CircNet

miRNA General Information

Basic
Network

miRNA ID	hsa-miR-3671
Description	Homo sapiens miR-3671 stem-loop
Comment	None
Experiment	Illumina [1]
Sequence	AUCAAAUAAGGACUAGUCUGCA

miRNA Expression in different cancers

circRNA-miRNA-gene regulatory network

Note about Netwrok:
This is a network diagram with miRNA (purple circle) as the center.
We used three tools(PITA, miRanda, targetScan) to predict the binding sites of circrna (green circle) and miRNA. Accordingly, for this miRNA that binds to circrna, we have three confidence levels, namely confident 1, confident 2 and confident 3. Confidence value indicates how many tools can deduce these results. For each confidence, we use different kinds of dashed lines.

Target circRNA with confidence

Confidence 3 (3 of 3 tools predicted)

CircID	miRNA	PITA	miRanda	targetScan

Confidence 2 (2 of 3 tools predicted)

CircID	miRNA	PITA	miRanda	targetScan
chr2:232858760\|232858935	hsa-miR-3671	1	1	0

Confidence 1 (1 of 3 tools predicted)

CircID	miRNA	PITA	miRanda
chr10:49166414\|49166531	hsa-miR-3671	0	1
chr16:2767838\|2768060	hsa-miR-3671	0	1
chr13:37579322\|37579988	hsa-miR-3671	0	1
chr22:38741606\|38741796	hsa-miR-3671	0	1
chr5:138506579\|138506769	hsa-miR-3671	0	1
chr1:209786918\|209787041	hsa-miR-3671	0	1
chr20:43459771\|43459878	hsa-miR-3671	0	1
chr22:36236629\|36236753	hsa-miR-3671	1	0
chr12:91178389\|91178500	hsa-miR-3671	0	1
chr16:72096215\|72096431	hsa-miR-3671	0	1
chr11:73662302\|73662478	hsa-miR-3671	0	1
chr5:40982516\|40982718	hsa-miR-3671	0	1
chr19:7938054\|7938171	hsa-miR-3671	0	1
chr2:27440860\|27441156	hsa-miR-3671	0	1
chr21:28936526\|28936615	hsa-miR-3671	0	1
chrX:152827398\|152827574	hsa-miR-3671	0	1
chr3:136839765\|136839863	hsa-miR-3671	0	1
chr2:65091409\|65091525	hsa-miR-3671	0	1
chr5:141511794\|141511963	hsa-miR-3671	0	1
chr7:44708369\|44708544	hsa-miR-3671	0	1
chr13:37579322~37579988	hsa-miR-3671	0	1
chr2:9490046~9490122	hsa-miR-3671	0	1
chr8:11843286~11843436	hsa-miR-3671	0	1
chr11:1018543~1018647	hsa-miR-3671	0	1
chr16:2767859~2768056	hsa-miR-3671	0	1
chr1:219968786~219969089	hsa-miR-3671	0	1
chr16:2767838~2768060	hsa-miR-3671	0	1
chr6:31730648~31730886	hsa-miR-3671	0	1
chr21:28936526~28936615	hsa-miR-3671	0	1
chr16:2767757~2767950	hsa-miR-3671	0	1
chr3:49423754\|49423969	hsa-miR-3671	1	0
chr1:234605128\|234605304	hsa-miR-3671	1	0
chr16:2767671\|2767950	hsa-miR-3671	0	1
chr17:45108264\|45108472	hsa-miR-3671	0	1
chr21:26175333\|26175585	hsa-miR-3671	0	1
chr9:136459149\|136459487	hsa-miR-3671	0	1
chr13:73062152\|73062320	hsa-miR-3671	0	1
chr5:141511794\|141511973	hsa-miR-3671	0	1
chr19:7938054\|7938197	hsa-miR-3671	0	1
chr12:9072683\|9072871	hsa-miR-3671	0	1
chr5:141511794\|141511980	hsa-miR-3671	0	1
chr6:31730705\|31730886	hsa-miR-3671	0	1
chr16:2767757\|2767942	hsa-miR-3671	0	1
chr6:32442492\|32442598	hsa-miR-3671	0	1
chr16:2767859\|2768060	hsa-miR-3671	0	1
chr13:52433662\|52434882	hsa-miR-3671	0	1
chrX:154349164\|154349285	hsa-miR-3671	0	1
chr9:86305192\|86310017	hsa-miR-3671	0	1
chr17:39727310\|39727402	hsa-miR-3671	0	1
chr12:51984009\|51984105	hsa-miR-3671	0	1
chr16:84465139\|84465363	hsa-miR-3671	0	1
chr10:3777106\|3777412	hsa-miR-3671	0	1
chr11:65126292\|65126557	hsa-miR-3671	0	1
chr12:57821093\|57821272	hsa-miR-3671	0	1
chr12:9072722\|9074589	hsa-miR-3671	0	1
chr12:88046813\|88046926	hsa-miR-3671	0	1
chr17:39727310\|39727426	hsa-miR-3671	0	1
chr13:73062191\|73062320	hsa-miR-3671	0	1
chrX:152827437\|152827574	hsa-miR-3671	0	1
chr1:167068948\|167069133	hsa-miR-3671	0	1
chr6:31730705\|31730894	hsa-miR-3671	0	1
chr16:29974298\|29974471	hsa-miR-3671	0	1
chr16:31187366\|31187653	hsa-miR-3671	0	1
chr11:90187973\|90188111	hsa-miR-3671	1	0

Target genes

miRNA	Gene	Gene Description	HGNC ID	details
hsa-miR-3671	TEX35	testis expressed 35	HGNC:25366	details
hsa-miR-3671	IQCG	IQ motif containing G	HGNC:25251	details
hsa-miR-3671	CCNT2	cyclin T2	HGNC:1600	details
hsa-miR-3671	YRDC	yrdC N6-threonylcarbamoyltransferase domain containing	HGNC:28905	details
hsa-miR-3671	CCT2	chaperonin containing TCP1 subunit 2	HGNC:1615	details
hsa-miR-3671	TNRC6A	trinucleotide repeat containing adaptor 6A	HGNC:11969	details
hsa-miR-3671	TDG	thymine DNA glycosylase	HGNC:11700	details
hsa-miR-3671	PTEN	phosphatase and tensin homolog	HGNC:9588	details
hsa-miR-3671	PDIA6	protein disulfide isomerase family A member 6	HGNC:30168	details
hsa-miR-3671	ATXN7L3B	ataxin 7 like 3B	HGNC:37931	details
hsa-miR-3671	ATXN7L3	ataxin 7 like 3	HGNC:25416	details
hsa-miR-3671	ANKRD46	ankyrin repeat domain 46	HGNC:27229	details
hsa-miR-3671	ESF1	ESF1 nucleolar pre-rRNA processing protein homolog	HGNC:15898	details
hsa-miR-3671	VPS52	VPS52 subunit of GARP complex	HGNC:10518	details
hsa-miR-3671	CEP120	centrosomal protein 120	HGNC:26690	details
hsa-miR-3671	GOLGA6L4	golgin A6 family like 4	HGNC:27256	details
hsa-miR-3671	GOLGA6L10	golgin A6 family like 10	HGNC:37228	details
hsa-miR-3671	TDRP	testis development related protein	HGNC:26951	details
hsa-miR-3671	CLCN6	chloride voltage-gated channel 6	HGNC:2024	details
hsa-miR-3671	APLP2	amyloid beta precursor like protein 2	HGNC:598	details
hsa-miR-3671	SLC36A1	solute carrier family 36 member 1	HGNC:18761	details
hsa-miR-3671	EIF3M	eukaryotic translation initiation factor 3 subunit M	HGNC:24460	details
hsa-miR-3671	SFT2D2	SFT2 domain containing 2	HGNC:25140	details
hsa-miR-3671	TBK1	TANK binding kinase 1	HGNC:11584	details
hsa-miR-3671	NPM1	nucleophosmin 1	HGNC:7910	details
hsa-miR-3671	TMF1	TATA element modulatory factor 1	HGNC:11870	details
hsa-miR-3671	SLC38A1	solute carrier family 38 member 1	HGNC:13447	details
hsa-miR-3671	SCD	stearoyl-CoA desaturase	HGNC:10571	details
hsa-miR-3671	HOXB3	homeobox B3	HGNC:5114	details
hsa-miR-3671	ZNF121	zinc finger protein 121	HGNC:12904	details
hsa-miR-3671	TOR1B	torsin family 1 member B	HGNC:11995	details
hsa-miR-3671	YAF2	YY1 associated factor 2	HGNC:17363	details
hsa-miR-3671				details
hsa-miR-3671	FRK	fyn related Src family tyrosine kinase	HGNC:3955	details
hsa-miR-3671	SOD2	superoxide dismutase 2	HGNC:11180	details
hsa-miR-3671	AGAP9	ArfGAP with GTPase domain, ankyrin repeat and PH domain 9	HGNC:23463	details
hsa-miR-3671				details
hsa-miR-3671	ZNF527	zinc finger protein 527	HGNC:29385	details
hsa-miR-3671	TXNDC16	thioredoxin domain containing 16	HGNC:19965	details
hsa-miR-3671	PLGRKT	plasminogen receptor with a C-terminal lysine	HGNC:23633	details
hsa-miR-3671	SAR1B	secretion associated Ras related GTPase 1B	HGNC:10535	details
hsa-miR-3671	PPP1CB	protein phosphatase 1 catalytic subunit beta	HGNC:9282	details
hsa-miR-3671				details
hsa-miR-3671	MAD2L1	mitotic arrest deficient 2 like 1	HGNC:6763	details
hsa-miR-3671	HEPHL1	hephaestin like 1	HGNC:30477	details
hsa-miR-3671	FBXO22	F-box protein 22	HGNC:13593	details
hsa-miR-3671	BPTF	bromodomain PHD finger transcription factor	HGNC:3581	details
hsa-miR-3671	EIF5AL1	eukaryotic translation initiation factor 5A like 1	HGNC:17419	details
hsa-miR-3671	ITM2A	integral membrane protein 2A	HGNC:6173	details
hsa-miR-3671	EIF5A	eukaryotic translation initiation factor 5A	HGNC:3300	details
hsa-miR-3671	CSE1L	chromosome segregation 1 like	HGNC:2431	details
hsa-miR-3671	NDUFB5	NADH:ubiquinone oxidoreductase subunit B5	HGNC:7700	details
hsa-miR-3671	CYP4V2	cytochrome P450 family 4 subfamily V member 2	HGNC:23198	details
hsa-miR-3671	ZNF146	zinc finger protein 146	HGNC:12931	details
hsa-miR-3671	RNF41	ring finger protein 41	HGNC:18401	details
hsa-miR-3671	NFATC2IP	nuclear factor of activated T cells 2 interacting protein	HGNC:25906	details
hsa-miR-3671	FOXP1	forkhead box P1	HGNC:3823	details
hsa-miR-3671	ENPP5	ectonucleotide pyrophosphatase/phosphodiesterase family member 5	HGNC:13717	details
hsa-miR-3671	CYP26B1	cytochrome P450 family 26 subfamily B member 1	HGNC:20581	details
hsa-miR-3671	BEND4	BEN domain containing 4	HGNC:23815	details
hsa-miR-3671	AKAP10	A-kinase anchoring protein 10	HGNC:368	details
hsa-miR-3671	TCERG1	transcription elongation regulator 1	HGNC:15630	details
hsa-miR-3671	ELOA	elongin A	HGNC:11620	details
hsa-miR-3671	KLHL15	kelch like family member 15	HGNC:29347	details
hsa-miR-3671	SLC29A1	solute carrier family 29 member 1 (Augustine blood group)	HGNC:11003	details
hsa-miR-3671	ETS2	ETS proto-oncogene 2, transcription factor	HGNC:3489	details
hsa-miR-3671	NHS	NHS actin remodeling regulator	HGNC:7820	details
hsa-miR-3671	PEG10	paternally expressed 10	HGNC:14005	details
hsa-miR-3671	LBR	lamin B receptor	HGNC:6518	details
hsa-miR-3671	E2F3	E2F transcription factor 3	HGNC:3115	details
hsa-miR-3671	DEK	DEK proto-oncogene	HGNC:2768	details
hsa-miR-3671	CREBZF	CREB/ATF bZIP transcription factor	HGNC:24905	details
hsa-miR-3671	USP15	ubiquitin specific peptidase 15	HGNC:12613	details
hsa-miR-3671	NRBF2	nuclear receptor binding factor 2	HGNC:19692	details
hsa-miR-3671	TRIM10	tripartite motif containing 10	HGNC:10072	details
hsa-miR-3671	NLRP11	NLR family pyrin domain containing 11	HGNC:22945	details
hsa-miR-3671	BRI3BP	BRI3 binding protein	HGNC:14251	details
hsa-miR-3671	WDR59	WD repeat domain 59	HGNC:25706	details
hsa-miR-3671	FNDC5	fibronectin type III domain containing 5	HGNC:20240	details
hsa-miR-3671	SLC6A6	solute carrier family 6 member 6	HGNC:11052	details
hsa-miR-3671	CLUAP1	clusterin associated protein 1	HGNC:19009	details
hsa-miR-3671				details
hsa-miR-3671	C1orf56	chromosome 1 open reading frame 56	HGNC:26045	details
hsa-miR-3671	KLHDC10	kelch domain containing 10	HGNC:22194	details
hsa-miR-3671	FAM126B	family with sequence similarity 126 member B	HGNC:28593	details
hsa-miR-3671	KANSL1L	KAT8 regulatory NSL complex subunit 1 like	HGNC:26310	details
hsa-miR-3671	FGF10	fibroblast growth factor 10	HGNC:3666	details
hsa-miR-3671	MAP3K7	mitogen-activated protein kinase kinase kinase 7	HGNC:6859	details
hsa-miR-3671	GTF2I	general transcription factor IIi	HGNC:4659	details
hsa-miR-3671	WDR75	WD repeat domain 75	HGNC:25725	details
hsa-miR-3671	UBE4B	ubiquitination factor E4B	HGNC:12500	details
hsa-miR-3671	SORBS2	sorbin and SH3 domain containing 2	HGNC:24098	details
hsa-miR-3671	SNAP29	synaptosome associated protein 29	HGNC:11133	details
hsa-miR-3671	CLIC5	chloride intracellular channel 5	HGNC:13517	details
hsa-miR-3671	CREB5	cAMP responsive element binding protein 5	HGNC:16844	details
hsa-miR-3671	AAK1	AP2 associated kinase 1	HGNC:19679	details
hsa-miR-3671	ABCB5	ATP binding cassette subfamily B member 5	HGNC:46	details
hsa-miR-3671	FGF19	fibroblast growth factor 19	HGNC:3675	details
hsa-miR-3671	PPARA	peroxisome proliferator activated receptor alpha	HGNC:9232	details
hsa-miR-3671	SRCAP	Snf2 related CREBBP activator protein	HGNC:16974	details
hsa-miR-3671	FAAP24	FA core complex associated protein 24	HGNC:28467	details
hsa-miR-3671	SNTG1	syntrophin gamma 1	HGNC:13740	details
hsa-miR-3671	COMMD2	COMM domain containing 2	HGNC:24993	details
hsa-miR-3671	FSHB	follicle stimulating hormone subunit beta	HGNC:3964	details
hsa-miR-3671	CERKL	ceramide kinase like	HGNC:21699	details
hsa-miR-3671	PAFAH1B1	platelet activating factor acetylhydrolase 1b regulatory subunit 1	HGNC:8574	details
hsa-miR-3671	TNFRSF9	TNF receptor superfamily member 9	HGNC:11924	details
hsa-miR-3671	NINJ1	ninjurin 1	HGNC:7824	details
hsa-miR-3671	PRDM10	PR/SET domain 10	HGNC:13995	details
hsa-miR-3671	OR9Q1	olfactory receptor family 9 subfamily Q member 1	HGNC:14724	details
hsa-miR-3671	TMLHE	trimethyllysine hydroxylase, epsilon	HGNC:18308	details
hsa-miR-3671	ALKBH4	alkB homolog 4, lysine demethylase	HGNC:21900	details
hsa-miR-3671	PALD1	phosphatase domain containing paladin 1	HGNC:23530	details
hsa-miR-3671	ZNF225	zinc finger protein 225	HGNC:13018	details
hsa-miR-3671	WASF3	WASP family member 3	HGNC:12734	details
hsa-miR-3671	LRAT	lecithin retinol acyltransferase	HGNC:6685	details
hsa-miR-3671	KLHL28	kelch like family member 28	HGNC:19741	details
hsa-miR-3671	FAM83F	family with sequence similarity 83 member F	HGNC:25148	details
hsa-miR-3671				details
hsa-miR-3671	CDK6	cyclin dependent kinase 6	HGNC:1777	details
hsa-miR-3671	ABHD10	abhydrolase domain containing 10, depalmitoylase	HGNC:25656	details
hsa-miR-3671	CYCS	cytochrome c, somatic	HGNC:19986	details
hsa-miR-3671	HMGN1	high mobility group nucleosome binding domain 1	HGNC:4984	details
hsa-miR-3671	TNPO1	transportin 1	HGNC:6401	details
hsa-miR-3671	HACD2	3-hydroxyacyl-CoA dehydratase 2	HGNC:9640	details
hsa-miR-3671	PDE3A	phosphodiesterase 3A	HGNC:8778	details
hsa-miR-3671	KLF10	Kruppel like factor 10	HGNC:11810	details
hsa-miR-3671	EXOC2	exocyst complex component 2	HGNC:24968	details
hsa-miR-3671	PRRC2C	proline rich coiled-coil 2C	HGNC:24903	details
hsa-miR-3671	TRUB2	TruB pseudouridine synthase family member 2	HGNC:17170	details
hsa-miR-3671	CRIPT	CXXC repeat containing interactor of PDZ3 domain	HGNC:14312	details
hsa-miR-3671	SH3TC2	SH3 domain and tetratricopeptide repeats 2	HGNC:29427	details
hsa-miR-3671	COQ7	coenzyme Q7, hydroxylase	HGNC:2244	details
hsa-miR-3671	GEM	GTP binding protein overexpressed in skeletal muscle	HGNC:4234	details
hsa-miR-3671	RAD52	RAD52 homolog, DNA repair protein	HGNC:9824	details
hsa-miR-3671	KCNS2	potassium voltage-gated channel modifier subfamily S member 2	HGNC:6301	details
hsa-miR-3671				details
hsa-miR-3671	FAM98B	family with sequence similarity 98 member B	HGNC:26773	details
hsa-miR-3671	MC2R	melanocortin 2 receptor	HGNC:6930	details
hsa-miR-3671	FGF2	fibroblast growth factor 2	HGNC:3676	details
hsa-miR-3671	ZPBP	zona pellucida binding protein	HGNC:15662	details
hsa-miR-3671				details
hsa-miR-3671	ADCY9	adenylate cyclase 9	HGNC:240	details
hsa-miR-3671	BCL2L1	BCL2 like 1	HGNC:992	details
hsa-miR-3671	CSNK2A1	casein kinase 2 alpha 1	HGNC:2457	details
hsa-miR-3671	HSPA8	heat shock protein family A (Hsp70) member 8	HGNC:5241	details
hsa-miR-3671	SMC1A	structural maintenance of chromosomes 1A	HGNC:11111	details
hsa-miR-3671	ESCO1	establishment of sister chromatid cohesion N-acetyltransferase 1	HGNC:24645	details
hsa-miR-3671	IGSF8	immunoglobulin superfamily member 8	HGNC:17813	details
hsa-miR-3671	MAGEA12	MAGE family member A12	HGNC:6799	details
hsa-miR-3671	NCL	nucleolin	HGNC:7667	details
hsa-miR-3671	QSOX1	quiescin sulfhydryl oxidase 1	HGNC:9756	details
hsa-miR-3671	RNF44	ring finger protein 44	HGNC:19180	details
hsa-miR-3671	TMEM251	transmembrane protein 251	HGNC:20218	details
hsa-miR-3671	CACNA1A	calcium voltage-gated channel subunit alpha1 A	HGNC:1388	details
hsa-miR-3671	ZNF431	zinc finger protein 431	HGNC:20809	details

miRNA Card

Confidence 3 (3 of 3 tools predicted)

Confidence 2 (2 of 3 tools predicted)

Confidence 1 (1 of 3 tools predicted)