miRNA Card

miRNA General Information
miRNA ID hsa-miR-3666
Description Homo sapiens miR-3666 stem-loop
Comment This sequence was predicted as a miRNA by Xie et al. [1] and validated later by microarray [2].
Experiment microarray [1]
Sequence CAGUGCAAGUGUAGAUGCCGA
miRNA Expression in different cancers

    by mir_boxplot.py

circRNA-miRNA-gene regulatory network

Note about Netwrok:
This is a network diagram with miRNA (purple circle) as the center.
We used three tools(PITA, miRanda, targetScan) to predict the binding sites of circrna (green circle) and miRNA. Accordingly, for this miRNA that binds to circrna, we have three confidence levels, namely confident 1, confident 2 and confident 3. Confidence value indicates how many tools can deduce these results. For each confidence, we use different kinds of dashed lines.

Target circRNA with confidence

Confidence 3 (3 of 3 tools predicted)

CircID miRNA PITA miRanda targetScan

Confidence 1 (1 of 3 tools predicted)

CircID miRNA PITA miRanda targetScan
chr12:10159384|10159478 hsa-miR-3666 1 0 0
chr2:28946621|28946717 hsa-miR-3666 1 0 0
chr3:184326609|184327277 hsa-miR-3666 0 1 0
chr1:34973060|34973165 hsa-miR-3666 0 1 0
chr14:105707832|105708105 hsa-miR-3666 0 1 0
chr14:105707832|105708129 hsa-miR-3666 0 1 0
chr17:47673538|47674739 hsa-miR-3666 0 1 0
chr14:94623848|94623950 hsa-miR-3666 0 1 0
chr11:120486208|120486383 hsa-miR-3666 0 1 0
chr8:38266149|38266276 hsa-miR-3666 0 1 0
chr2:117916158|117916313 hsa-miR-3666 0 1 0
chr5:56895649|56895840 hsa-miR-3666 0 1 0
chr3:49123303|49123546 hsa-miR-3666 0 1 0
chr11:6612940|6613059 hsa-miR-3666 0 1 0
chr13:113321601|113321709 hsa-miR-3666 0 1 0
chr22:29299269|29299667 hsa-miR-3666 0 1 0
chr6:157189729|157190088 hsa-miR-3666 0 1 0
chr11:33705504|33705577 hsa-miR-3666 0 1 0
chr2:216672859|216673070 hsa-miR-3666 0 1 0
chr11:614238|614502 hsa-miR-3666 0 1 0
chr7:74872546|74872730 hsa-miR-3666 0 1 0
chr13:113321572|113321702 hsa-miR-3666 0 1 0
chr2:117916158|117916287 hsa-miR-3666 0 1 0
chr14:94623832|94623950 hsa-miR-3666 0 1 0
chr2:216672707|216672939 hsa-miR-3666 0 1 0
chr2:216661873|216663971 hsa-miR-3666 0 1 0
chr17:15437419|15437616 hsa-miR-3666 0 1 0
chr11:614174|614315 hsa-miR-3666 0 1 0
chr12:120563465|120563579 hsa-miR-3666 0 1 0
chr20:52152213|52152437 hsa-miR-3666 0 1 0
chr2:47795894|47796063 hsa-miR-3666 0 1 0
chr5:180835311|180835470 hsa-miR-3666 0 1 0
chr9:75009905|75010010 hsa-miR-3666 0 1 0
chr16:81354453|81354590 hsa-miR-3666 0 1 0
chr1:156727481|156727615 hsa-miR-3666 0 1 0
chr14:105707796|105707917 hsa-miR-3666 0 1 0
chr12:7070751|7070933 hsa-miR-3666 0 1 0
chr14:105707810|105708125 hsa-miR-3666 0 1 0
chr2:28305067|28305206 hsa-miR-3666 0 1 0
chr14:94623712|94623875 hsa-miR-3666 0 1 0
chr19:40931751|40931899 hsa-miR-3666 0 1 0
chr6:3305788|3305907 hsa-miR-3666 0 1 0
chr6:122788596|122788712 hsa-miR-3666 1 0 0
chr9:137598442|137598589 hsa-miR-3666 1 0 0
chr1:67004212|67004338 hsa-miR-3666 1 0 0
chr12:79552131|79552308 hsa-miR-3666 1 0 0
chr13:99536662|99536735 hsa-miR-3666 1 0 0
chr11:1189404|1189592 hsa-miR-3666 1 0 0
chr11:1189236|1189544 hsa-miR-3666 1 0 0
chr11:1189404|1189784 hsa-miR-3666 1 0 0
chr11:1189404|1189544 hsa-miR-3666 1 0 0
chr11:1189140|1189496 hsa-miR-3666 1 0 0
chr11:1189332|1189544 hsa-miR-3666 1 0 0
chr3:129183790|129183865 hsa-miR-3666 1 0 0
chr19:11575095|11575192 hsa-miR-3666 1 0 0
chr1:26123386|26123613 hsa-miR-3666 1 0 0
chr17:56995520|56995635 hsa-miR-3666 1 0 0
chr4:53496158|53496325 hsa-miR-3666 1 0 0
chr10:116063133|116063328 hsa-miR-3666 1 0 0
chr6:46144341|46144467 hsa-miR-3666 1 0 0
chr1:52914870|52915057 hsa-miR-3666 1 0 0
chr10:7562911|7563073 hsa-miR-3666 1 0 0
chr2:60923712|60924010 hsa-miR-3666 1 0 0
chr1:54850136|54850461 hsa-miR-3666 0 1 0
chr7:55208913|55209082 hsa-miR-3666 0 1 0
chr17:76082740|76082908 hsa-miR-3666 0 1 0
chr10:74105102|74105229 hsa-miR-3666 0 1 0
chr4:55079898|55080045 hsa-miR-3666 0 1 0
chr17:43875845|43876139 hsa-miR-3666 0 1 0
chr2:175179057|175179223 hsa-miR-3666 0 1 0
chr3:49123303|49123582 hsa-miR-3666 0 1 0
chr1:209790529|209790639 hsa-miR-3666 0 1 0
chr17:50106399|50106581 hsa-miR-3666 0 1 0
chr14:69353250|69353375 hsa-miR-3666 0 1 0
chrX:13709143|13709279 hsa-miR-3666 0 1 0
chr3:10126611|10126738 hsa-miR-3666 0 1 0
chr16:71732742|71732905 hsa-miR-3666 0 1 0
chr4:147617578|147617711 hsa-miR-3666 0 1 0
chr17:19676745|19676897 hsa-miR-3666 0 1 0
chr14:94051094|94051256 hsa-miR-3666 0 1 0
chr4:147617589|147617711 hsa-miR-3666 0 1 0
chr11:67283857|67284242 hsa-miR-3666 0 1 0
chr2:227554521|227554662 hsa-miR-3666 0 1 0
chr11:33705372|33705662 hsa-miR-3666 0 1 0
chr19:6733869|6734212 hsa-miR-3666 0 1 0
chr12:7070875|7070957 hsa-miR-3666 0 1 0
chr2:237324618|237324758 hsa-miR-3666 0 1 0
chr7:35633661|35633851 hsa-miR-3666 0 1 0
chr5:180835306|180835470 hsa-miR-3666 0 1 0
chr1:40073793|40073917 hsa-miR-3666 0 1 0
chr2:47795924|47796063 hsa-miR-3666 0 1 0
chr1:42926353|42926500 hsa-miR-3666 0 1 0
chr20:33659529|33659694 hsa-miR-3666 0 1 0
chr10:71817402|71818643 hsa-miR-3666 0 1 0
chr18:36114146|36114391 hsa-miR-3666 0 1 0
chr22:19132276|19132526 hsa-miR-3666 0 1 0
chr18:13758379|13758503 hsa-miR-3666 0 1 0
chr1:16395249|16395315 hsa-miR-3666 0 1 0
chr1:42926339|42926470 hsa-miR-3666 0 1 0
chr22:19038241|19038440 hsa-miR-3666 0 1 0
chr11:46399952|46400091 hsa-miR-3666 0 1 0
chr10:101038119|101038251 hsa-miR-3666 0 1 0
chr9:134438644|134438807 hsa-miR-3666 0 1 0
chr2:237324586|237324777 hsa-miR-3666 0 1 0
chr16:88436766|88436925 hsa-miR-3666 0 1 0
chr2:117916158|117916311 hsa-miR-3666 0 1 0
chr11:33705504~33705577 hsa-miR-3666 0 1 0
chr22:37568662~37568853 hsa-miR-3666 0 1 0
chr15:29766266~29766469 hsa-miR-3666 0 1 0
chr3:184326969~184327354 hsa-miR-3666 0 1 0
chr1:112455971~112456131 hsa-miR-3666 0 1 0
chr20:58715348~58715588 hsa-miR-3666 0 1 0
chr14:105707832~105708105 hsa-miR-3666 0 1 0
chr13:31150947~31151178 hsa-miR-3666 0 1 0
chrX:53552638~53552727 hsa-miR-3666 0 1 0
chr3:143058201~143058377 hsa-miR-3666 0 1 0
chr8:100261579~100261682 hsa-miR-3666 0 1 0
chr17:28882118~28882408 hsa-miR-3666 0 1 0
chr2:237324618~237324758 hsa-miR-3666 0 1 0
chr2:216672769~216672950 hsa-miR-3666 0 1 0
chr4:84649052~84649173 hsa-miR-3666 0 1 0
chr5:180835306~180835470 hsa-miR-3666 0 1 0
chr13:113321418~113321659 hsa-miR-3666 0 1 0
chr1:228275155~228275261 hsa-miR-3666 0 1 0
chr10:116063133~116063328 hsa-miR-3666 0 1 0
chr12:107712565~107712766 hsa-miR-3666 0 1 0
chr14:94623712~94623908 hsa-miR-3666 0 1 0
chr14:105707537~105707849 hsa-miR-3666 0 1 0
chr21:45522316~45522517 hsa-miR-3666 0 1 0
chr3:187740726~187740905 hsa-miR-3666 0 1 0
chr14:105707798~105708110 hsa-miR-3666 0 1 0
chr1:42926363~42926505 hsa-miR-3666 0 1 0
chr6:157189729~157190088 hsa-miR-3666 0 1 0
chr12:7070740~7070933 hsa-miR-3666 0 1 0
chr7:151076302~151076415 hsa-miR-3666 0 1 0
chr16:88738314~88738665 hsa-miR-3666 0 1 0
chr3:10126589~10126738 hsa-miR-3666 0 1 0
chr20:45253047~45253147 hsa-miR-3666 0 1 0
chr17:64152980|64153143 hsa-miR-3666 1 0 0
chr17:56995535|56995635 hsa-miR-3666 1 0 0
chr12:56120621|56120772 hsa-miR-3666 1 0 0
chrX:154358546|154359107 hsa-miR-3666 0 1 0
chr6:21980793|21980986 hsa-miR-3666 0 1 0
chr11:130267292|130267431 hsa-miR-3666 0 1 0
chr14:94051094|94051211 hsa-miR-3666 0 1 0
chr19:46606269|46606439 hsa-miR-3666 0 1 0
chr2:240577918|240578145 hsa-miR-3666 0 1 0
chr14:91353248|91353388 hsa-miR-3666 0 1 0
chrX:154358546|154359140 hsa-miR-3666 0 1 0
chr7:65981858|65982087 hsa-miR-3666 0 1 0
chrX:3823028|3823249 hsa-miR-3666 0 1 0
chr16:57569811|57569936 hsa-miR-3666 1 0 0
chr1:76233527|76233670 hsa-miR-3666 1 0 0
chr14:39036997|39037126 hsa-miR-3666 1 0 0
chr3:12591623|12591780 hsa-miR-3666 1 0 0
chr4:57032669|57032784 hsa-miR-3666 0 1 0
chr6:45056425|45056554 hsa-miR-3666 0 1 0
chr6:154825451|154825700 hsa-miR-3666 0 1 0
chr2:241980507|241980723 hsa-miR-3666 0 1 0
chr8:91006186|91006311 hsa-miR-3666 0 1 0
chr14:105707798|105708019 hsa-miR-3666 0 1 0
chr12:56605027|56605141 hsa-miR-3666 0 1 0
chr14:56205101|56205245 hsa-miR-3666 0 1 0
chr6:21980987|21981150 hsa-miR-3666 0 1 0
chr9:137695825|137695967 hsa-miR-3666 0 1 0
chr10:11315301|11315494 hsa-miR-3666 0 1 0
chr14:102941913|102942045 hsa-miR-3666 1 0 0
chr3:12584158|12584267 hsa-miR-3666 1 0 0
chr1:186308566|186308720 hsa-miR-3666 1 0 0
chr11:1189404|1189688 hsa-miR-3666 1 0 0
chr12:132789108|132789290 hsa-miR-3666 1 0 0
chr2:37644301|37644562 hsa-miR-3666 1 0 0
chr8:60853322|60853431 hsa-miR-3666 1 0 0
chr11:1189284|1189640 hsa-miR-3666 1 0 0
chr11:1189188|1189544 hsa-miR-3666 1 0 0
chr11:1189404|1189616 hsa-miR-3666 1 0 0
chr11:20668175|20668346 hsa-miR-3666 1 0 0
chr8:29079205|29079433 hsa-miR-3666 1 0 0
chr2:230878119|230878249 hsa-miR-3666 1 0 0
chr14:55351477|55351628 hsa-miR-3666 1 0 0
chr14:94051094|94051217 hsa-miR-3666 0 1 0
chr1:155247646|155247745 hsa-miR-3666 0 1 0
chr2:237324618|237324777 hsa-miR-3666 0 1 0
chr2:108764321|108764483 hsa-miR-3666 0 1 0
chr14:94623647|94623908 hsa-miR-3666 0 1 0
chr13:113321557|113321716 hsa-miR-3666 0 1 0
chr19:34219452|34219573 hsa-miR-3666 0 1 0
chr1:206588338|206588631 hsa-miR-3666 0 1 0
chr13:113321435|113321659 hsa-miR-3666 0 1 0
chr10:72887360|72887544 hsa-miR-3666 0 1 0
chr22:45922874|45922971 hsa-miR-3666 0 1 0
chr2:131310210|131310562 hsa-miR-3666 0 1 0
chr15:48534080|48534205 hsa-miR-3666 0 1 0
chr2:28413019|28413198 hsa-miR-3666 0 1 0
chrX:65509013|65509349 hsa-miR-3666 0 1 0
chr17:80394900|80395050 hsa-miR-3666 0 1 0
chr12:12913311|12913510 hsa-miR-3666 0 1 0
chrX:135424612|135424742 hsa-miR-3666 0 1 0
chr17:78853644|78853861 hsa-miR-3666 0 1 0
chr7:76515327|76515560 hsa-miR-3666 0 1 0
chr7:76515356|76515452 hsa-miR-3666 0 1 0
chr12:7070649|7070933 hsa-miR-3666 0 1 0
chr14:105707798|105708134 hsa-miR-3666 0 1 0
chr2:200856682|200856985 hsa-miR-3666 0 1 0
chr6:166409635|166409770 hsa-miR-3666 0 1 0
chrX:40628189|40628335 hsa-miR-3666 0 1 0
chr11:9203817|9204190 hsa-miR-3666 0 1 0
chr16:3013456|3013696 hsa-miR-3666 0 1 0
chr14:94051094|94051226 hsa-miR-3666 0 1 0
chr17:19676733|19676897 hsa-miR-3666 0 1 0
chr14:105707798|105708008 hsa-miR-3666 0 1 0
chr6:160106065|160106164 hsa-miR-3666 0 1 0
chr12:7070740|7070933 hsa-miR-3666 0 1 0
chr13:22040997|22041123 hsa-miR-3666 0 1 0
chr18:690559|690713 hsa-miR-3666 0 1 0
chr4:54739934|54740232 hsa-miR-3666 0 1 0
chr2:216661894|216663971 hsa-miR-3666 0 1 0
chr22:41512713|41512799 hsa-miR-3666 0 1 0
chr15:45151510|45151842 hsa-miR-3666 0 1 0
chr1:11024209|11024327 hsa-miR-3666 0 1 0
chr10:101038124|101038251 hsa-miR-3666 0 1 0
chr3:10126572|10126738 hsa-miR-3666 0 1 0
chr14:105707798|105708129 hsa-miR-3666 0 1 0
chr15:48526214|48534167 hsa-miR-3666 0 1 0
chr1:184628384|184628510 hsa-miR-3666 0 1 0
chr3:10126572|10126746 hsa-miR-3666 0 1 0
chr12:15640703|15640828 hsa-miR-3666 0 1 0
chr6:46878305|46878405 hsa-miR-3666 0 1 0
chr12:12635777|12635974 hsa-miR-3666 0 1 0
chr1:35478966|35479212 hsa-miR-3666 0 1 0
chr8:56495935|56496112 hsa-miR-3666 0 1 0
chr19:10092769|10092958 hsa-miR-3666 0 1 0
chr9:127692237|127692359 hsa-miR-3666 0 1 0
chr22:49885307|49885439 hsa-miR-3666 0 1 0
chr16:67395187|67395523 hsa-miR-3666 0 1 0
chr14:105707832|105708101 hsa-miR-3666 0 1 0
chr2:240577927|240578148 hsa-miR-3666 0 1 0
chr16:8893704|8893895 hsa-miR-3666 0 1 0
chr7:138001700|138001994 hsa-miR-3666 0 1 0
chr14:105707798|105708006 hsa-miR-3666 0 1 0
chr6:151350387|151350475 hsa-miR-3666 0 1 0
chr11:33705372|33705644 hsa-miR-3666 0 1 0
chr6:138792864|138793151 hsa-miR-3666 0 1 0
chr1:46278597|46278785 hsa-miR-3666 0 1 0
chr2:47795920|47796063 hsa-miR-3666 0 1 0
chr13:95206623|95206777 hsa-miR-3666 0 1 0
chr17:19676728|19676897 hsa-miR-3666 0 1 0
chr6:160106020|160106164 hsa-miR-3666 0 1 0
chr5:154418871|154419105 hsa-miR-3666 0 1 0
chr16:89280804|89280979 hsa-miR-3666 0 1 0
chr3:88055407|88055733 hsa-miR-3666 0 1 0
chr13:113321608|113321709 hsa-miR-3666 0 1 0
chr18:690559|690675 hsa-miR-3666 0 1 0
chr5:1051075|1051346 hsa-miR-3666 0 1 0
chr17:59840007|59840117 hsa-miR-3666 0 1 0
chr19:55091094|55091214 hsa-miR-3666 0 1 0
chr6:16410370|16410542 hsa-miR-3666 0 1 0
chr13:95206613|95206765 hsa-miR-3666 0 1 0
chr5:154418927|154419105 hsa-miR-3666 0 1 0
chr12:7070753|7070933 hsa-miR-3666 0 1 0
chr14:105249948|105250036 hsa-miR-3666 0 1 0
chrX:53552638|53552727 hsa-miR-3666 0 1 0
chr17:30895374|30895499 hsa-miR-3666 0 1 0
chr12:12913203|12913382 hsa-miR-3666 0 1 0
chr11:9204057|9204237 hsa-miR-3666 0 1 0
chr12:48134739|48135019 hsa-miR-3666 0 1 0
chr19:55091142|55091281 hsa-miR-3666 0 1 0
chr22:38687678|38687939 hsa-miR-3666 0 1 0
chrX:129553576|129553782 hsa-miR-3666 0 1 0
chr5:112834959|112835138 hsa-miR-3666 0 1 0
chr2:147972739|147975975 hsa-miR-3666 0 1 0
chr9:21968931|21969262 hsa-miR-3666 0 1 0
chr6:3305735|3305907 hsa-miR-3666 0 1 0
chr20:45253047|45253147 hsa-miR-3666 0 1 0
chrX:53088019|53088140 hsa-miR-3666 0 1 0
chr9:128353200|128353519 hsa-miR-3666 0 1 0
chr14:105707537|105707849 hsa-miR-3666 0 1 0
chr14:105707301|105707849 hsa-miR-3666 0 1 0
chr7:30924081|30924285 hsa-miR-3666 0 1 0
chr10:89643962|89644113 hsa-miR-3666 0 1 0
chr20:45253049|45253147 hsa-miR-3666 0 1 0
chr20:45253034|45253147 hsa-miR-3666 -11 1 0
chr15:48445376|48445504 hsa-miR-3666 -17 1 0
chr4:147617571|147617711 hsa-miR-3666 -10 1 0
chr2:227554465|227554662 hsa-miR-3666 -11 1 0
chr14:105707810|105708105 hsa-miR-3666 -8 1 0
chr22:41949405|41949518 hsa-miR-3666 -11 1 0
chr2:117916158|117916315 hsa-miR-3666 -6 1 0
chr12:12913326|12913410 hsa-miR-3666 0 1 0
chr3:12584168|12584324 hsa-miR-3666 1 0 0
chr21:44474308|44474417 hsa-miR-3666 1 0 0
chr5:180576377|180576521 hsa-miR-3666 1 0 0
chr11:74464695|74464881 hsa-miR-3666 1 0 0
chr16:71928208|71928338 hsa-miR-3666 1 0 0
chr3:156705376|156705500 hsa-miR-3666 1 0 0
chr12:56137883|56138258 hsa-miR-3666 1 0 0
chr17:82421044|82421209 hsa-miR-3666 1 0 0
chr5:6756145|6756382 hsa-miR-3666 1 0 0
chr6:46144341|46144481 hsa-miR-3666 1 0 0
chr12:56120635|56120757 hsa-miR-3666 1 0 0
chr17:28734830|28734967 hsa-miR-3666 0 1 0
chr3:40465576|40465882 hsa-miR-3666 0 1 0
chr2:241092630|241092886 hsa-miR-3666 0 1 0
chr10:94328226|94328351 hsa-miR-3666 0 1 0
chr7:65981974|65982090 hsa-miR-3666 0 1 0
chr16:8893704|8893815 hsa-miR-3666 0 1 0
chr11:61788177|61788341 hsa-miR-3666 0 1 0
chr22:37568671|37568808 hsa-miR-3666 0 1 0
chr7:99494246|99494427 hsa-miR-3666 0 1 0
chr2:175179100|175179250 hsa-miR-3666 0 1 0
chr12:12913326|12913604 hsa-miR-3666 0 1 0
chr2:74428631|74428895 hsa-miR-3666 0 1 0
chr7:107959249|107959350 hsa-miR-3666 0 1 0
chr19:42225882|42226103 hsa-miR-3666 0 1 0
chr1:201383116|201383362 hsa-miR-3666 0 1 0
chr1:27734112|27734183 hsa-miR-3666 0 1 0
chr3:47849028|47849313 hsa-miR-3666 0 1 0
chr19:45831479|45831588 hsa-miR-3666 0 1 0
chr9:71684166|71684353 hsa-miR-3666 0 1 0
chr16:8893719|8893914 hsa-miR-3666 0 1 0
chr14:64541144|64541278 hsa-miR-3666 0 1 0
chr10:101038119|101038280 hsa-miR-3666 0 1 0
chr2:240578053|240578145 hsa-miR-3666 0 1 0
chr19:48256912|48257030 hsa-miR-3666 0 1 0
chr11:62880412|62880553 hsa-miR-3666 0 1 0
chr13:48046945|48047094 hsa-miR-3666 0 1 0
chr7:73831346|73831495 hsa-miR-3666 0 1 0
chr5:157739359|157739568 hsa-miR-3666 0 1 0
chr13:113321435|113321709 hsa-miR-3666 0 1 0
chr9:127365544|127365729 hsa-miR-3666 0 1 0
chr2:112583506|112583594 hsa-miR-3666 0 1 0
chr12:89521918|89522067 hsa-miR-3666 0 1 0
chr4:94285086|94285203 hsa-miR-3666 0 1 0
chr17:44075729|44075860 hsa-miR-3666 0 1 0
chr12:51921665|51921827 hsa-miR-3666 0 1 0
chr11:67611105|67611451 hsa-miR-3666 0 1 0
chr22:37568671|37568853 hsa-miR-3666 0 1 0
chr14:105707810|105707917 hsa-miR-3666 0 1 0
chr12:56644923|56645349 hsa-miR-3666 0 1 0
chr1:201383087|201383364 hsa-miR-3666 0 1 0
chr2:170966311|170966460 hsa-miR-3666 0 1 0
chr19:55091129|55091228 hsa-miR-3666 0 1 0
chr8:100261567|100261708 hsa-miR-3666 0 1 0
chr2:117916158|117916323 hsa-miR-3666 0 1 0
chr22:29299264|29299646 hsa-miR-3666 0 1 0
chr20:9333271|9333482 hsa-miR-3666 0 1 0
chr9:93289035|93289286 hsa-miR-3666 0 1 0
chr22:37568714|37568853 hsa-miR-3666 0 1 0
chr17:76626345|76626728 hsa-miR-3666 0 1 0
chr17:75145367|75145531 hsa-miR-3666 0 1 0
chr17:59947519|59947696 hsa-miR-3666 0 1 0
chr20:63699402|63699540 hsa-miR-3666 0 1 0
chr20:9333317|9333485 hsa-miR-3666 0 1 0
chr13:113321593|113321709 hsa-miR-3666 0 1 0
chr19:6733869|6734239 hsa-miR-3666 0 1 0
chr2:227554525|227554662 hsa-miR-3666 0 1 0
chr17:59947532|59947696 hsa-miR-3666 0 1 0
chr20:59944217|59944482 hsa-miR-3666 0 1 0
chr17:76626345|76626705 hsa-miR-3666 0 1 0
chr12:5948935|5949065 hsa-miR-3666 0 1 0
chr14:20384038|20384157 hsa-miR-3666 0 1 0
chr14:105707798|105708079 hsa-miR-3666 0 1 0
chr2:240578074|240578247 hsa-miR-3666 0 1 0
chr19:36922586|36922696 hsa-miR-3666 0 1 0
chr12:12913326|12913490 hsa-miR-3666 0 1 0
chr8:7055388|7055530 hsa-miR-3666 0 1 0
chr6:24804802|24804922 hsa-miR-3666 1 0 0
chr19:58260939|58261153 hsa-miR-3666 0 1 0
chr1:2583976|2584268 hsa-miR-3666 0 1 0
chr8:27458309|27458579 hsa-miR-3666 0 1 0
chr14:105707798|105708002 hsa-miR-3666 0 1 0
chr1:168081667|168081764 hsa-miR-3666 1 0 0
chr14:24186129|24186342 hsa-miR-3666 1 0 0
chr1:39335407|39335525 hsa-miR-3666 1 0 0
chr1:39335413|39335525 hsa-miR-3666 1 0 0
chr5:132483427|132483592 hsa-miR-3666 1 0 0
chr8:100712362|100712720 hsa-miR-3666 1 0 0
chr3:12584168|12584469 hsa-miR-3666 1 0 0
chr1:235342884|235342988 hsa-miR-3666 1 0 0
chr2:28946624|28946717 hsa-miR-3666 1 0 0
chr15:74175210|74175380 hsa-miR-3666 1 0 0
chr12:56175483|56175620 hsa-miR-3666 1 0 0
chr12:41071215|41071416 hsa-miR-3666 1 0 0
chr19:10117122|10119123 hsa-miR-3666 1 0 0
chr19:32353696|32353875 hsa-miR-3666 1 0 0
Target genes
miRNA Gene Gene Description HGNC ID details
hsa-miR-3666 PRNP prion protein HGNC:9449 details
hsa-miR-3666 WNK3 WNK lysine deficient protein kinase 3 HGNC:14543 details
hsa-miR-3666 CDK19 cyclin dependent kinase 19 HGNC:19338 details
hsa-miR-3666 CDADC1 cytidine and dCMP deaminase domain containing 1 HGNC:20299 details
hsa-miR-3666 UQCRB ubiquinol-cytochrome c reductase binding protein HGNC:12582 details
hsa-miR-3666 MRPL52 mitochondrial ribosomal protein L52 HGNC:16655 details
hsa-miR-3666 TPP1 tripeptidyl peptidase 1 HGNC:2073 details
hsa-miR-3666 TNFRSF10B TNF receptor superfamily member 10b HGNC:11905 details
hsa-miR-3666 COX10 cytochrome c oxidase assembly factor heme A:farnesyltransferase COX10 HGNC:2260 details
hsa-miR-3666 details
hsa-miR-3666 ZNF800 zinc finger protein 800 HGNC:27267 details
hsa-miR-3666 ZFYVE9 zinc finger FYVE-type containing 9 HGNC:6775 details
hsa-miR-3666 ZBTB7B zinc finger and BTB domain containing 7B HGNC:18668 details
hsa-miR-3666 YY1 YY1 transcription factor HGNC:12856 details
hsa-miR-3666 RPS27A ribosomal protein S27a HGNC:10417 details
hsa-miR-3666 UBB ubiquitin B HGNC:12463 details
hsa-miR-3666 TNRC6B trinucleotide repeat containing adaptor 6B HGNC:29190 details
hsa-miR-3666 TNRC6A trinucleotide repeat containing adaptor 6A HGNC:11969 details
hsa-miR-3666 TMOD3 tropomodulin 3 HGNC:11873 details
hsa-miR-3666 THRA thyroid hormone receptor alpha HGNC:11796 details
hsa-miR-3666 STX6 syntaxin 6 HGNC:11441 details
hsa-miR-3666 STX16 syntaxin 16 HGNC:11431 details
hsa-miR-3666 SNTB1 syntrophin beta 1 HGNC:11168 details
hsa-miR-3666 SNAPIN SNAP associated protein HGNC:17145 details
hsa-miR-3666 SLC38A2 solute carrier family 38 member 2 HGNC:13448 details
hsa-miR-3666 SERINC3 serine incorporator 3 HGNC:11699 details
hsa-miR-3666 RAB5B RAB5B, member RAS oncogene family HGNC:9784 details
hsa-miR-3666 RAB14 RAB14, member RAS oncogene family HGNC:16524 details
hsa-miR-3666 PXK PX domain containing serine/threonine kinase like HGNC:23326 details
hsa-miR-3666 PPP6R1 protein phosphatase 6 regulatory subunit 1 HGNC:29195 details
hsa-miR-3666 NFIB nuclear factor I B HGNC:7785 details
hsa-miR-3666 MAP3K9 mitogen-activated protein kinase kinase kinase 9 HGNC:6861 details
hsa-miR-3666 KIF13A kinesin family member 13A HGNC:14566 details
hsa-miR-3666 KCTD10 potassium channel tetramerization domain containing 10 HGNC:23236 details
hsa-miR-3666 HSPA8 heat shock protein family A (Hsp70) member 8 HGNC:5241 details
hsa-miR-3666 GMFB glia maturation factor beta HGNC:4373 details
hsa-miR-3666 FZD6 frizzled class receptor 6 HGNC:4044 details
hsa-miR-3666 MIGA2 mitoguardin 2 HGNC:23621 details
hsa-miR-3666 EOGT EGF domain specific O-linked N-acetylglucosamine transferase HGNC:28526 details
hsa-miR-3666 ELL2 elongation factor for RNA polymerase II 2 HGNC:17064 details
hsa-miR-3666 EDN1 endothelin 1 HGNC:3176 details
hsa-miR-3666 DLG5 discs large MAGUK scaffold protein 5 HGNC:2904 details
hsa-miR-3666 CCNA2 cyclin A2 HGNC:1578 details
hsa-miR-3666 CAPRIN2 caprin family member 2 HGNC:21259 details
hsa-miR-3666 details
hsa-miR-3666 BLCAP BLCAP apoptosis inducing factor HGNC:1055 details
hsa-miR-3666 ATP6V1B2 ATPase H+ transporting V1 subunit B2 HGNC:854 details
hsa-miR-3666 ARHGAP1 Rho GTPase activating protein 1 HGNC:673 details
hsa-miR-3666 ANKRD50 ankyrin repeat domain 50 HGNC:29223 details
hsa-miR-3666 GPRC5A G protein-coupled receptor class C group 5 member A HGNC:9836 details
hsa-miR-3666 ZFYVE26 zinc finger FYVE-type containing 26 HGNC:20761 details
hsa-miR-3666 SOX4 SRY-box transcription factor 4 HGNC:11200 details
hsa-miR-3666 SECISBP2L SECIS binding protein 2 like HGNC:28997 details
hsa-miR-3666 KLF6 Kruppel like factor 6 HGNC:2235 details
hsa-miR-3666 FOXQ1 forkhead box Q1 HGNC:20951 details
hsa-miR-3666 DICER1 dicer 1, ribonuclease III HGNC:17098 details
hsa-miR-3666 BTBD3 BTB domain containing 3 HGNC:15854 details
hsa-miR-3666 CNOT4 CCR4-NOT transcription complex subunit 4 HGNC:7880 details
hsa-miR-3666 OSBP oxysterol binding protein HGNC:8503 details
hsa-miR-3666 PDZD11 PDZ domain containing 11 HGNC:28034 details
hsa-miR-3666 PDRG1 p53 and DNA damage regulated 1 HGNC:16119 details
hsa-miR-3666 ZNF24 zinc finger protein 24 HGNC:13032 details
hsa-miR-3666 TAOK1 TAO kinase 1 HGNC:29259 details
hsa-miR-3666 SIK1 salt inducible kinase 1 HGNC:11142 details
hsa-miR-3666 PNRC1 proline rich nuclear receptor coactivator 1 HGNC:17278 details
hsa-miR-3666 MMGT1 membrane magnesium transporter 1 HGNC:28100 details
hsa-miR-3666 HBP1 HMG-box transcription factor 1 HGNC:23200 details
hsa-miR-3666 BTF3L4 basic transcription factor 3 like 4 HGNC:30547 details
hsa-miR-3666 NUS1 NUS1 dehydrodolichyl diphosphate synthase subunit HGNC:21042 details
hsa-miR-3666 SNX5 sorting nexin 5 HGNC:14969 details
hsa-miR-3666 ZNF12 zinc finger protein 12 HGNC:12902 details
hsa-miR-3666 KIAA1191 KIAA1191 HGNC:29209 details
hsa-miR-3666 ZMAT3 zinc finger matrin-type 3 HGNC:29983 details
hsa-miR-3666 ZBTB4 zinc finger and BTB domain containing 4 HGNC:23847 details
hsa-miR-3666 TXNIP thioredoxin interacting protein HGNC:16952 details
hsa-miR-3666 TRIM37 tripartite motif containing 37 HGNC:7523 details
hsa-miR-3666 STARD13 StAR related lipid transfer domain containing 13 HGNC:19164 details
hsa-miR-3666 PTPN4 protein tyrosine phosphatase non-receptor type 4 HGNC:9656 details
hsa-miR-3666 PPP1R15B protein phosphatase 1 regulatory subunit 15B HGNC:14951 details
hsa-miR-3666 POC1B-GALNT4 POC1B-GALNT4 readthrough HGNC:42957 details
hsa-miR-3666 PLEKHF2 pleckstrin homology and FYVE domain containing 2 HGNC:20757 details
hsa-miR-3666 NRBF2 nuclear receptor binding factor 2 HGNC:19692 details
hsa-miR-3666 MID1IP1 MID1 interacting protein 1 HGNC:20715 details
hsa-miR-3666 MAPRE3 microtubule associated protein RP/EB family member 3 HGNC:6892 details
hsa-miR-3666 MAPK1 mitogen-activated protein kinase 1 HGNC:6871 details
hsa-miR-3666 MAP7 microtubule associated protein 7 HGNC:6869 details
hsa-miR-3666 GALNT4 polypeptide N-acetylgalactosaminyltransferase 4 HGNC:4126 details
hsa-miR-3666 ESR1 estrogen receptor 1 HGNC:3467 details
hsa-miR-3666 CLIP1 CAP-Gly domain containing linker protein 1 HGNC:10461 details
hsa-miR-3666 CAMSAP2 calmodulin regulated spectrin associated protein family member 2 HGNC:29188 details
hsa-miR-3666 ZNF154 zinc finger protein 154 HGNC:12939 details
hsa-miR-3666 SLC46A1 solute carrier family 46 member 1 HGNC:30521 details
hsa-miR-3666 PARP1 poly(ADP-ribose) polymerase 1 HGNC:270 details
hsa-miR-3666 ZNF417 zinc finger protein 417 HGNC:20646 details
hsa-miR-3666 ATP6V0D1 ATPase H+ transporting V0 subunit d1 HGNC:13724 details
hsa-miR-3666 ZNF711 zinc finger protein 711 HGNC:13128 details
hsa-miR-3666 UBN2 ubinuclein 2 HGNC:21931 details
hsa-miR-3666 UBE2D3 ubiquitin conjugating enzyme E2 D3 HGNC:12476 details
hsa-miR-3666 POLR1B RNA polymerase I subunit B HGNC:20454 details
hsa-miR-3666 QKI QKI, KH domain containing RNA binding HGNC:21100 details
hsa-miR-3666 PHF12 PHD finger protein 12 HGNC:20816 details
hsa-miR-3666 NACC2 NACC family member 2 HGNC:23846 details
hsa-miR-3666 MSANTD4 Myb/SANT DNA binding domain containing 4 with coiled-coils HGNC:29383 details
hsa-miR-3666 LZIC leucine zipper and CTNNBIP1 domain containing HGNC:17497 details
hsa-miR-3666 LMLN leishmanolysin like peptidase HGNC:15991 details
hsa-miR-3666 CALM2 calmodulin 2 HGNC:1445 details
hsa-miR-3666 details
hsa-miR-3666 SMAD4 SMAD family member 4 HGNC:6770 details
hsa-miR-3666 MTPN myotrophin HGNC:15667 details
hsa-miR-3666 ZNF354B zinc finger protein 354B HGNC:17197 details
hsa-miR-3666 ZNF317 zinc finger protein 317 HGNC:13507 details
hsa-miR-3666 SPART spartin HGNC:18514 details
hsa-miR-3666 RAN RAN, member RAS oncogene family HGNC:9846 details
hsa-miR-3666 NIPA1 NIPA magnesium transporter 1 HGNC:17043 details
hsa-miR-3666 NABP1 nucleic acid binding protein 1 HGNC:26232 details
hsa-miR-3666 KLHL36 kelch like family member 36 HGNC:17844 details
hsa-miR-3666 RFT1 RFT1 homolog HGNC:30220 details
hsa-miR-3666 VPS37B VPS37B subunit of ESCRT-I HGNC:25754 details
hsa-miR-3666 RBM20 RNA binding motif protein 20 HGNC:27424 details
hsa-miR-3666 GRB10 growth factor receptor bound protein 10 HGNC:4564 details
hsa-miR-3666 UBBP4 ubiquitin B pseudogene 4 HGNC:12467 details
hsa-miR-3666 NCAPD2 non-SMC condensin I complex subunit D2 HGNC:24305 details
hsa-miR-3666 RRAGD Ras related GTP binding D HGNC:19903 details
hsa-miR-3666 PRKAA1 protein kinase AMP-activated catalytic subunit alpha 1 HGNC:9376 details
hsa-miR-3666 PPIG peptidylprolyl isomerase G HGNC:14650 details
hsa-miR-3666 CLIC4 chloride intracellular channel 4 HGNC:13518 details
hsa-miR-3666 CEP170 centrosomal protein 170 HGNC:28920 details
hsa-miR-3666 RPRD2 regulation of nuclear pre-mRNA domain containing 2 HGNC:29039 details
hsa-miR-3666 CLEC12B C-type lectin domain family 12 member B HGNC:31966 details
hsa-miR-3666 HADHB hydroxyacyl-CoA dehydrogenase trifunctional multienzyme complex subunit beta HGNC:4803 details
hsa-miR-3666 RAG1 recombination activating 1 HGNC:9831 details
hsa-miR-3666 PEX13 peroxisomal biogenesis factor 13 HGNC:8855 details
hsa-miR-3666 TRIM71 tripartite motif containing 71 HGNC:32669 details
hsa-miR-3666 TGFBR2 transforming growth factor beta receptor 2 HGNC:11773 details
hsa-miR-3666 SLC12A7 solute carrier family 12 member 7 HGNC:10915 details
hsa-miR-3666 SALL3 spalt like transcription factor 3 HGNC:10527 details
hsa-miR-3666 RFX7 regulatory factor X7 HGNC:25777 details
hsa-miR-3666 PIGA phosphatidylinositol glycan anchor biosynthesis class A HGNC:8957 details
hsa-miR-3666 PAFAH1B2 platelet activating factor acetylhydrolase 1b catalytic subunit 2 HGNC:8575 details
hsa-miR-3666 MBNL1 muscleblind like splicing regulator 1 HGNC:6923 details
hsa-miR-3666 LEFTY1 left-right determination factor 1 HGNC:6552 details
hsa-miR-3666 LDLR low density lipoprotein receptor HGNC:6547 details
hsa-miR-3666 KREMEN1 kringle containing transmembrane protein 1 HGNC:17550 details
hsa-miR-3666 HABP4 hyaluronan binding protein 4 HGNC:17062 details
hsa-miR-3666 ERBIN erbb2 interacting protein HGNC:15842 details
hsa-miR-3666 DSTYK dual serine/threonine and tyrosine protein kinase HGNC:29043 details
hsa-miR-3666 DPYSL2 dihydropyrimidinase like 2 HGNC:3014 details
hsa-miR-3666 CUL3 cullin 3 HGNC:2553 details
hsa-miR-3666 COX20 cytochrome c oxidase assembly factor COX20 HGNC:26970 details
hsa-miR-3666 CLCN3 chloride voltage-gated channel 3 HGNC:2021 details
hsa-miR-3666 CCND2 cyclin D2 HGNC:1583 details
hsa-miR-3666 ATP6V1C1 ATPase H+ transporting V1 subunit C1 HGNC:856 details
hsa-miR-3666 ATMIN ATM interactor HGNC:29034 details
hsa-miR-3666 ADARB2 adenosine deaminase RNA specific B2 (inactive) HGNC:227 details
hsa-miR-3666 RBM43 RNA binding motif protein 43 HGNC:24790 details
hsa-miR-3666 RAB34 RAB34, member RAS oncogene family HGNC:16519 details
hsa-miR-3666 MSMO1 methylsterol monooxygenase 1 HGNC:10545 details
hsa-miR-3666 RPF2 ribosome production factor 2 homolog HGNC:20870 details
hsa-miR-3666 IPMK inositol polyphosphate multikinase HGNC:20739 details
hsa-miR-3666 TRIM4 tripartite motif containing 4 HGNC:16275 details
hsa-miR-3666 ZNF224 zinc finger protein 224 HGNC:13017 details
hsa-miR-3666 SEC23B SEC23 homolog B, COPII coat complex component HGNC:10702 details
hsa-miR-3666 MFF mitochondrial fission factor HGNC:24858 details
hsa-miR-3666 POP7 POP7 homolog, ribonuclease P/MRP subunit HGNC:19949 details
hsa-miR-3666 USP13 ubiquitin specific peptidase 13 HGNC:12611 details
hsa-miR-3666 TMEM30A transmembrane protein 30A HGNC:16667 details
hsa-miR-3666 SMOC1 SPARC related modular calcium binding 1 HGNC:20318 details
hsa-miR-3666 SATB2 SATB homeobox 2 HGNC:21637 details
hsa-miR-3666 RPS6KA5 ribosomal protein S6 kinase A5 HGNC:10434 details
hsa-miR-3666 RLIM ring finger protein, LIM domain interacting HGNC:13429 details
hsa-miR-3666 SFTPA1 surfactant protein A1 HGNC:10798 details
hsa-miR-3666 POGZ pogo transposable element derived with ZNF domain HGNC:18801 details
hsa-miR-3666 MBNL3 muscleblind like splicing regulator 3 HGNC:20564 details
hsa-miR-3666 LCLAT1 lysocardiolipin acyltransferase 1 HGNC:26756 details
hsa-miR-3666 HOXA5 homeobox A5 HGNC:5106 details
hsa-miR-3666 FBXO28 F-box protein 28 HGNC:29046 details
hsa-miR-3666 ENPP5 ectonucleotide pyrophosphatase/phosphodiesterase family member 5 HGNC:13717 details
hsa-miR-3666 EGLN3 egl-9 family hypoxia inducible factor 3 HGNC:14661 details
hsa-miR-3666 DAPK1 death associated protein kinase 1 HGNC:2674 details
hsa-miR-3666 CERCAM cerebral endothelial cell adhesion molecule HGNC:23723 details
hsa-miR-3666 CEP55 centrosomal protein 55 HGNC:1161 details
hsa-miR-3666 CHEK2 checkpoint kinase 2 HGNC:16627 details
hsa-miR-3666 details
hsa-miR-3666 BRWD1 bromodomain and WD repeat domain containing 1 HGNC:12760 details
hsa-miR-3666 BMP3 bone morphogenetic protein 3 HGNC:1070 details
hsa-miR-3666 ARHGAP12 Rho GTPase activating protein 12 HGNC:16348 details
hsa-miR-3666 ACVR1 activin A receptor type 1 HGNC:171 details
hsa-miR-3666 ACSL4 acyl-CoA synthetase long chain family member 4 HGNC:3571 details
hsa-miR-3666 ACBD5 acyl-CoA binding domain containing 5 HGNC:23338 details
hsa-miR-3666 MAVS mitochondrial antiviral signaling protein HGNC:29233 details
hsa-miR-3666 ASB16 ankyrin repeat and SOCS box containing 16 HGNC:19768 details
hsa-miR-3666 DAD1 defender against cell death 1 HGNC:2664 details
hsa-miR-3666 CBY1 chibby family member 1, beta catenin antagonist HGNC:1307 details
hsa-miR-3666 ZNF620 zinc finger protein 620 HGNC:28742 details
hsa-miR-3666 ZIC5 Zic family member 5 HGNC:20322 details
hsa-miR-3666 WIPF2 WAS/WASL interacting protein family member 2 HGNC:30923 details
hsa-miR-3666 WASL WASP like actin nucleation promoting factor HGNC:12735 details
hsa-miR-3666 VPS37A VPS37A subunit of ESCRT-I HGNC:24928 details
hsa-miR-3666 UBE2D2 ubiquitin conjugating enzyme E2 D2 HGNC:12475 details
hsa-miR-3666 TSPAN3 tetraspanin 3 HGNC:17752 details
hsa-miR-3666 TRPC3 transient receptor potential cation channel subfamily C member 3 HGNC:12335 details
hsa-miR-3666 TCF7L2 transcription factor 7 like 2 HGNC:11641 details
hsa-miR-3666 SUN2 Sad1 and UNC84 domain containing 2 HGNC:14210 details
hsa-miR-3666 SAMD8 sterile alpha motif domain containing 8 HGNC:26320 details
hsa-miR-3666 RDH11 retinol dehydrogenase 11 HGNC:17964 details
hsa-miR-3666 PURG purine rich element binding protein G HGNC:17930 details
hsa-miR-3666 PTPRG protein tyrosine phosphatase receptor type G HGNC:9671 details
hsa-miR-3666 PRUNE2 prune homolog 2 with BCH domain HGNC:25209 details
hsa-miR-3666 PPP6R3 protein phosphatase 6 regulatory subunit 3 HGNC:1173 details
hsa-miR-3666 PPP1R14C protein phosphatase 1 regulatory inhibitor subunit 14C HGNC:14952 details
hsa-miR-3666 details
hsa-miR-3666 OTUD3 OTU deubiquitinase 3 HGNC:29038 details
hsa-miR-3666 MLEC malectin HGNC:28973 details
hsa-miR-3666 MCC MCC regulator of WNT signaling pathway HGNC:6935 details
hsa-miR-3666 MB21D2 Mab-21 domain containing 2 HGNC:30438 details
hsa-miR-3666 LIPA lipase A, lysosomal acid type HGNC:6617 details
hsa-miR-3666 JMY junction mediating and regulatory protein, p53 cofactor HGNC:28916 details
hsa-miR-3666 IER3IP1 immediate early response 3 interacting protein 1 HGNC:18550 details
hsa-miR-3666 HOXD11 homeobox D11 HGNC:5134 details
hsa-miR-3666 HOXB3 homeobox B3 HGNC:5114 details
hsa-miR-3666 GNPTAB N-acetylglucosamine-1-phosphate transferase subunits alpha and beta HGNC:29670 details
hsa-miR-3666 ENPP4 ectonucleotide pyrophosphatase/phosphodiesterase 4 HGNC:3359 details
hsa-miR-3666 DYNC1LI2 dynein cytoplasmic 1 light intermediate chain 2 HGNC:2966 details
hsa-miR-3666 DEPDC1 DEP domain containing 1 HGNC:22949 details
hsa-miR-3666 CHIC1 cysteine rich hydrophobic domain 1 HGNC:1934 details
hsa-miR-3666 CFL2 cofilin 2 HGNC:1875 details
hsa-miR-3666 CCT6A chaperonin containing TCP1 subunit 6A HGNC:1620 details
hsa-miR-3666 ARHGEF26 Rho guanine nucleotide exchange factor 26 HGNC:24490 details
hsa-miR-3666 AKIRIN2 akirin 2 HGNC:21407 details
hsa-miR-3666 KLHL21 kelch like family member 21 HGNC:29041 details
hsa-miR-3666 ZNF107 zinc finger protein 107 HGNC:12887 details
hsa-miR-3666 CDK2AP2 cyclin dependent kinase 2 associated protein 2 HGNC:30833 details
hsa-miR-3666 ZBTB18 zinc finger and BTB domain containing 18 HGNC:13030 details
hsa-miR-3666 NPTX1 neuronal pentraxin 1 HGNC:7952 details
hsa-miR-3666 ZNF678 zinc finger protein 678 HGNC:28652 details
hsa-miR-3666 CCDC137 coiled-coil domain containing 137 HGNC:33451 details
hsa-miR-3666 RNF11 ring finger protein 11 HGNC:10056 details
hsa-miR-3666 RACGAP1 Rac GTPase activating protein 1 HGNC:9804 details
hsa-miR-3666 PRRG4 proline rich and Gla domain 4 HGNC:30799 details
hsa-miR-3666 MYLIP myosin regulatory light chain interacting protein HGNC:21155 details
hsa-miR-3666 KCNB1 potassium voltage-gated channel subfamily B member 1 HGNC:6231 details
hsa-miR-3666 IGFBP5 insulin like growth factor binding protein 5 HGNC:5474 details
hsa-miR-3666 details
hsa-miR-3666 DLC1 DLC1 Rho GTPase activating protein HGNC:2897 details
hsa-miR-3666 DCUN1D3 defective in cullin neddylation 1 domain containing 3 HGNC:28734 details
hsa-miR-3666 details
hsa-miR-3666 SRSF2 serine and arginine rich splicing factor 2 HGNC:10783 details
hsa-miR-3666 HPRT1 hypoxanthine phosphoribosyltransferase 1 HGNC:5157 details
hsa-miR-3666 ABCD2 ATP binding cassette subfamily D member 2 HGNC:66 details
hsa-miR-3666 NF2 neurofibromin 2 HGNC:7773 details
hsa-miR-3666 ODF4 outer dense fiber of sperm tails 4 HGNC:19056 details
hsa-miR-3666 NAA50 N-alpha-acetyltransferase 50, NatE catalytic subunit HGNC:29533 details
hsa-miR-3666 FIG4 FIG4 phosphoinositide 5-phosphatase HGNC:16873 details
hsa-miR-3666 SF3A1 splicing factor 3a subunit 1 HGNC:10765 details
hsa-miR-3666 CYB5D1 cytochrome b5 domain containing 1 HGNC:26516 details
hsa-miR-3666 F2RL1 F2R like trypsin receptor 1 HGNC:3538 details
hsa-miR-3666 CINP cyclin dependent kinase 2 interacting protein HGNC:23789 details
hsa-miR-3666 ADM2 adrenomedullin 2 HGNC:28898 details
hsa-miR-3666 RFC2 replication factor C subunit 2 HGNC:9970 details
hsa-miR-3666 WDR31 WD repeat domain 31 HGNC:21421 details
hsa-miR-3666 GPR82 G protein-coupled receptor 82 HGNC:4533 details
hsa-miR-3666 NOM1 nucleolar protein with MIF4G domain 1 HGNC:13244 details
hsa-miR-3666 POLR2D RNA polymerase II subunit D HGNC:9191 details
hsa-miR-3666 details
hsa-miR-3666 TERF2 telomeric repeat binding factor 2 HGNC:11729 details
hsa-miR-3666 NIP7 nucleolar pre-rRNA processing protein NIP7 HGNC:24328 details
hsa-miR-3666 ZBTB8A zinc finger and BTB domain containing 8A HGNC:24172 details
hsa-miR-3666 SMTNL2 smoothelin like 2 HGNC:24764 details
hsa-miR-3666 PSMB5 proteasome 20S subunit beta 5 HGNC:9542 details
hsa-miR-3666 NKAP NFKB activating protein HGNC:29873 details
hsa-miR-3666 CYP20A1 cytochrome P450 family 20 subfamily A member 1 HGNC:20576 details
hsa-miR-3666 ATF7IP activating transcription factor 7 interacting protein HGNC:20092 details
hsa-miR-3666 RPS15A ribosomal protein S15a HGNC:10389 details
hsa-miR-3666 RAB11FIP1 RAB11 family interacting protein 1 HGNC:30265 details
hsa-miR-3666 PDP2 pyruvate dehyrogenase phosphatase catalytic subunit 2 HGNC:30263 details
hsa-miR-3666 DUSP18 dual specificity phosphatase 18 HGNC:18484 details
hsa-miR-3666 details
hsa-miR-3666 MYH11 myosin heavy chain 11 HGNC:7569 details
hsa-miR-3666 PLA2G12A phospholipase A2 group XIIA HGNC:18554 details
hsa-miR-3666 CDK4 cyclin dependent kinase 4 HGNC:1773 details
hsa-miR-3666 ROMO1 reactive oxygen species modulator 1 HGNC:16185 details
hsa-miR-3666 LILRA2 leukocyte immunoglobulin like receptor A2 HGNC:6603 details
hsa-miR-3666 USP32 ubiquitin specific peptidase 32 HGNC:19143 details
hsa-miR-3666 PTGR2 prostaglandin reductase 2 HGNC:20149 details
hsa-miR-3666 SLC35E3 solute carrier family 35 member E3 HGNC:20864 details
hsa-miR-3666 TMCO1 transmembrane and coiled-coil domains 1 HGNC:18188 details
hsa-miR-3666 SLC35E2B solute carrier family 35 member E2B HGNC:33941 details
hsa-miR-3666 ACP6 acid phosphatase 6, lysophosphatidic HGNC:29609 details
hsa-miR-3666 FAM217B family with sequence similarity 217 member B HGNC:16170 details
hsa-miR-3666 IL23R interleukin 23 receptor HGNC:19100 details
hsa-miR-3666 PIGG phosphatidylinositol glycan anchor biosynthesis class G HGNC:25985 details
hsa-miR-3666 XIAP X-linked inhibitor of apoptosis HGNC:592 details
hsa-miR-3666 RBM27 RNA binding motif protein 27 HGNC:29243 details
hsa-miR-3666 AGO3 argonaute RISC catalytic component 3 HGNC:18421 details
hsa-miR-3666 S1PR2 sphingosine-1-phosphate receptor 2 HGNC:3169 details
hsa-miR-3666 ARL17B ADP ribosylation factor like GTPase 17B HGNC:32387 details
hsa-miR-3666 OMD osteomodulin HGNC:8134 details
hsa-miR-3666 MED18 mediator complex subunit 18 HGNC:25944 details
hsa-miR-3666 MASTL microtubule associated serine/threonine kinase like HGNC:19042 details
hsa-miR-3666 CCR6 C-C motif chemokine receptor 6 HGNC:1607 details
hsa-miR-3666 details
hsa-miR-3666 SSTR2 somatostatin receptor 2 HGNC:11331 details
hsa-miR-3666 SLC31A1 solute carrier family 31 member 1 HGNC:11016 details
hsa-miR-3666 RBM23 RNA binding motif protein 23 HGNC:20155 details
hsa-miR-3666 NFE2L1 nuclear factor, erythroid 2 like 1 HGNC:7781 details
hsa-miR-3666 KDELR1 KDEL endoplasmic reticulum protein retention receptor 1 HGNC:6304 details
hsa-miR-3666 C4orf36 chromosome 4 open reading frame 36 HGNC:28386 details
hsa-miR-3666 FLYWCH2 FLYWCH family member 2 HGNC:25178 details
hsa-miR-3666 SLC38A9 solute carrier family 38 member 9 HGNC:26907 details
hsa-miR-3666 PLEKHS1 pleckstrin homology domain containing S1 HGNC:26285 details
hsa-miR-3666 GP2 glycoprotein 2 HGNC:4441 details
hsa-miR-3666 IRF1 interferon regulatory factor 1 HGNC:6116 details
hsa-miR-3666 ANKRD9 ankyrin repeat domain 9 HGNC:20096 details
hsa-miR-3666 FAM120AOS family with sequence similarity 120A opposite strand HGNC:23389 details
hsa-miR-3666 PRR23A proline rich 23A HGNC:37172 details
hsa-miR-3666 SNTB2 syntrophin beta 2 HGNC:11169 details
hsa-miR-3666 ZNF431 zinc finger protein 431 HGNC:20809 details
hsa-miR-3666 PRPF4 pre-mRNA processing factor 4 HGNC:17349 details
hsa-miR-3666 ZNF529 zinc finger protein 529 HGNC:29328 details
hsa-miR-3666 details
hsa-miR-3666 RUNDC1 RUN domain containing 1 HGNC:25418 details
hsa-miR-3666 JARID2 jumonji and AT-rich interaction domain containing 2 HGNC:6196 details
hsa-miR-3666 BTG1 BTG anti-proliferation factor 1 HGNC:1130 details
hsa-miR-3666 THAP6 THAP domain containing 6 HGNC:23189 details
hsa-miR-3666 MOCS2 molybdenum cofactor synthesis 2 HGNC:7193 details
hsa-miR-3666 C3orf18 chromosome 3 open reading frame 18 HGNC:24837 details
hsa-miR-3666 KBTBD6 kelch repeat and BTB domain containing 6 HGNC:25340 details
hsa-miR-3666 CDCA4 cell division cycle associated 4 HGNC:14625 details
hsa-miR-3666 IFNLR1 interferon lambda receptor 1 HGNC:18584 details
hsa-miR-3666 RFXAP regulatory factor X associated protein HGNC:9988 details
hsa-miR-3666 KLRD1 killer cell lectin like receptor D1 HGNC:6378 details
hsa-miR-3666 MED8 mediator complex subunit 8 HGNC:19971 details
hsa-miR-3666 IGF2R insulin like growth factor 2 receptor HGNC:5467 details
hsa-miR-3666 TMTC1 transmembrane O-mannosyltransferase targeting cadherins 1 HGNC:24099 details
hsa-miR-3666 DTX4 deltex E3 ubiquitin ligase 4 HGNC:29151 details
hsa-miR-3666 FKTN fukutin HGNC:3622 details
hsa-miR-3666 RNF125 ring finger protein 125 HGNC:21150 details
hsa-miR-3666 FAM114A1 family with sequence similarity 114 member A1 HGNC:25087 details
hsa-miR-3666 CHERP calcium homeostasis endoplasmic reticulum protein HGNC:16930 details
hsa-miR-3666 CSNK2A1 casein kinase 2 alpha 1 HGNC:2457 details
hsa-miR-3666 DCBLD2 discoidin, CUB and LCCL domain containing 2 HGNC:24627 details
hsa-miR-3666 DDX6 DEAD-box helicase 6 HGNC:2747 details
hsa-miR-3666 EREG epiregulin HGNC:3443 details
hsa-miR-3666 FXR1 FMR1 autosomal homolog 1 HGNC:4023 details
hsa-miR-3666 SEC16A SEC16 homolog A, endoplasmic reticulum export factor HGNC:29006 details
hsa-miR-3666 UBC ubiquitin C HGNC:12468 details
hsa-miR-3666 ZBTB7A zinc finger and BTB domain containing 7A HGNC:18078 details
hsa-miR-3666 ABCG8 ATP binding cassette subfamily G member 8 HGNC:13887 details
hsa-miR-3666 ARL6IP1 ADP ribosylation factor like GTPase 6 interacting protein 1 HGNC:697 details
hsa-miR-3666 ARSA arylsulfatase A HGNC:713 details
hsa-miR-3666 ATP6V0E1 ATPase H+ transporting V0 subunit e1 HGNC:863 details
hsa-miR-3666 GPR161 G protein-coupled receptor 161 HGNC:23694 details
hsa-miR-3666 GPR75 G protein-coupled receptor 75 HGNC:4526 details
hsa-miR-3666 GRSF1 G-rich RNA sequence binding factor 1 HGNC:4610 details
hsa-miR-3666 IFITM1 interferon induced transmembrane protein 1 HGNC:5412 details
hsa-miR-3666 MAPKAPK5 MAPK activated protein kinase 5 HGNC:6889 details
hsa-miR-3666 MREG melanoregulin HGNC:25478 details
hsa-miR-3666 ORC1 origin recognition complex subunit 1 HGNC:8487 details
hsa-miR-3666 PRPF38A pre-mRNA processing factor 38A HGNC:25930 details
hsa-miR-3666 QSOX1 quiescin sulfhydryl oxidase 1 HGNC:9756 details
hsa-miR-3666 SIGLEC9 sialic acid binding Ig like lectin 9 HGNC:10878 details
hsa-miR-3666 SLC10A3 solute carrier family 10 member 3 HGNC:22979 details
hsa-miR-3666 TIMM50 translocase of inner mitochondrial membrane 50 HGNC:23656 details
hsa-miR-3666 FUT11 fucosyltransferase 11 HGNC:19233 details
hsa-miR-3666 RNF149 ring finger protein 149 HGNC:23137 details
© 2021 Arieh Warshel Institute of Computational Biology, CUHK(SZ) | Designed by : Biomics Lab