miRNA Card

miRNA General Information
miRNA ID hsa-miR-3658
Description Homo sapiens miR-3658 stem-loop
Comment None
Experiment 454 [1]
Sequence UUUAAGAAAACACCAUGGAGAU
miRNA Expression in different cancers

    by mir_boxplot.py

circRNA-miRNA-gene regulatory network

Note about Netwrok:
This is a network diagram with miRNA (purple circle) as the center.
We used three tools(PITA, miRanda, targetScan) to predict the binding sites of circrna (green circle) and miRNA. Accordingly, for this miRNA that binds to circrna, we have three confidence levels, namely confident 1, confident 2 and confident 3. Confidence value indicates how many tools can deduce these results. For each confidence, we use different kinds of dashed lines.

Target circRNA with confidence

Confidence 3 (3 of 3 tools predicted)

CircID miRNA PITA miRanda targetScan

Confidence 1 (1 of 3 tools predicted)

CircID miRNA PITA miRanda targetScan
chr1:161048503|161048605 hsa-miR-3658 1 0 0
chr15:42532248|42532402 hsa-miR-3658 0 1 0
chr2:210028012|210028182 hsa-miR-3658 0 1 0
chr16:31080994|31081075 hsa-miR-3658 0 1 0
chr12:108785917|108786114 hsa-miR-3658 0 1 0
chr6:56616412|56616606 hsa-miR-3658 0 1 0
chr12:122865511|122865653 hsa-miR-3658 0 1 0
chr4:77611519|77611672 hsa-miR-3658 0 1 0
chr20:58995549|58995739 hsa-miR-3658 0 1 0
chr20:58995549|58995678 hsa-miR-3658 0 1 0
chr15:99134746|99134886 hsa-miR-3658 0 1 0
chr3:36988627|36988753 hsa-miR-3658 0 1 0
chr3:101856369~101856673 hsa-miR-3658 0 1 0
chr19:19112049~19112155 hsa-miR-3658 0 1 0
chr1:20767584~20770955 hsa-miR-3658 0 1 0
chr12:122865511~122865678 hsa-miR-3658 0 1 0
chr6:116597393|116597470 hsa-miR-3658 0 1 0
chr6:35252531~35252662 hsa-miR-3658 0 1 0
chr3:128620336~128620506 hsa-miR-3658 0 1 0
chr12:56713062~56713190 hsa-miR-3658 0 1 0
chr20:58995549~58995681 hsa-miR-3658 0 1 0
chr3:15679301~15679524 hsa-miR-3658 0 1 0
chr6:26055895~26056020 hsa-miR-3658 0 1 0
chr22:38484702~38484839 hsa-miR-3658 0 1 0
chr6:24718540~24718823 hsa-miR-3658 0 1 0
chrX:2724155|2724247 hsa-miR-3658 0 1 0
chr5:10754024|10754157 hsa-miR-3658 0 1 0
chrX:2724121|2724266 hsa-miR-3658 0 1 0
chr20:51538150|51538300 hsa-miR-3658 0 1 0
chr12:123293861|123293999 hsa-miR-3658 0 1 0
chr12:104560186|104560396 hsa-miR-3658 0 1 0
chr3:128620336|128620530 hsa-miR-3658 0 1 0
chr16:19860397|19860520 hsa-miR-3658 0 1 0
chr2:3477948|3478233 hsa-miR-3658 0 1 0
chr20:52151912|52152145 hsa-miR-3658 0 1 0
chr20:58995518|58995681 hsa-miR-3658 0 1 0
chr3:37821805|37821915 hsa-miR-3658 0 1 0
chr16:31080941|31081075 hsa-miR-3658 0 1 0
chr15:64132129|64132219 hsa-miR-3658 0 1 0
chr12:122985130|122985250 hsa-miR-3658 0 1 0
chr3:128620381|128620530 hsa-miR-3658 0 1 0
chr5:37392017|37392120 hsa-miR-3658 0 1 0
chr1:214656974|214657143 hsa-miR-3658 0 1 0
chr16:19860397|19860518 hsa-miR-3658 0 1 0
chr17:56848696|56856625 hsa-miR-3658 0 1 0
chr6:70426439|70452571 hsa-miR-3658 0 1 0
chr5:75402972|75411103 hsa-miR-3658 0 1 0
chr6:46883559|47029104 hsa-miR-3658 0 1 0
chr5:96774150|96774210 hsa-miR-3658 0 1 0
chr5:37392031|37396403 hsa-miR-3658 0 1 0
chr22:37373915|37374256 hsa-miR-3658 0 1 0
chr2:219420102|219420346 hsa-miR-3658 0 1 0
chr1:33010540|33010707 hsa-miR-3658 -11 1 0
chr1:20767584|20770955 hsa-miR-3658 -6 1 0
chr3:149169227|149169467 hsa-miR-3658 -11 1 0
chr20:58995549|58995681 hsa-miR-3658 0 1 0
chr6:31477674|31477925 hsa-miR-3658 0 1 0
chr13:113254750|113255008 hsa-miR-3658 0 1 0
chr3:48746868|48746985 hsa-miR-3658 0 1 0
chr2:219420251|219420533 hsa-miR-3658 0 1 0
chr9:93453245|93453469 hsa-miR-3658 0 1 0
chr11:102231886|102232075 hsa-miR-3658 0 1 0
chr12:69270373|69270541 hsa-miR-3658 0 1 0
chr8:143280176|143280269 hsa-miR-3658 0 1 0
chr3:15679301|15679555 hsa-miR-3658 0 1 0
chr16:1677062|1677184 hsa-miR-3658 0 1 0
chrX:100689856|100690117 hsa-miR-3658 0 1 0
chr4:185501238|185501417 hsa-miR-3658 0 1 0
chr1:152399600|152399740 hsa-miR-3658 0 1 0
chr15:32767294|32767420 hsa-miR-3658 0 1 0
chr12:55994459|55994657 hsa-miR-3658 0 1 0
chr20:58995500|58995681 hsa-miR-3658 0 1 0
chr12:89624227|89624397 hsa-miR-3658 0 1 0
chr16:46677315|46677398 hsa-miR-3658 0 1 0
chr10:79355083|79355218 hsa-miR-3658 0 1 0
chr21:33797422|33797542 hsa-miR-3658 0 1 0
chr21:33797389|33797542 hsa-miR-3658 0 1 0
chr2:219420105|219420346 hsa-miR-3658 0 1 0
chr3:179334880|179335009 hsa-miR-3658 0 1 0
chr16:50083978|50084109 hsa-miR-3658 0 1 0
chr16:75104500|75104640 hsa-miR-3658 1 0 0
chr10:5952303|5952589 hsa-miR-3658 1 0 0
Target genes
miRNA Gene Gene Description HGNC ID details
hsa-miR-3658 AKR1D1 aldo-keto reductase family 1 member D1 HGNC:388 details
hsa-miR-3658 ZBTB10 zinc finger and BTB domain containing 10 HGNC:30953 details
hsa-miR-3658 NINJ1 ninjurin 1 HGNC:7824 details
hsa-miR-3658 TENM1 teneurin transmembrane protein 1 HGNC:8117 details
hsa-miR-3658 LBR lamin B receptor HGNC:6518 details
hsa-miR-3658 CEP55 centrosomal protein 55 HGNC:1161 details
hsa-miR-3658 CNBP CCHC-type zinc finger nucleic acid binding protein HGNC:13164 details
hsa-miR-3658 RREB1 ras responsive element binding protein 1 HGNC:10449 details
hsa-miR-3658 C17orf80 chromosome 17 open reading frame 80 HGNC:29601 details
hsa-miR-3658 BTBD7 BTB domain containing 7 HGNC:18269 details
hsa-miR-3658 SCRN1 secernin 1 HGNC:22192 details
hsa-miR-3658 TMEM167A transmembrane protein 167A HGNC:28330 details
hsa-miR-3658 PIAS2 protein inhibitor of activated STAT 2 HGNC:17311 details
hsa-miR-3658 ZNF844 zinc finger protein 844 HGNC:25932 details
hsa-miR-3658 APOBEC3F apolipoprotein B mRNA editing enzyme catalytic subunit 3F HGNC:17356 details
hsa-miR-3658 WAC WW domain containing adaptor with coiled-coil HGNC:17327 details
hsa-miR-3658 TRIB1 tribbles pseudokinase 1 HGNC:16891 details
hsa-miR-3658 PTEN phosphatase and tensin homolog HGNC:9588 details
hsa-miR-3658 PAQR5 progestin and adipoQ receptor family member 5 HGNC:29645 details
hsa-miR-3658 MYLIP myosin regulatory light chain interacting protein HGNC:21155 details
hsa-miR-3658 LIN54 lin-54 DREAM MuvB core complex component HGNC:25397 details
hsa-miR-3658 KLF3 Kruppel like factor 3 HGNC:16516 details
hsa-miR-3658 GTF2A1 general transcription factor IIA subunit 1 HGNC:4646 details
hsa-miR-3658 CDKN1B cyclin dependent kinase inhibitor 1B HGNC:1785 details
hsa-miR-3658 ARL5B ADP ribosylation factor like GTPase 5B HGNC:23052 details
hsa-miR-3658 ARID5B AT-rich interaction domain 5B HGNC:17362 details
hsa-miR-3658 AKIRIN1 akirin 1 HGNC:25744 details
hsa-miR-3658 YTHDF1 YTH N6-methyladenosine RNA binding protein 1 HGNC:15867 details
hsa-miR-3658 TAOK1 TAO kinase 1 HGNC:29259 details
hsa-miR-3658 MTFR1 mitochondrial fission regulator 1 HGNC:29510 details
hsa-miR-3658 FAM91A1 family with sequence similarity 91 member A1 HGNC:26306 details
hsa-miR-3658 STARD13 StAR related lipid transfer domain containing 13 HGNC:19164 details
hsa-miR-3658 BRD3 bromodomain containing 3 HGNC:1104 details
hsa-miR-3658 MIER3 MIER family member 3 HGNC:26678 details
hsa-miR-3658 details
hsa-miR-3658 YOD1 YOD1 deubiquitinase HGNC:25035 details
hsa-miR-3658 CEP97 centrosomal protein 97 HGNC:26244 details
hsa-miR-3658 ZNF354B zinc finger protein 354B HGNC:17197 details
hsa-miR-3658 MBTD1 mbt domain containing 1 HGNC:19866 details
hsa-miR-3658 BTG3 BTG anti-proliferation factor 3 HGNC:1132 details
hsa-miR-3658 ABHD13 abhydrolase domain containing 13 HGNC:20293 details
hsa-miR-3658 details
hsa-miR-3658 C11orf54 chromosome 11 open reading frame 54 HGNC:30204 details
hsa-miR-3658 MBL2 mannose binding lectin 2 HGNC:6922 details
hsa-miR-3658 TOMM20 translocase of outer mitochondrial membrane 20 HGNC:20947 details
hsa-miR-3658 CLCC1 chloride channel CLIC like 1 HGNC:29675 details
hsa-miR-3658 CLEC4D C-type lectin domain family 4 member D HGNC:14554 details
hsa-miR-3658 GDPD1 glycerophosphodiester phosphodiesterase domain containing 1 HGNC:20883 details
hsa-miR-3658 PROSER2 proline and serine rich 2 HGNC:23728 details
hsa-miR-3658 CBY1 chibby family member 1, beta catenin antagonist HGNC:1307 details
hsa-miR-3658 TGOLN2 trans-golgi network protein 2 HGNC:15450 details
hsa-miR-3658 SCARB2 scavenger receptor class B member 2 HGNC:1665 details
hsa-miR-3658 RBM47 RNA binding motif protein 47 HGNC:30358 details
hsa-miR-3658 PCNP PEST proteolytic signal containing nuclear protein HGNC:30023 details
hsa-miR-3658 KPNA2 karyopherin subunit alpha 2 HGNC:6395 details
hsa-miR-3658 IRF2 interferon regulatory factor 2 HGNC:6117 details
hsa-miR-3658 ANP32E acidic nuclear phosphoprotein 32 family member E HGNC:16673 details
hsa-miR-3658 ADIPOR2 adiponectin receptor 2 HGNC:24041 details
hsa-miR-3658 PPIC peptidylprolyl isomerase C HGNC:9256 details
hsa-miR-3658 PLS3 plastin 3 HGNC:9091 details
hsa-miR-3658 ZNF529 zinc finger protein 529 HGNC:29328 details
hsa-miR-3658 NUTF2 nuclear transport factor 2 HGNC:13722 details
hsa-miR-3658 RLIM ring finger protein, LIM domain interacting HGNC:13429 details
hsa-miR-3658 ISG20L2 interferon stimulated exonuclease gene 20 like 2 HGNC:25745 details
hsa-miR-3658 INSIG1 insulin induced gene 1 HGNC:6083 details
hsa-miR-3658 CEP350 centrosomal protein 350 HGNC:24238 details
hsa-miR-3658 ACSL4 acyl-CoA synthetase long chain family member 4 HGNC:3571 details
hsa-miR-3658 EPB41L4B erythrocyte membrane protein band 4.1 like 4B HGNC:19818 details
hsa-miR-3658 VAT1 vesicle amine transport 1 HGNC:16919 details
hsa-miR-3658 USP38 ubiquitin specific peptidase 38 HGNC:20067 details
hsa-miR-3658 TVP23C trans-golgi network vesicle protein 23 homolog C HGNC:30453 details
hsa-miR-3658 TNRC6B trinucleotide repeat containing adaptor 6B HGNC:29190 details
hsa-miR-3658 TNFAIP3 TNF alpha induced protein 3 HGNC:11896 details
hsa-miR-3658 SPCS3 signal peptidase complex subunit 3 HGNC:26212 details
hsa-miR-3658 PDCD4 programmed cell death 4 HGNC:8763 details
hsa-miR-3658 KLHL28 kelch like family member 28 HGNC:19741 details
hsa-miR-3658 ISOC1 isochorismatase domain containing 1 HGNC:24254 details
hsa-miR-3658 EIF4G2 eukaryotic translation initiation factor 4 gamma 2 HGNC:3297 details
hsa-miR-3658 CREB3L2 cAMP responsive element binding protein 3 like 2 HGNC:23720 details
hsa-miR-3658 SOX4 SRY-box transcription factor 4 HGNC:11200 details
hsa-miR-3658 NCAM2 neural cell adhesion molecule 2 HGNC:7657 details
hsa-miR-3658 details
hsa-miR-3658 ACTG1 actin gamma 1 HGNC:144 details
hsa-miR-3658 HSPA4 heat shock protein family A (Hsp70) member 4 HGNC:5237 details
hsa-miR-3658 UBN2 ubinuclein 2 HGNC:21931 details
hsa-miR-3658 UBE2V2 ubiquitin conjugating enzyme E2 V2 HGNC:12495 details
hsa-miR-3658 TMCC1 transmembrane and coiled-coil domain family 1 HGNC:29116 details
hsa-miR-3658 SMAD5 SMAD family member 5 HGNC:6771 details
hsa-miR-3658 SETD5 SET domain containing 5 HGNC:25566 details
hsa-miR-3658 RACGAP1 Rac GTPase activating protein 1 HGNC:9804 details
hsa-miR-3658 PBX2P1 PBX homeobox 2 pseudogene 1 HGNC:8635 details
hsa-miR-3658 PAPOLG poly(A) polymerase gamma HGNC:14982 details
hsa-miR-3658 GXYLT1 glucoside xylosyltransferase 1 HGNC:27482 details
hsa-miR-3658 EIF2AK4 eukaryotic translation initiation factor 2 alpha kinase 4 HGNC:19687 details
hsa-miR-3658 ARL6IP1 ADP ribosylation factor like GTPase 6 interacting protein 1 HGNC:697 details
hsa-miR-3658 FIGNL1 fidgetin like 1 HGNC:13286 details
hsa-miR-3658 HS6ST1 heparan sulfate 6-O-sulfotransferase 1 HGNC:5201 details
hsa-miR-3658 ZNF347 zinc finger protein 347 HGNC:16447 details
hsa-miR-3658 UGT8 UDP glycosyltransferase 8 HGNC:12555 details
hsa-miR-3658 ARPC1B actin related protein 2/3 complex subunit 1B HGNC:704 details
hsa-miR-3658 RPP40 ribonuclease P/MRP subunit p40 HGNC:20992 details
hsa-miR-3658 ARHGAP12 Rho GTPase activating protein 12 HGNC:16348 details
hsa-miR-3658 SLC25A20 solute carrier family 25 member 20 HGNC:1421 details
hsa-miR-3658 WWC2 WW and C2 domain containing 2 HGNC:24148 details
hsa-miR-3658 SHOX2 short stature homeobox 2 HGNC:10854 details
hsa-miR-3658 COX7B cytochrome c oxidase subunit 7B HGNC:2291 details
hsa-miR-3658 LEFTY2 left-right determination factor 2 HGNC:3122 details
hsa-miR-3658 LRIF1 ligand dependent nuclear receptor interacting factor 1 HGNC:30299 details
hsa-miR-3658 NLRP12 NLR family pyrin domain containing 12 HGNC:22938 details
hsa-miR-3658 HSD3B1 hydroxy-delta-5-steroid dehydrogenase, 3 beta- and steroid delta-isomerase 1 HGNC:5217 details
hsa-miR-3658 B3GNT7 UDP-GlcNAc:betaGal beta-1,3-N-acetylglucosaminyltransferase 7 HGNC:18811 details
hsa-miR-3658 ABI2 abl interactor 2 HGNC:24011 details
hsa-miR-3658 PRKAR1A protein kinase cAMP-dependent type I regulatory subunit alpha HGNC:9388 details
hsa-miR-3658 VBP1 VHL binding protein 1 HGNC:12662 details
hsa-miR-3658 STK38 serine/threonine kinase 38 HGNC:17847 details
hsa-miR-3658 SSR2 signal sequence receptor subunit 2 HGNC:11324 details
hsa-miR-3658 SNX4 sorting nexin 4 HGNC:11175 details
hsa-miR-3658 SLC16A9 solute carrier family 16 member 9 HGNC:23520 details
hsa-miR-3658 PRKAA2 protein kinase AMP-activated catalytic subunit alpha 2 HGNC:9377 details
hsa-miR-3658 MAP1LC3B microtubule associated protein 1 light chain 3 beta HGNC:13352 details
hsa-miR-3658 LIFR LIF receptor subunit alpha HGNC:6597 details
hsa-miR-3658 details
hsa-miR-3658 C6orf62 chromosome 6 open reading frame 62 HGNC:20998 details
hsa-miR-3658 LDLRAD4 low density lipoprotein receptor class A domain containing 4 HGNC:1224 details
hsa-miR-3658 NLN neurolysin HGNC:16058 details
hsa-miR-3658 TLR4 toll like receptor 4 HGNC:11850 details
hsa-miR-3658 COX6C cytochrome c oxidase subunit 6C HGNC:2285 details
hsa-miR-3658 DCUN1D5 defective in cullin neddylation 1 domain containing 5 HGNC:28409 details
hsa-miR-3658 DDX11 DEAD/H-box helicase 11 HGNC:2736 details
hsa-miR-3658 GNAQ G protein subunit alpha q HGNC:4390 details
hsa-miR-3658 IFNLR1 interferon lambda receptor 1 HGNC:18584 details
hsa-miR-3658 MDM2 MDM2 proto-oncogene HGNC:6973 details
hsa-miR-3658 PIK3R1 phosphoinositide-3-kinase regulatory subunit 1 HGNC:8979 details
hsa-miR-3658 SETD2 SET domain containing 2, histone lysine methyltransferase HGNC:18420 details
hsa-miR-3658 details
hsa-miR-3658 B3GALNT2 beta-1,3-N-acetylgalactosaminyltransferase 2 HGNC:28596 details
hsa-miR-3658 CLDN12 claudin 12 HGNC:2034 details
hsa-miR-3658 MPPE1 metallophosphoesterase 1 HGNC:15988 details
hsa-miR-3658 NCOA4 nuclear receptor coactivator 4 HGNC:7671 details
hsa-miR-3658 TCP1 t-complex 1 HGNC:11655 details
hsa-miR-3658 CLPB caseinolytic mitochondrial matrix peptidase chaperone subunit B HGNC:30664 details
hsa-miR-3658 FZD3 frizzled class receptor 3 HGNC:4041 details
hsa-miR-3658 GDE1 glycerophosphodiester phosphodiesterase 1 HGNC:29644 details
hsa-miR-3658 GSKIP GSK3B interacting protein HGNC:20343 details
hsa-miR-3658 LEP leptin HGNC:6553 details
hsa-miR-3658 MCM8 minichromosome maintenance 8 homologous recombination repair factor HGNC:16147 details
hsa-miR-3658 NFATC2IP nuclear factor of activated T cells 2 interacting protein HGNC:25906 details
hsa-miR-3658 NFKBIB NFKB inhibitor beta HGNC:7798 details
hsa-miR-3658 PSMB9 proteasome 20S subunit beta 9 HGNC:9546 details
hsa-miR-3658 PSPH phosphoserine phosphatase HGNC:9577 details
hsa-miR-3658 SLC38A7 solute carrier family 38 member 7 HGNC:25582 details
hsa-miR-3658 ZNF395 zinc finger protein 395 HGNC:18737 details
© 2021 Arieh Warshel Institute of Computational Biology, CUHK(SZ) | Designed by : Biomics Lab