miR-3613-3p 0 1 0
chr6:113857381~113857501 hsa-miR-3613-3p 0 1 0
chr9:137084159~137084276 hsa-miR-3613-3p 0 1 0
chr17:50504332~50504455 hsa-miR-3613-3p 0 1 0
chr16:29810523|29810779 hsa-miR-3613-3p 1 0 0
chr12:56253651|56253867 hsa-miR-3613-3p 0 1 0
chr4:105219621|105219768 hsa-miR-3613-3p 0 1 0
chr11:3787519|3787635 hsa-miR-3613-3p 0 1 0
chr7:128281192|128281358 hsa-miR-3613-3p 0 1 0
chr6:37934514|37934605 hsa-miR-3613-3p 0 1 0
chr1:15565979|15566218 hsa-miR-3613-3p 0 1 0
chr22:41125351|41125496 hsa-miR-3613-3p 0 1 0
chr15:98868286|98868395 hsa-miR-3613-3p 0 1 0
chr19:48383060|48383188 hsa-miR-3613-3p 0 1 0
chr15:42735965|42736357 hsa-miR-3613-3p 0 1 0
chr19:47753373|47753482 hsa-miR-3613-3p 0 1 0
chr17:2842975|2843176 hsa-miR-3613-3p 0 1 0
chr1:213061567|213061719 hsa-miR-3613-3p 0 1 0
chr9:128917139|128917457 hsa-miR-3613-3p 1 0 0
chr3:49423754|49423969 hsa-miR-3613-3p 0 1 0
chr6:31533858|31534004 hsa-miR-3613-3p 0 1 0
chr19:48382982|48383144 hsa-miR-3613-3p 0 1 0
chr1:183553654|183553761 hsa-miR-3613-3p 0 1 0
chr8:22621130|22621327 hsa-miR-3613-3p 0 1 0
chr19:10092769|10092958 hsa-miR-3613-3p 0 1 0
chr11:61402810|61402915 hsa-miR-3613-3p 0 1 0
chr2:150469591|150469701 hsa-miR-3613-3p 0 1 0
chr11:102230528|102230726 hsa-miR-3613-3p 0 1 0
chr4:77051882|77051984 hsa-miR-3613-3p 0 1 0
chr16:11837797|11837888 hsa-miR-3613-3p 0 1 0
chr1:223757778|223757931 hsa-miR-3613-3p 0 1 0
chr18:13763386|13763613 hsa-miR-3613-3p 0 1 0
chr1:32176036|32176202 hsa-miR-3613-3p 0 1 0
chrX:78126366|78126569 hsa-miR-3613-3p 0 1 0
chr10:70428192|70428327 hsa-miR-3613-3p 0 1 0
chr19:1610803|1610893 hsa-miR-3613-3p 0 1 0
chrX:78126440|78126569 hsa-miR-3613-3p 0 1 0
chr1:205717481|205717618 hsa-miR-3613-3p 0 1 0
chr21:36413218|36413315 hsa-miR-3613-3p 0 1 0
chr22:37831084|37831354 hsa-miR-3613-3p 0 1 0
chrX:47247803|47248022 hsa-miR-3613-3p -7 1 0
chr19:10641298|10641435 hsa-miR-3613-3p -3 1 0
chr15:70048582|70048751 hsa-miR-3613-3p -19 1 0
chr17:7312059|7312270 hsa-miR-3613-3p 1 0 0
chr19:13154141|13154262 hsa-miR-3613-3p 0 1 0
chr9:20345133|20345344 hsa-miR-3613-3p 0 1 0
chrX:48580374|48580516 hsa-miR-3613-3p 0 1 0
chr9:131499810|131499994 hsa-miR-3613-3p 0 1 0
chr22:29549052|29549155 hsa-miR-3613-3p 0 1 0
chrX:68841321|68841514 hsa-miR-3613-3p 0 1 0
chr3:172399631|172399794 hsa-miR-3613-3p 0 1 0
chr8:28346842|28347072 hsa-miR-3613-3p 0 1 0
chr20:43562177|43562347 hsa-miR-3613-3p 0 1 0
chr11:61402810|61402942 hsa-miR-3613-3p 0 1 0
chr15:73303207|73303339 hsa-miR-3613-3p 0 1 0
chr8:143743108|143743286 hsa-miR-3613-3p 0 1 0
chr11:61402810|61402934 hsa-miR-3613-3p 0 1 0
chr12:55994459|55994657 hsa-miR-3613-3p 0 1 0
chr12:125026850|125027009 hsa-miR-3613-3p 0 1 0
chrX:48580374|48580510 hsa-miR-3613-3p 0 1 0
chr9:131499810|131500019 hsa-miR-3613-3p 0 1 0
chr1:25832590|25832787 hsa-miR-3613-3p 0 1 0
chrX:47247894|47248104 hsa-miR-3613-3p 0 1 0
chr19:13154106|13154231 hsa-miR-3613-3p 0 1 0
chr4:158833556|158833854 hsa-miR-3613-3p 0 1 0
chr14:64442126|64442375 hsa-miR-3613-3p 0 1 0
chrX:54445161|54445285 hsa-miR-3613-3p 0 1 0
chr7:16792727|16792905 hsa-miR-3613-3p 0 1 0
chr19:4046292|4046421 hsa-miR-3613-3p 0 1 0
chr16:29810446|29810713 hsa-miR-3613-3p 1 0 0
Target genes
miRNA Gene Gene Description HGNC ID details
hsa-miR-3613-3p PHKG2 phosphorylase kinase catalytic subunit gamma 2 HGNC:8931 details
hsa-miR-3613-3p AK4 adenylate kinase 4 HGNC:363 details
hsa-miR-3613-3p CCNB1IP1 cyclin B1 interacting protein 1 HGNC:19437 details
hsa-miR-3613-3p NINJ1 ninjurin 1 HGNC:7824 details
hsa-miR-3613-3p UHRF1BP1L UHRF1 binding protein 1 like HGNC:29102 details
hsa-miR-3613-3p SIX1 SIX homeobox 1 HGNC:10887 details
hsa-miR-3613-3p TMEM158 transmembrane protein 158 HGNC:30293 details
hsa-miR-3613-3p CCBE1 collagen and calcium binding EGF domains 1 HGNC:29426 details
hsa-miR-3613-3p CTNNA3 catenin alpha 3 HGNC:2511 details
hsa-miR-3613-3p FBXO48 F-box protein 48 HGNC:33857 details
hsa-miR-3613-3p CDR2L cerebellar degeneration related protein 2 like HGNC:29999 details
hsa-miR-3613-3p SOWAHB sosondowah ankyrin repeat domain family member B HGNC:32958 details
hsa-miR-3613-3p TRAPPC6B trafficking protein particle complex subunit 6B HGNC:23066 details
hsa-miR-3613-3p SLC14A1 solute carrier family 14 member 1 (Kidd blood group) HGNC:10918 details
hsa-miR-3613-3p ZNF257 zinc finger protein 257 HGNC:13498 details
hsa-miR-3613-3p S1PR2 sphingosine-1-phosphate receptor 2 HGNC:3169 details
hsa-miR-3613-3p details
hsa-miR-3613-3p GSTCD glutathione S-transferase C-terminal domain containing HGNC:25806 details
hsa-miR-3613-3p NCOA4 nuclear receptor coactivator 4 HGNC:7671 details
hsa-miR-3613-3p PHF14 PHD finger protein 14 HGNC:22203 details
hsa-miR-3613-3p PTCHD1 patched domain containing 1 HGNC:26392 details
hsa-miR-3613-3p CRNKL1 crooked neck pre-mRNA splicing factor 1 HGNC:15762 details
hsa-miR-3613-3p FUT10 fucosyltransferase 10 HGNC:19234 details
hsa-miR-3613-3p SLC36A4 solute carrier family 36 member 4 HGNC:19660 details
hsa-miR-3613-3p MCM9 minichromosome maintenance 9 homologous recombination repair factor HGNC:21484 details
hsa-miR-3613-3p KCNAB1 potassium voltage-gated channel subfamily A regulatory beta subunit 1 HGNC:6228 details
hsa-miR-3613-3p SLFN5 schlafen family member 5 HGNC:28286 details
hsa-miR-3613-3p ADM adrenomedullin HGNC:259 details
hsa-miR-3613-3p FOXN2 forkhead box N2 HGNC:5281 details
hsa-miR-3613-3p CLCN6 chloride voltage-gated channel 6 HGNC:2024 details
hsa-miR-3613-3p SHOX2 short stature homeobox 2 HGNC:10854 details
hsa-miR-3613-3p details
hsa-miR-3613-3p HAT1 histone acetyltransferase 1 HGNC:4821 details
hsa-miR-3613-3p ADH5 alcohol dehydrogenase 5 (class III), chi polypeptide HGNC:253 details
hsa-miR-3613-3p ZNF654 zinc finger protein 654 HGNC:25612 details
hsa-miR-3613-3p TSC22D3 TSC22 domain family member 3 HGNC:3051 details
hsa-miR-3613-3p TMEM170A transmembrane protein 170A HGNC:29577 details
hsa-miR-3613-3p TET3 tet methylcytosine dioxygenase 3 HGNC:28313 details
hsa-miR-3613-3p NRAS NRAS proto-oncogene, GTPase HGNC:7989 details
hsa-miR-3613-3p KIF13A kinesin family member 13A HGNC:14566 details
hsa-miR-3613-3p DLG5 discs large MAGUK scaffold protein 5 HGNC:2904 details
hsa-miR-3613-3p DDX6 DEAD-box helicase 6 HGNC:2747 details
hsa-miR-3613-3p COIL coilin HGNC:2184 details
hsa-miR-3613-3p CALM2 calmodulin 2 HGNC:1445 details
hsa-miR-3613-3p ACTB actin beta HGNC:132 details
hsa-miR-3613-3p TGIF1 TGFB induced factor homeobox 1 HGNC:11776 details
hsa-miR-3613-3p ZFYVE26 zinc finger FYVE-type containing 26 HGNC:20761 details
hsa-miR-3613-3p DICER1 dicer 1, ribonuclease III HGNC:17098 details
hsa-miR-3613-3p BTBD3 BTB domain containing 3 HGNC:15854 details
hsa-miR-3613-3p CNOT4 CCR4-NOT transcription complex subunit 4 HGNC:7880 details
hsa-miR-3613-3p GADD45A growth arrest and DNA damage inducible alpha HGNC:4095 details
hsa-miR-3613-3p CCND2 cyclin D2 HGNC:1583 details
hsa-miR-3613-3p SMAD2 SMAD family member 2 HGNC:6768 details
hsa-miR-3613-3p EIF3H eukaryotic translation initiation factor 3 subunit H HGNC:3273 details
hsa-miR-3613-3p ZNF641 zinc finger protein 641 HGNC:31834 details
hsa-miR-3613-3p PARVB parvin beta HGNC:14653 details
hsa-miR-3613-3p WNT2B Wnt family member 2B HGNC:12781 details
hsa-miR-3613-3p NPM3 nucleophosmin/nucleoplasmin 3 HGNC:7931 details
hsa-miR-3613-3p details
hsa-miR-3613-3p DAZAP1 DAZ associated protein 1 HGNC:2683 details
hsa-miR-3613-3p ZNF664 zinc finger protein 664 HGNC:25406 details
hsa-miR-3613-3p KCTD2 potassium channel tetramerization domain containing 2 HGNC:21294 details
hsa-miR-3613-3p ZMAT3 zinc finger matrin-type 3 HGNC:29983 details
hsa-miR-3613-3p SPTSSA serine palmitoyltransferase small subunit A HGNC:20361 details
hsa-miR-3613-3p SOX4 SRY-box transcription factor 4 HGNC:11200 details
hsa-miR-3613-3p PPP4R3A protein phosphatase 4 regulatory subunit 3A HGNC:20219 details
hsa-miR-3613-3p SKIL SKI like proto-oncogene HGNC:10897 details
hsa-miR-3613-3p DCP2 decapping mRNA 2 HGNC:24452 details
hsa-miR-3613-3p CCNL1 cyclin L1 HGNC:20569 details
hsa-miR-3613-3p AGO2 argonaute RISC catalytic component 2 HGNC:3263 details
hsa-miR-3613-3p BIRC5 baculoviral IAP repeat containing 5 HGNC:593 details
hsa-miR-3613-3p CD38 CD38 molecule HGNC:1667 details
hsa-miR-3613-3p ZNF226 zinc finger protein 226 HGNC:13019 details
hsa-miR-3613-3p HNRNPDL heterogeneous nuclear ribonucleoprotein D like HGNC:5037 details
hsa-miR-3613-3p GABARAPL1 GABA type A receptor associated protein like 1 HGNC:4068 details
hsa-miR-3613-3p GALK2 galactokinase 2 HGNC:4119 details
hsa-miR-3613-3p NIPAL1 NIPA like domain containing 1 HGNC:27194 details
hsa-miR-3613-3p PLEKHG3 pleckstrin homology and RhoGEF domain containing G3 HGNC:20364 details
hsa-miR-3613-3p ZNFX1 zinc finger NFX1-type containing 1 HGNC:29271 details
hsa-miR-3613-3p SGMS2 sphingomyelin synthase 2 HGNC:28395 details
hsa-miR-3613-3p RAN RAN, member RAS oncogene family HGNC:9846 details
hsa-miR-3613-3p PRKCI protein kinase C iota HGNC:9404 details
hsa-miR-3613-3p GRB10 growth factor receptor bound protein 10 HGNC:4564 details
hsa-miR-3613-3p SRPX2 sushi repeat containing protein X-linked 2 HGNC:30668 details
hsa-miR-3613-3p ZER1 zyg-11 related cell cycle regulator HGNC:30960 details
hsa-miR-3613-3p TMF1 TATA element modulatory factor 1 HGNC:11870 details
hsa-miR-3613-3p INPP4A inositol polyphosphate-4-phosphatase type I A HGNC:6074 details
hsa-miR-3613-3p GUCD1 guanylyl cyclase domain containing 1 HGNC:14237 details
hsa-miR-3613-3p MCM4 minichromosome maintenance complex component 4 HGNC:6947 details
hsa-miR-3613-3p HEPH hephaestin HGNC:4866 details
hsa-miR-3613-3p C4orf17 chromosome 4 open reading frame 17 HGNC:25274 details
hsa-miR-3613-3p CLASP1 cytoplasmic linker associated protein 1 HGNC:17088 details
hsa-miR-3613-3p TMEM196 transmembrane protein 196 HGNC:22431 details
hsa-miR-3613-3p ORC4 origin recognition complex subunit 4 HGNC:8490 details
hsa-miR-3613-3p ZNF552 zinc finger protein 552 HGNC:26135 details
hsa-miR-3613-3p TRAF3IP1 TRAF3 interacting protein 1 HGNC:17861 details
hsa-miR-3613-3p PSMB2 proteasome 20S subunit beta 2 HGNC:9539 details
hsa-miR-3613-3p ISLR2 immunoglobulin superfamily containing leucine rich repeat 2 HGNC:29286 details
hsa-miR-3613-3p ATRNL1 attractin like 1 HGNC:29063 details
hsa-miR-3613-3p MALT1 MALT1 paracaspase HGNC:6819 details
hsa-miR-3613-3p PSMG1 proteasome assembly chaperone 1 HGNC:3043 details
hsa-miR-3613-3p HCCS holocytochrome c synthase HGNC:4837 details
hsa-miR-3613-3p PLXDC1 plexin domain containing 1 HGNC:20945 details
hsa-miR-3613-3p ZNF582 zinc finger protein 582 HGNC:26421 details
hsa-miR-3613-3p GPR85 G protein-coupled receptor 85 HGNC:4536 details
hsa-miR-3613-3p PLA2G4D phospholipase A2 group IVD HGNC:30038 details
hsa-miR-3613-3p FANCC FA complementation group C HGNC:3584 details
hsa-miR-3613-3p LSM8 LSM8 homolog, U6 small nuclear RNA associated HGNC:20471 details
hsa-miR-3613-3p HAUS3 HAUS augmin like complex subunit 3 HGNC:28719 details
hsa-miR-3613-3p LINC00598 long intergenic non-protein coding RNA 598 HGNC:42770 details
hsa-miR-3613-3p WDR13 WD repeat domain 13 HGNC:14352 details
hsa-miR-3613-3p WASF3 WASP family member 3 HGNC:12734 details
hsa-miR-3613-3p TMSB4X thymosin beta 4 X-linked HGNC:11881 details
hsa-miR-3613-3p SPPL3 signal peptide peptidase like 3 HGNC:30424 details
hsa-miR-3613-3p RNF20 ring finger protein 20 HGNC:10062 details
hsa-miR-3613-3p RAB18 RAB18, member RAS oncogene family HGNC:14244 details
hsa-miR-3613-3p PTBP3 polypyrimidine tract binding protein 3 HGNC:10253 details
hsa-miR-3613-3p PLK2 polo like kinase 2 HGNC:19699 details
hsa-miR-3613-3p MAPK8 mitogen-activated protein kinase 8 HGNC:6881 details
hsa-miR-3613-3p MAP7 microtubule associated protein 7 HGNC:6869 details
hsa-miR-3613-3p LIMA1 LIM domain and actin binding 1 HGNC:24636 details
hsa-miR-3613-3p LDLR low density lipoprotein receptor HGNC:6547 details
hsa-miR-3613-3p HOOK3 hook microtubule tethering protein 3 HGNC:23576 details
hsa-miR-3613-3p HNRNPD heterogeneous nuclear ribonucleoprotein D HGNC:5036 details
hsa-miR-3613-3p HIVEP1 HIVEP zinc finger 1 HGNC:4920 details
hsa-miR-3613-3p GOLGA3 golgin A3 HGNC:4426 details
hsa-miR-3613-3p GDE1 glycerophosphodiester phosphodiesterase 1 HGNC:29644 details
hsa-miR-3613-3p FOXP2 forkhead box P2 HGNC:13875 details
hsa-miR-3613-3p ERGIC2 ERGIC and golgi 2 HGNC:30208 details
hsa-miR-3613-3p DPP8 dipeptidyl peptidase 8 HGNC:16490 details
hsa-miR-3613-3p DCDC2 doublecortin domain containing 2 HGNC:18141 details
hsa-miR-3613-3p CTC1 CST telomere replication complex component 1 HGNC:26169 details
hsa-miR-3613-3p RPL32 ribosomal protein L32 HGNC:10336 details
hsa-miR-3613-3p CDC5L cell division cycle 5 like HGNC:1743 details
hsa-miR-3613-3p ZNF136 zinc finger protein 136 HGNC:12920 details
hsa-miR-3613-3p C18orf32 chromosome 18 open reading frame 32 HGNC:31690 details
hsa-miR-3613-3p ASB11 ankyrin repeat and SOCS box containing 11 HGNC:17186 details
hsa-miR-3613-3p QTRT2 queuine tRNA-ribosyltransferase accessory subunit 2 HGNC:25771 details
hsa-miR-3613-3p SESN3 sestrin 3 HGNC:23060 details
hsa-miR-3613-3p HSPA1B heat shock protein family A (Hsp70) member 1B HGNC:5233 details
hsa-miR-3613-3p DYRK2 dual specificity tyrosine phosphorylation regulated kinase 2 HGNC:3093 details
hsa-miR-3613-3p STXBP2 syntaxin binding protein 2 HGNC:11445 details
hsa-miR-3613-3p ITM2A integral membrane protein 2A HGNC:6173 details
hsa-miR-3613-3p LRIF1 ligand dependent nuclear receptor interacting factor 1 HGNC:30299 details
hsa-miR-3613-3p SIKE1 suppressor of IKBKE 1 HGNC:26119 details
hsa-miR-3613-3p ZNF860 zinc finger protein 860 HGNC:34513 details
hsa-miR-3613-3p FCF1 FCF1 rRNA-processing protein HGNC:20220 details
hsa-miR-3613-3p INTU inturned planar cell polarity protein HGNC:29239 details
hsa-miR-3613-3p BVES blood vessel epicardial substance HGNC:1152 details
hsa-miR-3613-3p PDZRN4 PDZ domain containing ring finger 4 HGNC:30552 details
hsa-miR-3613-3p ADAMTS9 ADAM metallopeptidase with thrombospondin type 1 motif 9 HGNC:13202 details
hsa-miR-3613-3p UBE3A ubiquitin protein ligase E3A HGNC:12496 details
hsa-miR-3613-3p SYNM synemin HGNC:24466 details
hsa-miR-3613-3p RNF115 ring finger protein 115 HGNC:18154 details
hsa-miR-3613-3p RAP1B RAP1B, member of RAS oncogene family HGNC:9857 details
hsa-miR-3613-3p PTMA prothymosin alpha HGNC:9623 details
hsa-miR-3613-3p POGZ pogo transposable element derived with ZNF domain HGNC:18801 details
hsa-miR-3613-3p MBNL3 muscleblind like splicing regulator 3 HGNC:20564 details
hsa-miR-3613-3p GIGYF1 GRB10 interacting GYF protein 1 HGNC:9126 details
hsa-miR-3613-3p CHD1 chromodomain helicase DNA binding protein 1 HGNC:1915 details
hsa-miR-3613-3p CANX calnexin HGNC:1473 details
hsa-miR-3613-3p C18orf25 chromosome 18 open reading frame 25 HGNC:28172 details
hsa-miR-3613-3p BMP3 bone morphogenetic protein 3 HGNC:1070 details
hsa-miR-3613-3p ARHGAP12 Rho GTPase activating protein 12 HGNC:16348 details
hsa-miR-3613-3p MAVS mitochondrial antiviral signaling protein HGNC:29233 details
hsa-miR-3613-3p PLCXD1 phosphatidylinositol specific phospholipase C X domain containing 1 HGNC:23148 details
hsa-miR-3613-3p ZNF678 zinc finger protein 678 HGNC:28652 details
hsa-miR-3613-3p WNK3 WNK lysine deficient protein kinase 3 HGNC:14543 details
hsa-miR-3613-3p UBE2Z ubiquitin conjugating enzyme E2 Z HGNC:25847 details
hsa-miR-3613-3p TUBB2A tubulin beta 2A class IIa HGNC:12412 details
hsa-miR-3613-3p TCF7L2 transcription factor 7 like 2 HGNC:11641 details
hsa-miR-3613-3p PAFAH1B2 platelet activating factor acetylhydrolase 1b catalytic subunit 2 HGNC:8575 details
hsa-miR-3613-3p MAP3K3 mitogen-activated protein kinase kinase kinase 3 HGNC:6855 details
hsa-miR-3613-3p MAFK MAF bZIP transcription factor K HGNC:6782 details
hsa-miR-3613-3p LMNB2 lamin B2 HGNC:6638 details
hsa-miR-3613-3p IGF1R insulin like growth factor 1 receptor HGNC:5465 details
hsa-miR-3613-3p HNRNPU heterogeneous nuclear ribonucleoprotein U HGNC:5048 details
hsa-miR-3613-3p ESCO2 establishment of sister chromatid cohesion N-acetyltransferase 2 HGNC:27230 details
hsa-miR-3613-3p DYNC1LI2 dynein cytoplasmic 1 light intermediate chain 2 HGNC:2966 details
hsa-miR-3613-3p CFL2 cofilin 2 HGNC:1875 details
hsa-miR-3613-3p details
hsa-miR-3613-3p RPS28 ribosomal protein S28 HGNC:10418 details
hsa-miR-3613-3p TRMT112 tRNA methyltransferase activator subunit 11-2 HGNC:26940 details
hsa-miR-3613-3p YY1 YY1 transcription factor HGNC:12856 details
hsa-miR-3613-3p ZNF28 zinc finger protein 28 HGNC:13073 details
hsa-miR-3613-3p SLC25A12 solute carrier family 25 member 12 HGNC:10982 details
hsa-miR-3613-3p ZWINT ZW10 interacting kinetochore protein HGNC:13195 details
hsa-miR-3613-3p PFDN2 prefoldin subunit 2 HGNC:8867 details
hsa-miR-3613-3p HUWE1 HECT, UBA and WWE domain containing E3 ubiquitin protein ligase 1 HGNC:30892 details
hsa-miR-3613-3p STAT2 signal transducer and activator of transcription 2 HGNC:11363 details
hsa-miR-3613-3p CEBPB CCAAT enhancer binding protein beta HGNC:1834 details
hsa-miR-3613-3p GPBP1L1 GC-rich promoter binding protein 1 like 1 HGNC:28843 details
hsa-miR-3613-3p ZFC3H1 zinc finger C3H1-type containing HGNC:28328 details
hsa-miR-3613-3p WEE1 WEE1 G2 checkpoint kinase HGNC:12761 details
hsa-miR-3613-3p VIM vimentin HGNC:12692 details
hsa-miR-3613-3p TBL1XR1 TBL1X receptor 1 HGNC:29529 details
hsa-miR-3613-3p PLAGL2 PLAG1 like zinc finger 2 HGNC:9047 details
hsa-miR-3613-3p OTUD1 OTU deubiquitinase 1 HGNC:27346 details
hsa-miR-3613-3p NFYA nuclear transcription factor Y subunit alpha HGNC:7804 details
hsa-miR-3613-3p LMNB1 lamin B1 HGNC:6637 details
hsa-miR-3613-3p IGFBP5 insulin like growth factor binding protein 5 HGNC:5474 details
hsa-miR-3613-3p FCHSD2 FCH and double SH3 domains 2 HGNC:29114 details
hsa-miR-3613-3p SINHCAF SIN3-HDAC complex associated factor HGNC:30702 details
hsa-miR-3613-3p DYNLL2 dynein light chain LC8-type 2 HGNC:24596 details
hsa-miR-3613-3p CCNY cyclin Y HGNC:23354 details
hsa-miR-3613-3p CBX3 chromobox 3 HGNC:1553 details
hsa-miR-3613-3p BTF3L4 basic transcription factor 3 like 4 HGNC:30547 details
hsa-miR-3613-3p MYBL1 MYB proto-oncogene like 1 HGNC:7547 details
hsa-miR-3613-3p TMC5 transmembrane channel like 5 HGNC:22999 details
hsa-miR-3613-3p HIPK3 homeodomain interacting protein kinase 3 HGNC:4915 details
hsa-miR-3613-3p OR9Q1 olfactory receptor family 9 subfamily Q member 1 HGNC:14724 details
hsa-miR-3613-3p TTPAL alpha tocopherol transfer protein like HGNC:16114 details
hsa-miR-3613-3p LSM11 LSM11, U7 small nuclear RNA associated HGNC:30860 details
hsa-miR-3613-3p GPATCH8 G-patch domain containing 8 HGNC:29066 details
hsa-miR-3613-3p CELF1 CUGBP Elav-like family member 1 HGNC:2549 details
hsa-miR-3613-3p CDV3 CDV3 homolog HGNC:26928 details
hsa-miR-3613-3p AKIRIN1 akirin 1 HGNC:25744 details
hsa-miR-3613-3p RNF103-CHMP3 RNF103-CHMP3 readthrough HGNC:38847 details
hsa-miR-3613-3p CHMP3 charged multivesicular body protein 3 HGNC:29865 details
hsa-miR-3613-3p PDE3A phosphodiesterase 3A HGNC:8778 details
hsa-miR-3613-3p SLC24A4 solute carrier family 24 member 4 HGNC:10978 details
hsa-miR-3613-3p VPS50 VPS50 subunit of EARP/GARPII complex HGNC:25956 details
hsa-miR-3613-3p RPS16 ribosomal protein S16 HGNC:10396 details
hsa-miR-3613-3p HMGB2 high mobility group box 2 HGNC:5000 details
hsa-miR-3613-3p DHODH dihydroorotate dehydrogenase (quinone) HGNC:2867 details
hsa-miR-3613-3p TANGO2 transport and golgi organization 2 homolog HGNC:25439 details
hsa-miR-3613-3p PARP15 poly(ADP-ribose) polymerase family member 15 HGNC:26876 details
hsa-miR-3613-3p SMS spermine synthase HGNC:11123 details
hsa-miR-3613-3p ATF7IP2 activating transcription factor 7 interacting protein 2 HGNC:20397 details
hsa-miR-3613-3p TMEM44 transmembrane protein 44 HGNC:25120 details
hsa-miR-3613-3p SGO2 shugoshin 2 HGNC:30812 details
hsa-miR-3613-3p NUDCD3 NudC domain containing 3 HGNC:22208 details
hsa-miR-3613-3p HINFP histone H4 transcription factor HGNC:17850 details
hsa-miR-3613-3p BSDC1 BSD domain containing 1 HGNC:25501 details
hsa-miR-3613-3p HSPA4 heat shock protein family A (Hsp70) member 4 HGNC:5237 details
hsa-miR-3613-3p GDPD1 glycerophosphodiester phosphodiesterase domain containing 1 HGNC:20883 details
hsa-miR-3613-3p UTP20 UTP20 small subunit processome component HGNC:17897 details
hsa-miR-3613-3p PCNX2 pecanex 2 HGNC:8736 details
hsa-miR-3613-3p PSPC1 paraspeckle component 1 HGNC:20320 details
hsa-miR-3613-3p GNAQ G protein subunit alpha q HGNC:4390 details
hsa-miR-3613-3p SCN1A sodium voltage-gated channel alpha subunit 1 HGNC:10585 details
hsa-miR-3613-3p details
hsa-miR-3613-3p INTS7 integrator complex subunit 7 HGNC:24484 details
hsa-miR-3613-3p TM4SF20 transmembrane 4 L six family member 20 HGNC:26230 details
hsa-miR-3613-3p EIF4G3 eukaryotic translation initiation factor 4 gamma 3 HGNC:3298 details
hsa-miR-3613-3p TMTC1 transmembrane O-mannosyltransferase targeting cadherins 1 HGNC:24099 details
hsa-miR-3613-3p BRD4 bromodomain containing 4 HGNC:13575 details
hsa-miR-3613-3p FGF5 fibroblast growth factor 5 HGNC:3683 details
hsa-miR-3613-3p DNTTIP2 deoxynucleotidyltransferase terminal interacting protein 2 HGNC:24013 details
hsa-miR-3613-3p DLG4 discs large MAGUK scaffold protein 4 HGNC:2903 details
hsa-miR-3613-3p CCNF cyclin F HGNC:1591 details
hsa-miR-3613-3p SLC35C2 solute carrier family 35 member C2 HGNC:17117 details
hsa-miR-3613-3p PSMD11 proteasome 26S subunit, non-ATPase 11 HGNC:9556 details
hsa-miR-3613-3p GGCX gamma-glutamyl carboxylase HGNC:4247 details
hsa-miR-3613-3p FAM117B family with sequence similarity 117 member B HGNC:14440 details
hsa-miR-3613-3p ACTR10 actin related protein 10 HGNC:17372 details
hsa-miR-3613-3p DPF3 double PHD fingers 3 HGNC:17427 details
hsa-miR-3613-3p FAM126B family with sequence similarity 126 member B HGNC:28593 details
hsa-miR-3613-3p PARD6B par-6 family cell polarity regulator beta HGNC:16245 details
hsa-miR-3613-3p SH3BP2 SH3 domain binding protein 2 HGNC:10825 details
hsa-miR-3613-3p HECTD1 HECT domain E3 ubiquitin protein ligase 1 HGNC:20157 details
hsa-miR-3613-3p SPIC Spi-C transcription factor HGNC:29549 details
hsa-miR-3613-3p MICA MHC class I polypeptide-related sequence A HGNC:7090 details
hsa-miR-3613-3p IGSF11 immunoglobulin superfamily member 11 HGNC:16669 details
hsa-miR-3613-3p ZNF568 zinc finger protein 568 HGNC:25392 details
hsa-miR-3613-3p SPECC1 sperm antigen with calponin homology and coiled-coil domains 1 HGNC:30615 details
hsa-miR-3613-3p FUNDC2 FUN14 domain containing 2 HGNC:24925 details
hsa-miR-3613-3p CWF19L1 CWF19 like cell cycle control factor 1 HGNC:25613 details
hsa-miR-3613-3p LMBR1 limb development membrane protein 1 HGNC:13243 details
hsa-miR-3613-3p TMEM220 transmembrane protein 220 HGNC:33757 details
hsa-miR-3613-3p SRFBP1 serum response factor binding protein 1 HGNC:26333 details
hsa-miR-3613-3p NRIP2 nuclear receptor interacting protein 2 HGNC:23078 details
hsa-miR-3613-3p CCDC65 coiled-coil domain containing 65 HGNC:29937 details
hsa-miR-3613-3p RAPH1 Ras association (RalGDS/AF-6) and pleckstrin homology domains 1 HGNC:14436 details
hsa-miR-3613-3p TLN1 talin 1 HGNC:11845 details
hsa-miR-3613-3p POLR2D RNA polymerase II subunit D HGNC:9191 details
hsa-miR-3613-3p TM4SF5 transmembrane 4 L six family member 5 HGNC:11857 details
hsa-miR-3613-3p RPL3L ribosomal protein L3 like HGNC:10351 details
hsa-miR-3613-3p EIF2S3 eukaryotic translation initiation factor 2 subunit gamma HGNC:3267 details
hsa-miR-3613-3p ITGB8 integrin subunit beta 8 HGNC:6163 details
hsa-miR-3613-3p ZNF514 zinc finger protein 514 HGNC:25894 details
hsa-miR-3613-3p TNPO1 transportin 1 HGNC:6401 details
hsa-miR-3613-3p SV2C synaptic vesicle glycoprotein 2C HGNC:30670 details
hsa-miR-3613-3p STK17B serine/threonine kinase 17b HGNC:11396 details
hsa-miR-3613-3p SEH1L SEH1 like nucleoporin HGNC:30379 details
hsa-miR-3613-3p RRAGC Ras related GTP binding C HGNC:19902 details
hsa-miR-3613-3p HINT1 histidine triad nucleotide binding protein 1 HGNC:4912 details
hsa-miR-3613-3p CASTOR2 cytosolic arginine sensor for mTORC1 subunit 2 HGNC:37073 details
hsa-miR-3613-3p FOXK2 forkhead box K2 HGNC:6036 details
hsa-miR-3613-3p FGF12 fibroblast growth factor 12 HGNC:3668 details
hsa-miR-3613-3p FBN2 fibrillin 2 HGNC:3604 details
hsa-miR-3613-3p FAM104A family with sequence similarity 104 member A HGNC:25918 details
hsa-miR-3613-3p EDEM1 ER degradation enhancing alpha-mannosidase like protein 1 HGNC:18967 details
hsa-miR-3613-3p CRISPLD2 cysteine rich secretory protein LCCL domain containing 2 HGNC:25248 details
hsa-miR-3613-3p CNOT6L CCR4-NOT transcription complex subunit 6 like HGNC:18042 details
hsa-miR-3613-3p STMP1 short transmembrane mitochondrial protein 1 HGNC:41909 details
hsa-miR-3613-3p PAK4 p21 (RAC1) activated kinase 4 HGNC:16059 details
hsa-miR-3613-3p OGFOD1 2-oxoglutarate and iron dependent oxygenase domain containing 1 HGNC:25585 details
hsa-miR-3613-3p CCS copper chaperone for superoxide dismutase HGNC:1613 details
hsa-miR-3613-3p ZNF619 zinc finger protein 619 HGNC:26910 details
hsa-miR-3613-3p TP73 tumor protein p73 HGNC:12003 details
hsa-miR-3613-3p DFFA DNA fragmentation factor subunit alpha HGNC:2772 details
hsa-miR-3613-3p PAQR7 progestin and adipoQ receptor family member 7 HGNC:23146 details
hsa-miR-3613-3p PIK3C2B phosphatidylinositol-4-phosphate 3-kinase catalytic subunit type 2 beta HGNC:8972 details
hsa-miR-3613-3p ASAP2 ArfGAP with SH3 domain, ankyrin repeat and PH domain 2 HGNC:2721 details
hsa-miR-3613-3p SLC19A1 solute carrier family 19 member 1 HGNC:10937 details
hsa-miR-3613-3p FDX1 ferredoxin 1 HGNC:3638 details
hsa-miR-3613-3p ZBTB3 zinc finger and BTB domain containing 3 HGNC:22918 details
hsa-miR-3613-3p STRIP2 striatin interacting protein 2 HGNC:22209 details
hsa-miR-3613-3p SNIP1 Smad nuclear interacting protein 1 HGNC:30587 details
hsa-miR-3613-3p RFFL ring finger and FYVE like domain containing E3 ubiquitin protein ligase HGNC:24821 details
hsa-miR-3613-3p details
hsa-miR-3613-3p FREM2 FRAS1 related extracellular matrix 2 HGNC:25396 details
hsa-miR-3613-3p FKBP9 FKBP prolyl isomerase 9 HGNC:3725 details
hsa-miR-3613-3p details
hsa-miR-3613-3p ANAPC16 anaphase promoting complex subunit 16 HGNC:26976 details
hsa-miR-3613-3p PLEKHA3 pleckstrin homology domain containing A3 HGNC:14338 details
hsa-miR-3613-3p CD59 CD59 molecule (CD59 blood group) HGNC:1689 details
hsa-miR-3613-3p PRRG3 proline rich and Gla domain 3 HGNC:30798 details
hsa-miR-3613-3p details
hsa-miR-3613-3p NOP53 NOP53 ribosome biogenesis factor HGNC:4333 details
hsa-miR-3613-3p DEFB105B defensin beta 105B HGNC:29930 details
hsa-miR-3613-3p DEFB105A defensin beta 105A HGNC:18087 details
hsa-miR-3613-3p B3GNT7 UDP-GlcNAc:betaGal beta-1,3-N-acetylglucosaminyltransferase 7 HGNC:18811 details
hsa-miR-3613-3p CDK9 cyclin dependent kinase 9 HGNC:1780 details
hsa-miR-3613-3p RNF2 ring finger protein 2 HGNC:10061 details
hsa-miR-3613-3p ACER2 alkaline ceramidase 2 HGNC:23675 details
hsa-miR-3613-3p ZBTB33 zinc finger and BTB domain containing 33 HGNC:16682 details
hsa-miR-3613-3p RABGEF1 RAB guanine nucleotide exchange factor 1 HGNC:17676 details
hsa-miR-3613-3p ZNF99 zinc finger protein 99 HGNC:13175 details
hsa-miR-3613-3p details
hsa-miR-3613-3p SRSF2 serine and arginine rich splicing factor 2 HGNC:10783 details
hsa-miR-3613-3p PGM2 phosphoglucomutase 2 HGNC:8906 details
hsa-miR-3613-3p STEAP4 STEAP4 metalloreductase HGNC:21923 details
hsa-miR-3613-3p RPP40 ribonuclease P/MRP subunit p40 HGNC:20992 details
hsa-miR-3613-3p C9orf64 chromosome 9 open reading frame 64 HGNC:28144 details
hsa-miR-3613-3p details
hsa-miR-3613-3p CDCA2 cell division cycle associated 2 HGNC:14623 details
hsa-miR-3613-3p IGSF9B immunoglobulin superfamily member 9B HGNC:32326 details
hsa-miR-3613-3p ZNF562 zinc finger protein 562 HGNC:25950 details
hsa-miR-3613-3p LPCAT3 lysophosphatidylcholine acyltransferase 3 HGNC:30244 details
hsa-miR-3613-3p ZNF518B zinc finger protein 518B HGNC:29365 details
hsa-miR-3613-3p VPS37A VPS37A subunit of ESCRT-I HGNC:24928 details
hsa-miR-3613-3p TRA2B transformer 2 beta homolog HGNC:10781 details
hsa-miR-3613-3p SNAP29 synaptosome associated protein 29 HGNC:11133 details
hsa-miR-3613-3p RASSF2 Ras association domain family member 2 HGNC:9883 details
hsa-miR-3613-3p PNO1 partner of NOB1 homolog HGNC:32790 details
hsa-miR-3613-3p details
hsa-miR-3613-3p PAK3 p21 (RAC1) activated kinase 3 HGNC:8592 details
hsa-miR-3613-3p NUDT21 nudix hydrolase 21 HGNC:13870 details
hsa-miR-3613-3p NGDN neuroguidin HGNC:20271 details
hsa-miR-3613-3p MTX3 metaxin 3 HGNC:24812 details
hsa-miR-3613-3p MBOAT2 membrane bound O-acyltransferase domain containing 2 HGNC:25193 details
hsa-miR-3613-3p MACC1 MET transcriptional regulator MACC1 HGNC:30215 details
hsa-miR-3613-3p KCNN3 potassium calcium-activated channel subfamily N member 3 HGNC:6292 details
hsa-miR-3613-3p details
hsa-miR-3613-3p GJD3 gap junction protein delta 3 HGNC:19147 details
hsa-miR-3613-3p FRMD3 FERM domain containing 3 HGNC:24125 details
hsa-miR-3613-3p EXOC5 exocyst complex component 5 HGNC:10696 details
hsa-miR-3613-3p CLSPN claspin HGNC:19715 details
hsa-miR-3613-3p APLF aprataxin and PNKP like factor HGNC:28724 details
hsa-miR-3613-3p ANTXR2 ANTXR cell adhesion molecule 2 HGNC:21732 details
hsa-miR-3613-3p AKAP2 A-kinase anchoring protein 2 HGNC:372 details
hsa-miR-3613-3p AGPS alkylglycerone phosphate synthase HGNC:327 details
hsa-miR-3613-3p SHMT1 serine hydroxymethyltransferase 1 HGNC:10850 details
hsa-miR-3613-3p KCNB1 potassium voltage-gated channel subfamily B member 1 HGNC:6231 details
hsa-miR-3613-3p HCFC2 host cell factor C2 HGNC:24972 details
hsa-miR-3613-3p GINS2 GINS complex subunit 2 HGNC:24575 details
hsa-miR-3613-3p ENAH ENAH actin regulator HGNC:18271 details
hsa-miR-3613-3p KLHDC8A kelch domain containing 8A HGNC:25573 details
hsa-miR-3613-3p TBPL1 TATA-box binding protein like 1 HGNC:11589 details
hsa-miR-3613-3p CPM carboxypeptidase M HGNC:2311 details
hsa-miR-3613-3p ZNF581 zinc finger protein 581 HGNC:25017 details
hsa-miR-3613-3p MCM10 minichromosome maintenance 10 replication initiation factor HGNC:18043 details
hsa-miR-3613-3p IFIT3 interferon induced protein with tetratricopeptide repeats 3 HGNC:5411 details
hsa-miR-3613-3p MCTS1 MCTS1 re-initiation and release factor HGNC:23357 details
hsa-miR-3613-3p RPL10A ribosomal protein L10a HGNC:10299 details
hsa-miR-3613-3p COX18 cytochrome c oxidase assembly factor COX18 HGNC:26801 details
hsa-miR-3613-3p FBXO25 F-box protein 25 HGNC:13596 details
hsa-miR-3613-3p LSG1 large 60S subunit nuclear export GTPase 1 HGNC:25652 details
hsa-miR-3613-3p TVP23C trans-golgi network vesicle protein 23 homolog C HGNC:30453 details
hsa-miR-3613-3p FAM234B family with sequence similarity 234 member B HGNC:29288 details
hsa-miR-3613-3p HHIP hedgehog interacting protein HGNC:14866 details
hsa-miR-3613-3p DNA2 DNA replication helicase/nuclease 2 HGNC:2939 details
hsa-miR-3613-3p ZNF574 zinc finger protein 574 HGNC:26166 details
hsa-miR-3613-3p C5AR2 complement C5a receptor 2 HGNC:4527 details
hsa-miR-3613-3p NXN nucleoredoxin HGNC:18008 details
hsa-miR-3613-3p PLA2G2C phospholipase A2 group IIC HGNC:9032 details
hsa-miR-3613-3p SGSM2 small G protein signaling modulator 2 HGNC:29026 details
hsa-miR-3613-3p PTCD2 pentatricopeptide repeat domain 2 HGNC:25734 details
hsa-miR-3613-3p RNF207 ring finger protein 207 HGNC:32947 details
hsa-miR-3613-3p ORC1 origin recognition complex subunit 1 HGNC:8487 details
hsa-miR-3613-3p MXRA7 matrix remodeling associated 7 HGNC:7541 details
hsa-miR-3613-3p HASPIN histone H3 associated protein kinase HGNC:19682 details
hsa-miR-3613-3p LRTOMT leucine rich transmembrane and O-methyltransferase domain containing HGNC:25033 details
hsa-miR-3613-3p PHAX phosphorylated adaptor for RNA export HGNC:10241 details
hsa-miR-3613-3p CLPB caseinolytic mitochondrial matrix peptidase chaperone subunit B HGNC:30664 details
hsa-miR-3613-3p GLP2R glucagon like peptide 2 receptor HGNC:4325 details
hsa-miR-3613-3p LYZ lysozyme HGNC:6740 details
hsa-miR-3613-3p APOC3 apolipoprotein C3 HGNC:610 details
hsa-miR-3613-3p SAMD15 sterile alpha motif domain containing 15 HGNC:18631 details
hsa-miR-3613-3p USP6NL USP6 N-terminal like HGNC:16858 details
hsa-miR-3613-3p TNFRSF13C TNF receptor superfamily member 13C HGNC:17755 details
hsa-miR-3613-3p TMEM127 transmembrane protein 127 HGNC:26038 details
hsa-miR-3613-3p SOS1 SOS Ras/Rac guanine nucleotide exchange factor 1 HGNC:11187 details
hsa-miR-3613-3p RNF38 ring finger protein 38 HGNC:18052 details
hsa-miR-3613-3p NT5DC3 5'-nucleotidase domain containing 3 HGNC:30826 details
hsa-miR-3613-3p IFNLR1 interferon lambda receptor 1 HGNC:18584 details
hsa-miR-3613-3p FNBP1 formin binding protein 1 HGNC:17069 details
hsa-miR-3613-3p ERGIC1 endoplasmic reticulum-golgi intermediate compartment 1 HGNC:29205 details
hsa-miR-3613-3p DCAF16 DDB1 and CUL4 associated factor 16 HGNC:25987 details
hsa-miR-3613-3p CLN8 CLN8 transmembrane ER and ERGIC protein HGNC:2079 details
hsa-miR-3613-3p CDC73 cell division cycle 73 HGNC:16783 details
hsa-miR-3613-3p C5orf51 chromosome 5 open reading frame 51 HGNC:27750 details
hsa-miR-3613-3p ADIPOR2 adiponectin receptor 2 HGNC:24041 details
hsa-miR-3613-3p TARDBP TAR DNA binding protein HGNC:11571 details
hsa-miR-3613-3p TBX20 T-box transcription factor 20 HGNC:11598 details
hsa-miR-3613-3p SLC39A9 solute carrier family 39 member 9 HGNC:20182 details
hsa-miR-3613-3p CERCAM cerebral endothelial cell adhesion molecule HGNC:23723 details
hsa-miR-3613-3p SPATS2 spermatogenesis associated serine rich 2 HGNC:18650 details
hsa-miR-3613-3p OLR1 oxidized low density lipoprotein receptor 1 HGNC:8133 details
hsa-miR-3613-3p PHF7 PHD finger protein 7 HGNC:18458 details
hsa-miR-3613-3p USF3 upstream transcription factor family member 3 HGNC:30494 details
hsa-miR-3613-3p SKA1 spindle and kinetochore associated complex subunit 1 HGNC:28109 details
hsa-miR-3613-3p LAMTOR1 late endosomal/lysosomal adaptor, MAPK and MTOR activator 1 HGNC:26068 details
hsa-miR-3613-3p KCNMB3 potassium calcium-activated channel subfamily M regulatory beta subunit 3 HGNC:6287 details
hsa-miR-3613-3p RHOA ras homolog family member A HGNC:667 details
hsa-miR-3613-3p RPF2 ribosome production factor 2 homolog HGNC:20870 details
hsa-miR-3613-3p KCNK5 potassium two pore domain channel subfamily K member 5 HGNC:6280 details
hsa-miR-3613-3p SYDE2 synapse defective Rho GTPase homolog 2 HGNC:25841 details
hsa-miR-3613-3p WIPF2 WAS/WASL interacting protein family member 2 HGNC:30923 details
hsa-miR-3613-3p PDP2 pyruvate dehyrogenase phosphatase catalytic subunit 2 HGNC:30263 details
hsa-miR-3613-3p FBXO31 F-box protein 31 HGNC:16510 details
hsa-miR-3613-3p ZBTB39 zinc finger and BTB domain containing 39 HGNC:29014 details
hsa-miR-3613-3p CENPH centromere protein H HGNC:17268 details
hsa-miR-3613-3p ADAMTS17 ADAM metallopeptidase with thrombospondin type 1 motif 17 HGNC:17109 details
hsa-miR-3613-3p ZNF394 zinc finger protein 394 HGNC:18832 details
hsa-miR-3613-3p TRIM66 tripartite motif containing 66 HGNC:29005 details
hsa-miR-3613-3p VGLL4 vestigial like family member 4 HGNC:28966 details
hsa-miR-3613-3p AP5M1 adaptor related protein complex 5 subunit mu 1 HGNC:20192 details
hsa-miR-3613-3p JAG1 jagged canonical Notch ligand 1 HGNC:6188 details
hsa-miR-3613-3p PPIP5K2 diphosphoinositol pentakisphosphate kinase 2 HGNC:29035 details
hsa-miR-3613-3p ZNF549 zinc finger protein 549 HGNC:26632 details
hsa-miR-3613-3p C11orf54 chromosome 11 open reading frame 54 HGNC:30204 details
hsa-miR-3613-3p MYOCD myocardin HGNC:16067 details
hsa-miR-3613-3p MAT1A methionine adenosyltransferase 1A HGNC:6903 details
hsa-miR-3613-3p BUB3 BUB3 mitotic checkpoint protein HGNC:1151 details
hsa-miR-3613-3p details
hsa-miR-3613-3p MPRIP myosin phosphatase Rho interacting protein HGNC:30321 details
hsa-miR-3613-3p AVL9 AVL9 cell migration associated HGNC:28994 details
hsa-miR-3613-3p TMED10 transmembrane p24 trafficking protein 10 HGNC:16998 details
hsa-miR-3613-3p SPIDR scaffold protein involved in DNA repair HGNC:28971 details
hsa-miR-3613-3p HRH4 histamine receptor H4 HGNC:17383 details
hsa-miR-3613-3p AGTRAP angiotensin II receptor associated protein HGNC:13539 details
hsa-miR-3613-3p GRK2 G protein-coupled receptor kinase 2 HGNC:289 details
hsa-miR-3613-3p LRRC58 leucine rich repeat containing 58 HGNC:26968 details
hsa-miR-3613-3p SECISBP2L SECIS binding protein 2 like HGNC:28997 details
hsa-miR-3613-3p UBE2D3 ubiquitin conjugating enzyme E2 D3 HGNC:12476 details
hsa-miR-3613-3p APOL6 apolipoprotein L6 HGNC:14870 details
hsa-miR-3613-3p ATP6V0A2 ATPase H+ transporting V0 subunit a2 HGNC:18481 details
hsa-miR-3613-3p ATP6V0E1 ATPase H+ transporting V0 subunit e1 HGNC:863 details
hsa-miR-3613-3p CAMK2N1 calcium/calmodulin dependent protein kinase II inhibitor 1 HGNC:24190 details
hsa-miR-3613-3p CAMLG calcium modulating ligand HGNC:1471 details
hsa-miR-3613-3p CAPZA1 capping actin protein of muscle Z-line subunit alpha 1 HGNC:1488 details
hsa-miR-3613-3p CARD8 caspase recruitment domain family member 8 HGNC:17057 details
hsa-miR-3613-3p CD47 CD47 molecule HGNC:1682 details
hsa-miR-3613-3p CD9 CD9 molecule HGNC:1709 details
hsa-miR-3613-3p CDK12 cyclin dependent kinase 12 HGNC:24224 details
hsa-miR-3613-3p CGNL1 cingulin like 1 HGNC:25931 details
hsa-miR-3613-3p CNNM3 cyclin and CBS domain divalent metal cation transport mediator 3 HGNC:104 details
hsa-miR-3613-3p DBNL drebrin like HGNC:2696 details
hsa-miR-3613-3p DPPA4 developmental pluripotency associated 4 HGNC:19200 details
hsa-miR-3613-3p DSC3 desmocollin 3 HGNC:3037 details
hsa-miR-3613-3p FAT3 FAT atypical cadherin 3 HGNC:23112 details
hsa-miR-3613-3p FBXO47 F-box protein 47 HGNC:31969 details
hsa-miR-3613-3p FEM1A fem-1 homolog A HGNC:16934 details
hsa-miR-3613-3p FKBP5 FKBP prolyl isomerase 5 HGNC:3721 details
hsa-miR-3613-3p GEMIN6 gem nuclear organelle associated protein 6 HGNC:20044 details
hsa-miR-3613-3p GPR37L1 G protein-coupled receptor 37 like 1 HGNC:14923 details
hsa-miR-3613-3p LRPAP1 LDL receptor related protein associated protein 1 HGNC:6701 details
hsa-miR-3613-3p NCBP3 nuclear cap binding subunit 3 HGNC:24612 details
hsa-miR-3613-3p OCIAD2 OCIA domain containing 2 HGNC:28685 details
hsa-miR-3613-3p PDF peptide deformylase, mitochondrial HGNC:30012 details
hsa-miR-3613-3p PDK3 pyruvate dehydrogenase kinase 3 HGNC:8811 details
hsa-miR-3613-3p POLM DNA polymerase mu HGNC:9185 details
hsa-miR-3613-3p PPFIBP1 PPFIA binding protein 1 HGNC:9249 details
hsa-miR-3613-3p PROSER3 proline and serine rich 3 HGNC:25204 details
hsa-miR-3613-3p SCYL3 SCY1 like pseudokinase 3 HGNC:19285 details
hsa-miR-3613-3p SFXN1 sideroflexin 1 HGNC:16085 details
hsa-miR-3613-3p SKP2 S-phase kinase associated protein 2 HGNC:10901 details
hsa-miR-3613-3p SPC24 SPC24 component of NDC80 kinetochore complex HGNC:26913 details
hsa-miR-3613-3p TAF13 TATA-box binding protein associated factor 13 HGNC:11546 details
hsa-miR-3613-3p TMEM65 transmembrane protein 65 HGNC:25203 details
hsa-miR-3613-3p TNFRSF9 TNF receptor superfamily member 9 HGNC:11924 details
hsa-miR-3613-3p TSPEAR-AS2 TSPEAR antisense RNA 2 HGNC:16428 details
hsa-miR-3613-3p WDFY1 WD repeat and FYVE domain containing 1 HGNC:20451 details
hsa-miR-3613-3p WDR12 WD repeat domain 12 HGNC:14098 details
hsa-miR-3613-3p WDR76 WD repeat domain 76 HGNC:25773 details
hsa-miR-3613-3p WT1 WT1 transcription factor HGNC:12796 details
hsa-miR-3613-3p ZNF124 zinc finger protein 124 HGNC:12907 details
hsa-miR-3613-3p ZNF157 zinc finger protein 157 HGNC:12942 details
hsa-miR-3613-3p ZNF317 zinc finger protein 317 HGNC:13507 details
hsa-miR-3613-3p ZNF451 zinc finger protein 451 HGNC:21091 details
hsa-miR-3613-3p ZNF487 zinc finger protein 487 HGNC:23488 details
hsa-miR-3613-3p FUT11 fucosyltransferase 11 HGNC:19233 details
hsa-miR-3613-3p GNPTAB N-acetylglucosamine-1-phosphate transferase subunits alpha and beta HGNC:29670 details
hsa-miR-3613-3p KLHL11 kelch like family member 11 HGNC:19008 details
hsa-miR-3613-3p NDRG4 NDRG family member 4 HGNC:14466 details
hsa-miR-3613-3p ZNF284 zinc finger protein 284 HGNC:13078 details
© 2021 Arieh Warshel Institute of Computational Biology, CUHK(SZ) | Designed by : Biomics Lab