miRNA Card

miRNA General Information
miRNA ID hsa-miR-3646
Description Homo sapiens miR-3646 stem-loop
Comment None
Experiment 454 [1]
Sequence AAAAUGAAAUGAGCCCAGCCCA
miRNA Expression in different cancers

    by mir_boxplot.py

circRNA-miRNA-gene regulatory network

Note about Netwrok:
This is a network diagram with miRNA (purple circle) as the center.
We used three tools(PITA, miRanda, targetScan) to predict the binding sites of circrna (green circle) and miRNA. Accordingly, for this miRNA that binds to circrna, we have three confidence levels, namely confident 1, confident 2 and confident 3. Confidence value indicates how many tools can deduce these results. For each confidence, we use different kinds of dashed lines.

Target circRNA with confidence

Confidence 3 (3 of 3 tools predicted)

CircID miRNA PITA miRanda targetScan
chr2:86147702|86151520 hsa-miR-3646 1 1 1
chr1:114569992|114581391 hsa-miR-3646 1 1 1

Confidence 1 (1 of 3 tools predicted)

CircID miRNA PITA miRanda targetScan
chr19:1925507|1925625 hsa-miR-3646 1 0 0
chr5:173316083|173316233 hsa-miR-3646 1 0 0
chr16:642835|642987 hsa-miR-3646 1 0 0
chr5:172768650|172768867 hsa-miR-3646 1 0 0
chr9:71684018|71684130 hsa-miR-3646 1 0 0
chrX:119617745|119617849 hsa-miR-3646 0 1 0
chr3:38141922|38142061 hsa-miR-3646 0 1 0
chr17:63824084|63824202 hsa-miR-3646 0 1 0
chr3:38141922|38142025 hsa-miR-3646 0 1 0
chr1:23030536|23044463 hsa-miR-3646 0 1 0
chr3:38141922|38142084 hsa-miR-3646 0 1 0
chr17:74771832|74772264 hsa-miR-3646 0 1 0
chr11:9732604|9732710 hsa-miR-3646 0 1 0
chr1:184477386|184477603 hsa-miR-3646 0 1 0
chr17:63488773|63489044 hsa-miR-3646 0 1 0
chr22:38673198|38673374 hsa-miR-3646 0 1 0
chr15:48432866|48432988 hsa-miR-3646 0 1 0
chr7:100063836|100063979 hsa-miR-3646 0 1 0
chr17:63824084|63824223 hsa-miR-3646 0 1 0
chr18:54381365|54381428 hsa-miR-3646 0 1 0
chr12:113009258|113009380 hsa-miR-3646 0 1 0
chr19:19334530|19334727 hsa-miR-3646 0 1 0
chr12:113009261|113009421 hsa-miR-3646 0 1 0
chr17:63824101|63824160 hsa-miR-3646 0 1 0
chr7:96688821|96688887 hsa-miR-3646 1 0 0
chr5:134146227|134146411 hsa-miR-3646 1 0 0
chr1:51271776|51271923 hsa-miR-3646 1 0 0
chr14:20455933|20456101 hsa-miR-3646 1 0 0
chr9:120764357|120764460 hsa-miR-3646 1 0 0
chr11:34480687|34480819 hsa-miR-3646 1 0 0
chr5:97034541|97034671 hsa-miR-3646 1 0 0
chr18:63123745|63123856 hsa-miR-3646 1 0 0
chr18:63123761|63123856 hsa-miR-3646 1 0 0
chr10:133464358|133464415 hsa-miR-3646 1 0 0
chr19:56494686|56495038 hsa-miR-3646 1 0 0
chr3:19984383|19984608 hsa-miR-3646 0 1 0
chr3:38141922|38142048 hsa-miR-3646 0 1 0
chr11:57551932|57552056 hsa-miR-3646 0 1 0
chr1:16395436|16395560 hsa-miR-3646 0 1 0
chr2:241075769|241076030 hsa-miR-3646 0 1 0
chr2:55867020|55867130 hsa-miR-3646 0 1 0
chr17:63824084|63824205 hsa-miR-3646 0 1 0
chr12:15903093|15903200 hsa-miR-3646 0 1 0
chr6:36685920|36686072 hsa-miR-3646 0 1 0
chr3:160431689|160431812 hsa-miR-3646 0 1 0
chr12:103947406|103947751 hsa-miR-3646 0 1 0
chr17:63823880|63824142 hsa-miR-3646 0 1 0
chr3:38141922|38142165 hsa-miR-3646 0 1 0
chr3:194136651|194137703 hsa-miR-3646 0 1 0
chr12:120444010|120444120 hsa-miR-3646 0 1 0
chr1:203741437|203741551 hsa-miR-3646 0 1 0
chr5:179884602|179884830 hsa-miR-3646 0 1 0
chr6:75237854|75237984 hsa-miR-3646 0 1 0
chr6:36685990|36686214 hsa-miR-3646 0 1 0
chr22:29800991|29801110 hsa-miR-3646 0 1 0
chr5:151663078|151663206 hsa-miR-3646 0 1 0
chr1:108638374|108638584 hsa-miR-3646 0 1 0
chr20:3875610|3875824 hsa-miR-3646 0 1 0
chrX:119617745|119617831 hsa-miR-3646 0 1 0
chr9:12775198|12775311 hsa-miR-3646 0 1 0
chr8:102253074~102253219 hsa-miR-3646 0 1 0
chr22:28796070|28796192 hsa-miR-3646 0 1 0
chr10:46014910~46015230 hsa-miR-3646 0 1 0
chr17:63823880~63824151 hsa-miR-3646 0 1 0
chr16:1362672~1362906 hsa-miR-3646 0 1 0
chr1:184477386~184477603 hsa-miR-3646 0 1 0
chr3:38141922~38142025 hsa-miR-3646 0 1 0
chr12:26340167~26340270 hsa-miR-3646 0 1 0
chr8:143613557~143613805 hsa-miR-3646 0 1 0
chr3:38141922~38142165 hsa-miR-3646 0 1 0
chr22:46347466~46347598 hsa-miR-3646 0 1 0
chr11:57551932~57552105 hsa-miR-3646 0 1 0
chr12:103947361~103947751 hsa-miR-3646 0 1 0
chr7:23523714~23523878 hsa-miR-3646 0 1 0
chr5:81229584~81229793 hsa-miR-3646 0 1 0
chr12:15903030~15903176 hsa-miR-3646 0 1 0
chr18:6311554~6312056 hsa-miR-3646 0 1 0
chr5:93554973~93563460 hsa-miR-3646 0 1 0
chrX:119617745~119617891 hsa-miR-3646 0 1 0
chr19:973952|974086 hsa-miR-3646 0 1 0
chr1:184477531~184507616 hsa-miR-3646 0 1 0
chr22:29800991~29801108 hsa-miR-3646 0 1 0
chr17:63824101|63824202 hsa-miR-3646 0 1 0
chr3:38141922~38142048 hsa-miR-3646 0 1 0
chr6:52400953|52401127 hsa-miR-3646 1 0 0
chr19:1071796|1071934 hsa-miR-3646 1 0 0
chr3:196653711|196653893 hsa-miR-3646 1 0 0
chr17:42302456|42302696 hsa-miR-3646 1 0 0
chr16:89316933|89317075 hsa-miR-3646 1 0 0
chr16:85801256|85801379 hsa-miR-3646 0 1 0
chr10:74118660|74118774 hsa-miR-3646 0 1 0
chr17:63488689|63489002 hsa-miR-3646 0 1 0
chr3:172397323|172397492 hsa-miR-3646 0 1 0
chr7:36250845|36251006 hsa-miR-3646 0 1 0
chr20:50081834|50081972 hsa-miR-3646 0 1 0
chr15:90962153|90962329 hsa-miR-3646 0 1 0
chr20:20512683|20512826 hsa-miR-3646 0 1 0
chr15:63593971|63594142 hsa-miR-3646 0 1 0
chr10:102398444|102398823 hsa-miR-3646 1 0 0
chr15:77045455|77045638 hsa-miR-3646 1 0 0
chr11:10460711|10460857 hsa-miR-3646 1 0 0
chr19:1925505|1925708 hsa-miR-3646 1 0 0
chr3:32482564|32482791 hsa-miR-3646 1 0 0
chr18:80045919|80046058 hsa-miR-3646 1 0 0
chr16:11176646|11176833 hsa-miR-3646 1 0 0
chr10:102398497|102398823 hsa-miR-3646 1 0 0
chr10:30027423|30027558 hsa-miR-3646 1 0 0
chr19:1925505|1925625 hsa-miR-3646 1 0 0
chr11:852062|852213 hsa-miR-3646 1 0 0
chr10:27116219|27116319 hsa-miR-3646 1 0 0
chr1:114730305|114730549 hsa-miR-3646 0 1 0
chr15:99134344|99134592 hsa-miR-3646 0 1 0
chr12:103947370|103947751 hsa-miR-3646 0 1 0
chr1:21217345|21217500 hsa-miR-3646 0 1 0
chr22:31206562|31206689 hsa-miR-3646 0 1 0
chr19:8262886|8262998 hsa-miR-3646 0 1 0
chr4:75804157|75805160 hsa-miR-3646 0 1 0
chrX:119617745|119617846 hsa-miR-3646 0 1 0
chr11:57551932|57552054 hsa-miR-3646 0 1 0
chr1:235447820|235447952 hsa-miR-3646 0 1 0
chr10:117283261|117283378 hsa-miR-3646 0 1 0
chr17:4897698|4897867 hsa-miR-3646 0 1 0
chr8:37754178|37754299 hsa-miR-3646 0 1 0
chr17:46941308|46941499 hsa-miR-3646 0 1 0
chr12:1928336|1928522 hsa-miR-3646 0 1 0
chr20:46686918|46687043 hsa-miR-3646 0 1 0
chr3:194686363|194686458 hsa-miR-3646 0 1 0
chr12:103947568|103947751 hsa-miR-3646 0 1 0
chr3:160431674|160431812 hsa-miR-3646 0 1 0
chr13:46751844|46752026 hsa-miR-3646 0 1 0
chr1:108638398|108638584 hsa-miR-3646 0 1 0
chr9:128592714|128593031 hsa-miR-3646 0 1 0
chr19:8262871|8262998 hsa-miR-3646 0 1 0
chr22:41905042|41905149 hsa-miR-3646 0 1 0
chr1:203741387|203741542 hsa-miR-3646 0 1 0
chr11:95133708|95133834 hsa-miR-3646 0 1 0
chr17:63823848|63824142 hsa-miR-3646 0 1 0
chr5:37392017|37392120 hsa-miR-3646 0 1 0
chr16:4743576|4743713 hsa-miR-3646 0 1 0
chr5:141512270|141512457 hsa-miR-3646 0 1 0
chr1:203741387|203741551 hsa-miR-3646 0 1 0
chr15:89908280|89910819 hsa-miR-3646 0 1 0
chrX:53614534|53614745 hsa-miR-3646 0 1 0
chr15:85684741|85710645 hsa-miR-3646 0 1 0
chrX:53614534|53615835 hsa-miR-3646 0 1 0
chr14:20395450|20395949 hsa-miR-3646 0 1 0
chr9:112472229|112472354 hsa-miR-3646 0 1 0
chr2:201129660|201129839 hsa-miR-3646 0 1 0
chr15:89908311|89908412 hsa-miR-3646 0 1 0
chr19:41324265|41324416 hsa-miR-3646 0 1 0
chr11:57551932|57552052 hsa-miR-3646 0 1 0
chr12:15903069|15903207 hsa-miR-3646 0 1 0
chr3:38141889|38142061 hsa-miR-3646 0 1 0
chr7:105090194|105090273 hsa-miR-3646 0 1 0
chr17:63824084|63824213 hsa-miR-3646 0 1 0
chr10:3777106|3777412 hsa-miR-3646 0 1 0
chr13:113179690|113179934 hsa-miR-3646 0 1 0
chr5:141512368|141512457 hsa-miR-3646 0 1 0
chr12:103947368|103947751 hsa-miR-3646 0 1 0
chr16:4346614|4346807 hsa-miR-3646 0 1 0
chr12:103947361|103947751 hsa-miR-3646 0 1 0
chr5:37392031|37396403 hsa-miR-3646 0 1 0
chr12:113009302|113009421 hsa-miR-3646 0 1 0
chr12:15903079|15903207 hsa-miR-3646 0 1 0
chr10:117283261|117283404 hsa-miR-3646 0 1 0
chr11:57551950|57552202 hsa-miR-3646 0 1 0
chr3:194136649|194137008 hsa-miR-3646 0 1 0
chr16:11981264|11981473 hsa-miR-3646 0 1 0
chr1:1785423|1785664 hsa-miR-3646 0 1 0
chr17:81698153|81698305 hsa-miR-3646 0 1 0
chr22:28796167|28797168 hsa-miR-3646 0 1 0
chr22:29800991|29801108 hsa-miR-3646 0 1 0
chr12:103947358|103947751 hsa-miR-3646 -12 1 0
chr1:32758816|32758927 hsa-miR-3646 -6 1 0
chr1:21217278|21217545 hsa-miR-3646 -11 1 0
chr11:67285089|67285329 hsa-miR-3646 -2 1 0
chr17:63824101|63824219 hsa-miR-3646 0 1 0
chr22:24540515|24540720 hsa-miR-3646 0 1 0
chr17:2059451|2059611 hsa-miR-3646 1 0 0
chr19:46610238|46610468 hsa-miR-3646 1 0 0
chrX:41348547|41348727 hsa-miR-3646 1 0 0
chr10:102398464|102398844 hsa-miR-3646 1 0 0
chr16:11176636|11176833 hsa-miR-3646 1 0 0
chr18:80045919|80046088 hsa-miR-3646 1 0 0
chr12:53068908|53069164 hsa-miR-3646 1 0 0
chr17:7560935|7561101 hsa-miR-3646 1 0 0
chr15:43531223|43531377 hsa-miR-3646 1 0 0
chr15:72735686|72735824 hsa-miR-3646 1 0 0
chr1:25832590|25832787 hsa-miR-3646 1 0 0
chr12:103947356|103947734 hsa-miR-3646 0 1 0
chr1:108638341|108638584 hsa-miR-3646 0 1 0
chr1:37489163|37489312 hsa-miR-3646 0 1 0
chr17:42843331|42843478 hsa-miR-3646 0 1 0
chr7:73611970|73612067 hsa-miR-3646 0 1 0
chr14:20455667|20455803 hsa-miR-3646 0 1 0
chr12:15903027|15903176 hsa-miR-3646 0 1 0
chr17:38729059|38729221 hsa-miR-3646 0 1 0
chr22:31280955|31281022 hsa-miR-3646 0 1 0
chr11:118264266|118264505 hsa-miR-3646 0 1 0
chrX:24077344|24077439 hsa-miR-3646 0 1 0
chr1:33012457|33012611 hsa-miR-3646 0 1 0
chr5:141939443|141939563 hsa-miR-3646 0 1 0
chr6:75237797|75237928 hsa-miR-3646 0 1 0
chr1:1234063|1234190 hsa-miR-3646 0 1 0
chr17:63823880|63824148 hsa-miR-3646 0 1 0
chr3:45678978|45679063 hsa-miR-3646 0 1 0
chr4:154586650|154586843 hsa-miR-3646 0 1 0
chr11:114313729|114313925 hsa-miR-3646 0 1 0
chr22:37612864|37613091 hsa-miR-3646 0 1 0
chr1:180111609|180111795 hsa-miR-3646 0 1 0
chr11:134472599|134472697 hsa-miR-3646 0 1 0
chr11:117287769|117287927 hsa-miR-3646 0 1 0
chr11:95133739|95133862 hsa-miR-3646 0 1 0
chr10:117283261|117283448 hsa-miR-3646 0 1 0
chr12:15903037|15903176 hsa-miR-3646 0 1 0
chr4:75804134|75804217 hsa-miR-3646 0 1 0
chr17:49600177|49600306 hsa-miR-3646 0 1 0
chr14:64167255|64167387 hsa-miR-3646 0 1 0
chr9:22008926|22009088 hsa-miR-3646 0 1 0
chr1:26123615|26123718 hsa-miR-3646 0 1 0
chr3:58667778|58667861 hsa-miR-3646 0 1 0
chr10:117283261|117283399 hsa-miR-3646 0 1 0
chr6:36352487|36352590 hsa-miR-3646 1 0 0
chr2:169811183|169811314 hsa-miR-3646 1 0 0
chr1:202068357|202068522 hsa-miR-3646 1 0 0
chr10:102658015|102658159 hsa-miR-3646 1 0 0
chr9:127941779|127941944 hsa-miR-3646 1 0 0
chr15:43531244|43531377 hsa-miR-3646 1 0 0
chr20:3121384|3121537 hsa-miR-3646 1 0 0
chr3:197002204|197002344 hsa-miR-3646 1 0 0
chr2:7041522|7041625 hsa-miR-3646 1 0 0
chr22:21448372|21448546 hsa-miR-3646 1 0 0
Target genes
miRNA Gene Gene Description HGNC ID details
hsa-miR-3646 CIT citron rho-interacting serine/threonine kinase HGNC:1985 details
hsa-miR-3646 RFX3 regulatory factor X3 HGNC:9984 details
hsa-miR-3646 FAM217B family with sequence similarity 217 member B HGNC:16170 details
hsa-miR-3646 UBE2Q1 ubiquitin conjugating enzyme E2 Q1 HGNC:15698 details
hsa-miR-3646 NUDT12 nudix hydrolase 12 HGNC:18826 details
hsa-miR-3646 CEP170 centrosomal protein 170 HGNC:28920 details
hsa-miR-3646 CERKL ceramide kinase like HGNC:21699 details
hsa-miR-3646 RBL1 RB transcriptional corepressor like 1 HGNC:9893 details
hsa-miR-3646 PGK1 phosphoglycerate kinase 1 HGNC:8896 details
hsa-miR-3646 ENTPD7 ectonucleoside triphosphate diphosphohydrolase 7 HGNC:19745 details
hsa-miR-3646 NUDT21 nudix hydrolase 21 HGNC:13870 details
hsa-miR-3646 LLPH LLP homolog, long-term synaptic facilitation factor HGNC:28229 details
hsa-miR-3646 SH3GLB1 SH3 domain containing GRB2 like, endophilin B1 HGNC:10833 details
hsa-miR-3646 FEM1C fem-1 homolog C HGNC:16933 details
hsa-miR-3646 SMIM19 small integral membrane protein 19 HGNC:25166 details
hsa-miR-3646 SLC44A1 solute carrier family 44 member 1 HGNC:18798 details
hsa-miR-3646 POU2F1 POU class 2 homeobox 1 HGNC:9212 details
hsa-miR-3646 ZNF34 zinc finger protein 34 HGNC:13098 details
hsa-miR-3646 CCT2 chaperonin containing TCP1 subunit 2 HGNC:1615 details
hsa-miR-3646 C20orf27 chromosome 20 open reading frame 27 HGNC:15873 details
hsa-miR-3646 VEGFA vascular endothelial growth factor A HGNC:12680 details
hsa-miR-3646 UBE2N ubiquitin conjugating enzyme E2 N HGNC:12492 details
hsa-miR-3646 TTC39C tetratricopeptide repeat domain 39C HGNC:26595 details
hsa-miR-3646 TRMT5 tRNA methyltransferase 5 HGNC:23141 details
hsa-miR-3646 TDG thymine DNA glycosylase HGNC:11700 details
hsa-miR-3646 STX16 syntaxin 16 HGNC:11431 details
hsa-miR-3646 SPRY4 sprouty RTK signaling antagonist 4 HGNC:15533 details
hsa-miR-3646 SPATA2 spermatogenesis associated 2 HGNC:14681 details
hsa-miR-3646 SLC20A1 solute carrier family 20 member 1 HGNC:10946 details
hsa-miR-3646 SGK1 serum/glucocorticoid regulated kinase 1 HGNC:10810 details
hsa-miR-3646 SET SET nuclear proto-oncogene HGNC:10760 details
hsa-miR-3646 PTPN14 protein tyrosine phosphatase non-receptor type 14 HGNC:9647 details
hsa-miR-3646 PPP1CC protein phosphatase 1 catalytic subunit gamma HGNC:9283 details
hsa-miR-3646 PDIA6 protein disulfide isomerase family A member 6 HGNC:30168 details
hsa-miR-3646 TSPAN1 tetraspanin 1 HGNC:20657 details
hsa-miR-3646 NAPG NSF attachment protein gamma HGNC:7642 details
hsa-miR-3646 EDEM3 ER degradation enhancing alpha-mannosidase like protein 3 HGNC:16787 details
hsa-miR-3646 WDR82P1 WD repeat domain 82 pseudogene 1 HGNC:32447 details
hsa-miR-3646 BZW1 basic leucine zipper and W2 domains 1 HGNC:18380 details
hsa-miR-3646 ZDHHC20 zinc finger DHHC-type palmitoyltransferase 20 HGNC:20749 details
hsa-miR-3646 UGCG UDP-glucose ceramide glucosyltransferase HGNC:12524 details
hsa-miR-3646 RAPGEF1 Rap guanine nucleotide exchange factor 1 HGNC:4568 details
hsa-miR-3646 FRS2 fibroblast growth factor receptor substrate 2 HGNC:16971 details
hsa-miR-3646 PDIK1L PDLIM1 interacting kinase 1 like HGNC:18981 details
hsa-miR-3646 ABHD17B abhydrolase domain containing 17B, depalmitoylase HGNC:24278 details
hsa-miR-3646 SOD2 superoxide dismutase 2 HGNC:11180 details
hsa-miR-3646 NBPF11 NBPF member 11 HGNC:31993 details
hsa-miR-3646 ZMAT3 zinc finger matrin-type 3 HGNC:29983 details
hsa-miR-3646 ZCCHC3 zinc finger CCHC-type containing 3 HGNC:16230 details
hsa-miR-3646 PRICKLE2 prickle planar cell polarity protein 2 HGNC:20340 details
hsa-miR-3646 MAP7 microtubule associated protein 7 HGNC:6869 details
hsa-miR-3646 KMT2D lysine methyltransferase 2D HGNC:7133 details
hsa-miR-3646 IGSF3 immunoglobulin superfamily member 3 HGNC:5950 details
hsa-miR-3646 HSPA4L heat shock protein family A (Hsp70) member 4 like HGNC:17041 details
hsa-miR-3646 G3BP2 G3BP stress granule assembly factor 2 HGNC:30291 details
hsa-miR-3646 E2F6 E2F transcription factor 6 HGNC:3120 details
hsa-miR-3646 CELF1 CUGBP Elav-like family member 1 HGNC:2549 details
hsa-miR-3646 SEH1L SEH1 like nucleoporin HGNC:30379 details
hsa-miR-3646 TMOD3 tropomodulin 3 HGNC:11873 details
hsa-miR-3646 COIL coilin HGNC:2184 details
hsa-miR-3646 COPS8 COP9 signalosome subunit 8 HGNC:24335 details
hsa-miR-3646 LRP6 LDL receptor related protein 6 HGNC:6698 details
hsa-miR-3646 SLC39A10 solute carrier family 39 member 10 HGNC:20861 details
hsa-miR-3646 KHSRP KH-type splicing regulatory protein HGNC:6316 details
hsa-miR-3646 HOXA10 homeobox A10 HGNC:5100 details
hsa-miR-3646 details
hsa-miR-3646 CALR calreticulin HGNC:1455 details
hsa-miR-3646 PPP2CA protein phosphatase 2 catalytic subunit alpha HGNC:9299 details
hsa-miR-3646 ADAMTS4 ADAM metallopeptidase with thrombospondin type 1 motif 4 HGNC:220 details
hsa-miR-3646 TYW5 tRNA-yW synthesizing protein 5 HGNC:26754 details
hsa-miR-3646 details
hsa-miR-3646 details
hsa-miR-3646 PSAT1 phosphoserine aminotransferase 1 HGNC:19129 details
hsa-miR-3646 PNISR PNN interacting serine and arginine rich protein HGNC:21222 details
hsa-miR-3646 TOGARAM2 TOG array regulator of axonemal microtubules 2 HGNC:33715 details
hsa-miR-3646 DYNLT1 dynein light chain Tctex-type 1 HGNC:11697 details
hsa-miR-3646 FRK fyn related Src family tyrosine kinase HGNC:3955 details
hsa-miR-3646 TUBGCP4 tubulin gamma complex associated protein 4 HGNC:16691 details
hsa-miR-3646 CENPK centromere protein K HGNC:29479 details
hsa-miR-3646 C4orf17 chromosome 4 open reading frame 17 HGNC:25274 details
hsa-miR-3646 BDP1 B double prime 1, subunit of RNA polymerase III transcription initiation factor IIIB HGNC:13652 details
hsa-miR-3646 PATE2 prostate and testis expressed 2 HGNC:32249 details
hsa-miR-3646 ZSCAN16 zinc finger and SCAN domain containing 16 HGNC:20813 details
hsa-miR-3646 SERINC1 serine incorporator 1 HGNC:13464 details
hsa-miR-3646 TRIM72 tripartite motif containing 72 HGNC:32671 details
hsa-miR-3646 NKIRAS2 NFKB inhibitor interacting Ras like 2 HGNC:17898 details
hsa-miR-3646 SEMA3D semaphorin 3D HGNC:10726 details
hsa-miR-3646 CLDN11 claudin 11 HGNC:8514 details
hsa-miR-3646 WASL WASP like actin nucleation promoting factor HGNC:12735 details
hsa-miR-3646 INIP INTS3 and NABP interacting protein HGNC:24994 details
hsa-miR-3646 IGF1R insulin like growth factor 1 receptor HGNC:5465 details
hsa-miR-3646 FOXK2 forkhead box K2 HGNC:6036 details
hsa-miR-3646 ATXN7L1 ataxin 7 like 1 HGNC:22210 details
hsa-miR-3646 SKA2 spindle and kinetochore associated complex subunit 2 HGNC:28006 details
hsa-miR-3646 FICD FIC domain protein adenylyltransferase HGNC:18416 details
hsa-miR-3646 details
hsa-miR-3646 YY2 YY2 transcription factor HGNC:31684 details
hsa-miR-3646 MYBPC1 myosin binding protein C1 HGNC:7549 details
hsa-miR-3646 EGLN1 egl-9 family hypoxia inducible factor 1 HGNC:1232 details
hsa-miR-3646 CSDE1 cold shock domain containing E1 HGNC:29905 details
hsa-miR-3646 MFF mitochondrial fission factor HGNC:24858 details
hsa-miR-3646 LIN7C lin-7 homolog C, crumbs cell polarity complex component HGNC:17789 details
hsa-miR-3646 SYNM synemin HGNC:24466 details
hsa-miR-3646 SNX5 sorting nexin 5 HGNC:14969 details
hsa-miR-3646 RORA RAR related orphan receptor A HGNC:10258 details
hsa-miR-3646 RLIM ring finger protein, LIM domain interacting HGNC:13429 details
hsa-miR-3646 RAP2C RAP2C, member of RAS oncogene family HGNC:21165 details
hsa-miR-3646 PANK1 pantothenate kinase 1 HGNC:8598 details
hsa-miR-3646 NPTN neuroplastin HGNC:17867 details
hsa-miR-3646 NETO2 neuropilin and tolloid like 2 HGNC:14644 details
hsa-miR-3646 MOB1A MOB kinase activator 1A HGNC:16015 details
hsa-miR-3646 details
hsa-miR-3646 CCDC6 coiled-coil domain containing 6 HGNC:18782 details
hsa-miR-3646 ABHD2 abhydrolase domain containing 2, acylglycerol lipase HGNC:18717 details
hsa-miR-3646 ECHDC1 ethylmalonyl-CoA decarboxylase 1 HGNC:21489 details
hsa-miR-3646 TSNAX translin associated factor X HGNC:12380 details
hsa-miR-3646 CD46 CD46 molecule HGNC:6953 details
hsa-miR-3646 BBS5 Bardet-Biedl syndrome 5 HGNC:970 details
hsa-miR-3646 ASB16 ankyrin repeat and SOCS box containing 16 HGNC:19768 details
hsa-miR-3646 PNPO pyridoxamine 5'-phosphate oxidase HGNC:30260 details
hsa-miR-3646 TNRC6A trinucleotide repeat containing adaptor 6A HGNC:11969 details
hsa-miR-3646 TMEM167A transmembrane protein 167A HGNC:28330 details
hsa-miR-3646 PAFAH1B2 platelet activating factor acetylhydrolase 1b catalytic subunit 2 HGNC:8575 details
hsa-miR-3646 GOSR1 golgi SNAP receptor complex member 1 HGNC:4430 details
hsa-miR-3646 GNPTAB N-acetylglucosamine-1-phosphate transferase subunits alpha and beta HGNC:29670 details
hsa-miR-3646 ETS2 ETS proto-oncogene 2, transcription factor HGNC:3489 details
hsa-miR-3646 ESCO2 establishment of sister chromatid cohesion N-acetyltransferase 2 HGNC:27230 details
hsa-miR-3646 DEPDC1 DEP domain containing 1 HGNC:22949 details
hsa-miR-3646 DDHD2 DDHD domain containing 2 HGNC:29106 details
hsa-miR-3646 BAMBI BMP and activin membrane bound inhibitor HGNC:30251 details
hsa-miR-3646 ARL8A ADP ribosylation factor like GTPase 8A HGNC:25192 details
hsa-miR-3646 OSBPL3 oxysterol binding protein like 3 HGNC:16370 details
hsa-miR-3646 CLEC2D C-type lectin domain family 2 member D HGNC:14351 details
hsa-miR-3646 ELOA elongin A HGNC:11620 details
hsa-miR-3646 PMAIP1 phorbol-12-myristate-13-acetate-induced protein 1 HGNC:9108 details
hsa-miR-3646 PAWR pro-apoptotic WT1 regulator HGNC:8614 details
hsa-miR-3646 NUFIP2 nuclear FMR1 interacting protein 2 HGNC:17634 details
hsa-miR-3646 KPNA6 karyopherin subunit alpha 6 HGNC:6399 details
hsa-miR-3646 KIAA0895 KIAA0895 HGNC:22206 details
hsa-miR-3646 IGFBP5 insulin like growth factor binding protein 5 HGNC:5474 details
hsa-miR-3646 ID4 inhibitor of DNA binding 4, HLH protein HGNC:5363 details
hsa-miR-3646 ERI2 ERI1 exoribonuclease family member 2 HGNC:30541 details
hsa-miR-3646 QRFPR pyroglutamylated RFamide peptide receptor HGNC:15565 details
hsa-miR-3646 SLFN11 schlafen family member 11 HGNC:26633 details
hsa-miR-3646 ZDHHC7 zinc finger DHHC-type palmitoyltransferase 7 HGNC:18459 details
hsa-miR-3646 TRA2B transformer 2 beta homolog HGNC:10781 details
hsa-miR-3646 RHOA ras homolog family member A HGNC:667 details
hsa-miR-3646 KCNJ2 potassium inwardly rectifying channel subfamily J member 2 HGNC:6263 details
hsa-miR-3646 ABHD17C abhydrolase domain containing 17C, depalmitoylase HGNC:26925 details
hsa-miR-3646 ZNF662 zinc finger protein 662 HGNC:31930 details
hsa-miR-3646 MTRNR2L11 MT-RNR2 like 11 HGNC:37168 details
hsa-miR-3646 TFDP1 transcription factor Dp-1 HGNC:11749 details
hsa-miR-3646 RNF103-CHMP3 RNF103-CHMP3 readthrough HGNC:38847 details
hsa-miR-3646 CHMP3 charged multivesicular body protein 3 HGNC:29865 details
hsa-miR-3646 RANBP1 RAN binding protein 1 HGNC:9847 details
hsa-miR-3646 DDX21 DExD-box helicase 21 HGNC:2744 details
hsa-miR-3646 RABGEF1 RAB guanine nucleotide exchange factor 1 HGNC:17676 details
hsa-miR-3646 ARF6 ADP ribosylation factor 6 HGNC:659 details
hsa-miR-3646 EID1 EP300 interacting inhibitor of differentiation 1 HGNC:1191 details
hsa-miR-3646 TPGS2 tubulin polyglutamylase complex subunit 2 HGNC:24561 details
hsa-miR-3646 ARPC1B actin related protein 2/3 complex subunit 1B HGNC:704 details
hsa-miR-3646 LYRM7 LYR motif containing 7 HGNC:28072 details
hsa-miR-3646 SKIL SKI like proto-oncogene HGNC:10897 details
hsa-miR-3646 GTF2I general transcription factor IIi HGNC:4659 details
hsa-miR-3646 ZNF800 zinc finger protein 800 HGNC:27267 details
hsa-miR-3646 DNAAF3 dynein axonemal assembly factor 3 HGNC:30492 details
hsa-miR-3646 TMEM220 transmembrane protein 220 HGNC:33757 details
hsa-miR-3646 SH3TC2 SH3 domain and tetratricopeptide repeats 2 HGNC:29427 details
hsa-miR-3646 UGT8 UDP glycosyltransferase 8 HGNC:12555 details
hsa-miR-3646 MYOCD myocardin HGNC:16067 details
hsa-miR-3646 FXR1 FMR1 autosomal homolog 1 HGNC:4023 details
hsa-miR-3646 KCTD12 potassium channel tetramerization domain containing 12 HGNC:14678 details
hsa-miR-3646 ATF6B activating transcription factor 6 beta HGNC:2349 details
hsa-miR-3646 MAP3K1 mitogen-activated protein kinase kinase kinase 1 HGNC:6848 details
hsa-miR-3646 CSE1L chromosome segregation 1 like HGNC:2431 details
hsa-miR-3646 ARL3 ADP ribosylation factor like GTPase 3 HGNC:694 details
hsa-miR-3646 MRRF mitochondrial ribosome recycling factor HGNC:7234 details
hsa-miR-3646 GTF3C4 general transcription factor IIIC subunit 4 HGNC:4667 details
hsa-miR-3646 MKI67 marker of proliferation Ki-67 HGNC:7107 details
hsa-miR-3646 ATAT1 alpha tubulin acetyltransferase 1 HGNC:21186 details
hsa-miR-3646 PDE4D phosphodiesterase 4D HGNC:8783 details
hsa-miR-3646 MYO1B myosin IB HGNC:7596 details
hsa-miR-3646 MINK1 misshapen like kinase 1 HGNC:17565 details
hsa-miR-3646 CRAMP1 cramped chromatin regulator homolog 1 HGNC:14122 details
hsa-miR-3646 SELENOI selenoprotein I HGNC:29361 details
hsa-miR-3646 CAPZA1 capping actin protein of muscle Z-line subunit alpha 1 HGNC:1488 details
hsa-miR-3646 ADAM9 ADAM metallopeptidase domain 9 HGNC:216 details
hsa-miR-3646 MAPK6 mitogen-activated protein kinase 6 HGNC:6879 details
hsa-miR-3646 DYRK3 dual specificity tyrosine phosphorylation regulated kinase 3 HGNC:3094 details
hsa-miR-3646 LMBR1 limb development membrane protein 1 HGNC:13243 details
hsa-miR-3646 APP amyloid beta precursor protein HGNC:620 details
hsa-miR-3646 GLUD2 glutamate dehydrogenase 2 HGNC:4336 details
hsa-miR-3646 GABRB1 gamma-aminobutyric acid type A receptor subunit beta1 HGNC:4081 details
hsa-miR-3646 SYNJ2BP synaptojanin 2 binding protein HGNC:18955 details
hsa-miR-3646 GPBP1 GC-rich promoter binding protein 1 HGNC:29520 details
hsa-miR-3646 EIF2AK2 eukaryotic translation initiation factor 2 alpha kinase 2 HGNC:9437 details
hsa-miR-3646 MON2 MON2 homolog, regulator of endosome-to-Golgi trafficking HGNC:29177 details
hsa-miR-3646 RTL10 retrotransposon Gag like 10 HGNC:26112 details
hsa-miR-3646 WNT16 Wnt family member 16 HGNC:16267 details
hsa-miR-3646 OTUD4 OTU deubiquitinase 4 HGNC:24949 details
hsa-miR-3646 TMED4 transmembrane p24 trafficking protein 4 HGNC:22301 details
© 2021 Arieh Warshel Institute of Computational Biology, CUHK(SZ) | Designed by : Biomics Lab