CircNet

miRNA General Information

Basic
Network

miRNA ID	hsa-miR-3672
Description	Homo sapiens miR-3672 stem-loop
Comment	None
Experiment	Illumina [1]
Sequence	AUGAGACUCAUGUAAAACAUCUU

miRNA Expression in different cancers

circRNA-miRNA-gene regulatory network

Note about Netwrok:
This is a network diagram with miRNA (purple circle) as the center.
We used three tools(PITA, miRanda, targetScan) to predict the binding sites of circrna (green circle) and miRNA. Accordingly, for this miRNA that binds to circrna, we have three confidence levels, namely confident 1, confident 2 and confident 3. Confidence value indicates how many tools can deduce these results. For each confidence, we use different kinds of dashed lines.

Target circRNA with confidence

Confidence 3 (3 of 3 tools predicted)

CircID	miRNA	PITA	miRanda	targetScan

Confidence 2 (2 of 3 tools predicted)

CircID	miRNA	PITA	miRanda	targetScan
chr1:162020162\|162023351	hsa-miR-3672	1	1	0

Confidence 1 (1 of 3 tools predicted)

CircID	miRNA	PITA	miRanda
chr3:4831731\|4831850	hsa-miR-3672	0	1
chr1:43617487\|43617841	hsa-miR-3672	0	1
chr19:48874414\|48874581	hsa-miR-3672	0	1
chr2:188974389\|188974544	hsa-miR-3672	0	1
chr2:188974389\|188974534	hsa-miR-3672	0	1
chr1:77458630\|77458732	hsa-miR-3672	0	1
chr8:143816549\|143816681	hsa-miR-3672	0	1
chr20:47663070\|47663187	hsa-miR-3672	0	1
chr1:25823700\|25826406	hsa-miR-3672	0	1
chr8:143816524\|143816753	hsa-miR-3672	0	1
chr14:74480119\|74480272	hsa-miR-3672	0	1
chrX:136667895\|136668044	hsa-miR-3672	0	1
chr2:188974389\|188974531	hsa-miR-3672	0	1
chr6:127970122\|127970277	hsa-miR-3672	0	1
chr5:140300429\|140300537	hsa-miR-3672	0	1
chr2:188974415\|188974531	hsa-miR-3672	0	1
chr12:71702300\|71702397	hsa-miR-3672	0	1
chr1:22092156\|22092263	hsa-miR-3672	0	1
chr19:36515020\|36515162	hsa-miR-3672	0	1
chr3:161085611\|161085726	hsa-miR-3672	0	1
chr8:143816549\|143816698	hsa-miR-3672	0	1
chr16:58520969\|58521287	hsa-miR-3672	0	1
chr6:127970122\|127973042	hsa-miR-3672	0	1
chr17:7224519\|7224697	hsa-miR-3672	0	1
chr8:143816473\|143816689	hsa-miR-3672	0	1
chr17:72028343\|72028551	hsa-miR-3672	0	1
chr11:116784855\|116785142	hsa-miR-3672	0	1
chr4:6642034\|6642130	hsa-miR-3672	0	1
chr17:8146921\|8147312	hsa-miR-3672	0	1
chr8:143816577\|143816753	hsa-miR-3672	0	1
chr11:114296431\|114296546	hsa-miR-3672	0	1
chr17:7224480\|7224703	hsa-miR-3672	0	1
chr17:67032307\|67032550	hsa-miR-3672	0	1
chr17:67032324\|67032538	hsa-miR-3672	0	1
chr20:2461760\|2461866	hsa-miR-3672	0	1
chr15:45470606\|45470703	hsa-miR-3672	0	1
chr19:6754663\|6754875	hsa-miR-3672	0	1
chr8:143816577\|143816744	hsa-miR-3672	0	1
chr19:39427829\|39427996	hsa-miR-3672	0	1
chr20:2461760\|2461861	hsa-miR-3672	0	1
chr1:202891834\|202892010	hsa-miR-3672	0	1
chr8:143816549\|143816678	hsa-miR-3672	0	1
chr20:50751857\|50751987	hsa-miR-3672	0	1
chr17:7224354\|7224700	hsa-miR-3672	0	1
chr7:94427753~94427889	hsa-miR-3672	0	1
chr15:99129594~99129728	hsa-miR-3672	0	1
chr19:44751561~44751764	hsa-miR-3672	0	1
chr11:64350774~64350976	hsa-miR-3672	0	1
chr16:1362672~1362906	hsa-miR-3672	0	1
chr11:43399958~43400048	hsa-miR-3672	0	1
chr8:143816549~143816746	hsa-miR-3672	0	1
chr3:150585038~150585274	hsa-miR-3672	0	1
chr17:50360883\|50361001	hsa-miR-3672	0	1
chr2:149470966\|149471059	hsa-miR-3672	0	1
chr5:140300429\|140300531	hsa-miR-3672	0	1
chr2:174073070~174073338	hsa-miR-3672	0	1
chr20:2461760~2461861	hsa-miR-3672	0	1
chr20:2461740~2461858	hsa-miR-3672	0	1
chr1:23307234~23307335	hsa-miR-3672	0	1
chr12:53721790~53721889	hsa-miR-3672	0	1
chr9:35061152~35061644	hsa-miR-3672	0	1
chr8:143816577~143816744	hsa-miR-3672	0	1
chr20:2461727~2461861	hsa-miR-3672	0	1
chr20:2461735~2461858	hsa-miR-3672	0	1
chr20:2461731\|2461854	hsa-miR-3672	0	1
chr19:18498343\|18498558	hsa-miR-3672	0	1
chr16:11738123\|11738259	hsa-miR-3672	0	1
chr7:2992797\|2992957	hsa-miR-3672	0	1
chr5:79653286\|79653428	hsa-miR-3672	0	1
chr16:20680641\|20680793	hsa-miR-3672	0	1
chr18:62306605\|62306755	hsa-miR-3672	0	1
chr17:8146844\|8147050	hsa-miR-3672	0	1
chr15:90005246\|90005438	hsa-miR-3672	0	1
chr11:35231373\|35231546	hsa-miR-3672	0	1
chr14:100298709\|100298850	hsa-miR-3672	0	1
chr12:116699511\|116699670	hsa-miR-3672	0	1
chr2:119264651\|119264794	hsa-miR-3672	0	1
chr9:132892600\|132892717	hsa-miR-3672	0	1
chr2:222558829\|222559044	hsa-miR-3672	0	1
chr2:190500015\|190500163	hsa-miR-3672	0	1
chr9:133555632\|133555930	hsa-miR-3672	0	1
chr20:62316121\|62316475	hsa-miR-3672	0	1
chr2:188974415\|188974534	hsa-miR-3672	0	1
chr19:41016965\|41017156	hsa-miR-3672	0	1
chr7:131496022\|131496238	hsa-miR-3672	0	1
chr17:7224480\|7224700	hsa-miR-3672	0	1
chr16:77197368\|77197502	hsa-miR-3672	0	1
chr17:69317745\|69317901	hsa-miR-3672	0	1
chr2:190500027\|190500163	hsa-miR-3672	0	1
chr17:5319234\|5319387	hsa-miR-3672	0	1
chr19:46317829\|46317952	hsa-miR-3672	0	1
chr17:2373233\|2373307	hsa-miR-3672	0	1
chr6:24412697\|24412819	hsa-miR-3672	0	1
chr14:74479959\|74480288	hsa-miR-3672	0	1
chr2:130341709\|130342065	hsa-miR-3672	0	1
chr12:113186733\|113186914	hsa-miR-3672	0	1
chr20:13711409\|13711513	hsa-miR-3672	0	1
chr8:143816565\|143816684	hsa-miR-3672	0	1
chr19:39427813\|39427944	hsa-miR-3672	0	1
chr6:158633279\|158633410	hsa-miR-3672	0	1
chr13:113260486\|113260606	hsa-miR-3672	0	1
chr3:122573801\|122573908	hsa-miR-3672	0	1
chr19:39427823\|39427996	hsa-miR-3672	0	1
chr19:48874273\|48874581	hsa-miR-3672	0	1
chr2:20051420\|20051562	hsa-miR-3672	0	1
chr8:143816549\|143816689	hsa-miR-3672	0	1
chr11:118405825\|118406025	hsa-miR-3672	0	1
chr20:62316127\|62316322	hsa-miR-3672	0	1
chr16:47083671\|47083789	hsa-miR-3672	0	1
chr17:7224519\|7224700	hsa-miR-3672	0	1
chr5:151031827\|151031900	hsa-miR-3672	0	1
chrX:47186283\|47186532	hsa-miR-3672	0	1
chr8:78535195\|78535436	hsa-miR-3672	0	1
chr16:58520969\|58521234	hsa-miR-3672	0	1
chr19:48874431\|48874531	hsa-miR-3672	0	1
chr17:7224519\|7224703	hsa-miR-3672	0	1
chr12:57095783\|57096018	hsa-miR-3672	0	1
chr5:10759123\|10759315	hsa-miR-3672	0	1
chr3:126472882\|126473043	hsa-miR-3672	0	1
chr20:41414683\|41414796	hsa-miR-3672	0	1
chr9:32933447\|32933722	hsa-miR-3672	0	1
chr14:106557097\|106557209	hsa-miR-3672	0	1
chr17:7224498\|7224700	hsa-miR-3672	0	1
chr9:35061152\|35061644	hsa-miR-3672	0	1
chr14:94378322\|94378429	hsa-miR-3672	0	1
chr8:143816549\|143816758	hsa-miR-3672	-7	1
chr17:7224525\|7224697	hsa-miR-3672	-2	1
chr17:7224480\|7224697	hsa-miR-3672	0	1
chr3:128822340\|128822472	hsa-miR-3672	0	1
chr7:94427753\|94427885	hsa-miR-3672	0	1
chr9:132892556\|132892700	hsa-miR-3672	0	1
chr13:113254750\|113255008	hsa-miR-3672	0	1
chr16:57450891\|57451073	hsa-miR-3672	0	1
chr4:3520072\|3524934	hsa-miR-3672	0	1
chr12:12070980\|12079318	hsa-miR-3672	0	1
chr1:235551479\|235551596	hsa-miR-3672	0	1
chr20:2461760\|2461858	hsa-miR-3672	0	1
chr9:132892556\|132892685	hsa-miR-3672	0	1
chr3:197612139\|197612285	hsa-miR-3672	0	1
chr20:2461760\|2461854	hsa-miR-3672	0	1
chr11:61403208\|61403376	hsa-miR-3672	0	1
chr17:7224484\|7224874	hsa-miR-3672	0	1
chr3:122573801\|122573951	hsa-miR-3672	0	1
chr10:43362156\|43362254	hsa-miR-3672	0	1
chr1:46514925\|46515152	hsa-miR-3672	0	1
chr16:15036249\|15036420	hsa-miR-3672	0	1
chr6:127970098\|127970280	hsa-miR-3672	0	1
chr2:119264651\|119264800	hsa-miR-3672	0	1
chr1:16396641\|16396726	hsa-miR-3672	0	1
chr17:29261826\|29262099	hsa-miR-3672	0	1
chr20:2461743\|2461854	hsa-miR-3672	0	1
chr4:6641962\|6642130	hsa-miR-3672	0	1
chr3:196236215\|196236450	hsa-miR-3672	0	1
chr2:120293198\|120293325	hsa-miR-3672	0	1
chr8:143816574\|143816689	hsa-miR-3672	0	1
chr16:2767086\|2767232	hsa-miR-3672	0	1
chr12:57095900\|57096262	hsa-miR-3672	0	1
chr16:68298514\|68298598	hsa-miR-3672	0	1
chr19:48874428\|48874529	hsa-miR-3672	0	1
chr14:24143975\|24144242	hsa-miR-3672	0	1
chr12:132825952\|132826089	hsa-miR-3672	0	1
chr7:128949098\|128949324	hsa-miR-3672	0	1
chr20:2461743\|2461917	hsa-miR-3672	0	1
chr3:185631283\|185631409	hsa-miR-3672	0	1
chr11:119417052\|119417266	hsa-miR-3672	0	1
chr12:12071062\|12079324	hsa-miR-3672	0	1
chr19:56394321\|56394438	hsa-miR-3672	0	1
chr1:160614504\|160614628	hsa-miR-3672	0	1
chr1:160092122\|160092270	hsa-miR-3672	0	1
chr21:41556298\|41556464	hsa-miR-3672	0	1

Target genes

miRNA	Gene	Gene Description	HGNC ID	details
hsa-miR-3672	METRN	meteorin, glial cell differentiation regulator	HGNC:14151	details
hsa-miR-3672	SEPHS1	selenophosphate synthetase 1	HGNC:19685	details
hsa-miR-3672	PDE6D	phosphodiesterase 6D	HGNC:8788	details
hsa-miR-3672				details
hsa-miR-3672	ALG13	ALG13 UDP-N-acetylglucosaminyltransferase subunit	HGNC:30881	details
hsa-miR-3672	RPL12	ribosomal protein L12	HGNC:10302	details
hsa-miR-3672	SAMD9L	sterile alpha motif domain containing 9 like	HGNC:1349	details
hsa-miR-3672	FZD5	frizzled class receptor 5	HGNC:4043	details
hsa-miR-3672	TMPRSS15	transmembrane serine protease 15	HGNC:9490	details
hsa-miR-3672	PLEKHG4B	pleckstrin homology and RhoGEF domain containing G4B	HGNC:29399	details
hsa-miR-3672	RAB3GAP1	RAB3 GTPase activating protein catalytic subunit 1	HGNC:17063	details
hsa-miR-3672	SLC7A6OS	solute carrier family 7 member 6 opposite strand	HGNC:25807	details
hsa-miR-3672	KLHL11	kelch like family member 11	HGNC:19008	details
hsa-miR-3672	FKBP1A	FKBP prolyl isomerase 1A	HGNC:3711	details
hsa-miR-3672	MFSD4B	major facilitator superfamily domain containing 4B	HGNC:21053	details
hsa-miR-3672	ZNF562	zinc finger protein 562	HGNC:25950	details
hsa-miR-3672				details
hsa-miR-3672	POLI	DNA polymerase iota	HGNC:9182	details
hsa-miR-3672	IFFO1	intermediate filament family orphan 1	HGNC:24970	details
hsa-miR-3672	TCEA3	transcription elongation factor A3	HGNC:11615	details
hsa-miR-3672	HLA-A	major histocompatibility complex, class I, A	HGNC:4931	details
hsa-miR-3672	HEATR3	HEAT repeat containing 3	HGNC:26087	details
hsa-miR-3672	TBC1D19	TBC1 domain family member 19	HGNC:25624	details
hsa-miR-3672	CCND2	cyclin D2	HGNC:1583	details
hsa-miR-3672	SLFN12L	schlafen family member 12 like	HGNC:33920	details
hsa-miR-3672	ZFX	zinc finger protein X-linked	HGNC:12869	details
hsa-miR-3672	TMEM170B	transmembrane protein 170B	HGNC:34244	details
hsa-miR-3672	SFXN4	sideroflexin 4	HGNC:16088	details
hsa-miR-3672	OSBPL2	oxysterol binding protein like 2	HGNC:15761	details
hsa-miR-3672	MSMO1	methylsterol monooxygenase 1	HGNC:10545	details
hsa-miR-3672	JOSD1	Josephin domain containing 1	HGNC:28953	details
hsa-miR-3672	GSPT1	G1 to S phase transition 1	HGNC:4621	details
hsa-miR-3672	GABRB1	gamma-aminobutyric acid type A receptor subunit beta1	HGNC:4081	details
hsa-miR-3672	FRMD8	FERM domain containing 8	HGNC:25462	details
hsa-miR-3672				details
hsa-miR-3672	LZIC	leucine zipper and CTNNBIP1 domain containing	HGNC:17497	details
hsa-miR-3672	DCTN4	dynactin subunit 4	HGNC:15518	details
hsa-miR-3672				details
hsa-miR-3672	HLA-C	major histocompatibility complex, class I, C	HGNC:4933	details
hsa-miR-3672	POLR3E	RNA polymerase III subunit E	HGNC:30347	details
hsa-miR-3672	DCAF7	DDB1 and CUL4 associated factor 7	HGNC:30915	details
hsa-miR-3672	NBEAL1	neurobeachin like 1	HGNC:20681	details
hsa-miR-3672	TMEM245	transmembrane protein 245	HGNC:1363	details
hsa-miR-3672	PLCG1	phospholipase C gamma 1	HGNC:9065	details
hsa-miR-3672	BLOC1S3	biogenesis of lysosomal organelles complex 1 subunit 3	HGNC:20914	details
hsa-miR-3672	PABPN1	poly(A) binding protein nuclear 1	HGNC:8565	details
hsa-miR-3672	ARID2	AT-rich interaction domain 2	HGNC:18037	details
hsa-miR-3672	CNTN4	contactin 4	HGNC:2174	details
hsa-miR-3672	LYPD6	LY6/PLAUR domain containing 6	HGNC:28751	details
hsa-miR-3672	ZNF431	zinc finger protein 431	HGNC:20809	details
hsa-miR-3672	ZNF573	zinc finger protein 573	HGNC:26420	details
hsa-miR-3672	UGDH	UDP-glucose 6-dehydrogenase	HGNC:12525	details
hsa-miR-3672	TMED7	transmembrane p24 trafficking protein 7	HGNC:24253	details
hsa-miR-3672	PRKAR2A	protein kinase cAMP-dependent type II regulatory subunit alpha	HGNC:9391	details
hsa-miR-3672	FBXO27	F-box protein 27	HGNC:18753	details
hsa-miR-3672	STMP1	short transmembrane mitochondrial protein 1	HGNC:41909	details
hsa-miR-3672	CSTF1	cleavage stimulation factor subunit 1	HGNC:2483	details
hsa-miR-3672	CCSER2	coiled-coil serine rich protein 2	HGNC:29197	details
hsa-miR-3672	EIF3H	eukaryotic translation initiation factor 3 subunit H	HGNC:3273	details
hsa-miR-3672	GAPVD1	GTPase activating protein and VPS9 domains 1	HGNC:23375	details
hsa-miR-3672	FAM83F	family with sequence similarity 83 member F	HGNC:25148	details
hsa-miR-3672	CXCL10	C-X-C motif chemokine ligand 10	HGNC:10637	details
hsa-miR-3672	F2RL2	coagulation factor II thrombin receptor like 2	HGNC:3539	details
hsa-miR-3672	ZNF331	zinc finger protein 331	HGNC:15489	details
hsa-miR-3672	AKR7A2	aldo-keto reductase family 7 member A2	HGNC:389	details
hsa-miR-3672	CC2D2A	coiled-coil and C2 domain containing 2A	HGNC:29253	details
hsa-miR-3672	FLVCR1	FLVCR heme transporter 1	HGNC:24682	details
hsa-miR-3672	CSTF2T	cleavage stimulation factor subunit 2 tau variant	HGNC:17086	details
hsa-miR-3672	NUFIP2	nuclear FMR1 interacting protein 2	HGNC:17634	details
hsa-miR-3672	GFPT1	glutamine--fructose-6-phosphate transaminase 1	HGNC:4241	details
hsa-miR-3672	COLEC10	collectin subfamily member 10	HGNC:2220	details
hsa-miR-3672	AHCYL2	adenosylhomocysteinase like 2	HGNC:22204	details
hsa-miR-3672	NBPF12	NBPF member 12	HGNC:24297	details
hsa-miR-3672	CHCHD4	coiled-coil-helix-coiled-coil-helix domain containing 4	HGNC:26467	details
hsa-miR-3672	CKAP2L	cytoskeleton associated protein 2 like	HGNC:26877	details
hsa-miR-3672	ERBIN	erbb2 interacting protein	HGNC:15842	details
hsa-miR-3672	DCAF10	DDB1 and CUL4 associated factor 10	HGNC:23686	details
hsa-miR-3672	RABGEF1	RAB guanine nucleotide exchange factor 1	HGNC:17676	details
hsa-miR-3672	HMOX1	heme oxygenase 1	HGNC:5013	details
hsa-miR-3672	ANGPT4	angiopoietin 4	HGNC:487	details
hsa-miR-3672	SPRYD4	SPRY domain containing 4	HGNC:27468	details
hsa-miR-3672	ABCF3	ATP binding cassette subfamily F member 3	HGNC:72	details
hsa-miR-3672	SERPING1	serpin family G member 1	HGNC:1228	details
hsa-miR-3672	CCDC77	coiled-coil domain containing 77	HGNC:28203	details
hsa-miR-3672	PDE4C	phosphodiesterase 4C	HGNC:8782	details
hsa-miR-3672	RPS6KA3	ribosomal protein S6 kinase A3	HGNC:10432	details
hsa-miR-3672	NIFK	nucleolar protein interacting with the FHA domain of MKI67	HGNC:17838	details
hsa-miR-3672	RANGAP1	Ran GTPase activating protein 1	HGNC:9854	details
hsa-miR-3672	SRFBP1	serum response factor binding protein 1	HGNC:26333	details
hsa-miR-3672	TBRG4	transforming growth factor beta regulator 4	HGNC:17443	details
hsa-miR-3672	KLLN	killin, p53 regulated DNA replication inhibitor	HGNC:37212	details
hsa-miR-3672				details
hsa-miR-3672	NFKBID	NFKB inhibitor delta	HGNC:15671	details
hsa-miR-3672	COX18	cytochrome c oxidase assembly factor COX18	HGNC:26801	details
hsa-miR-3672	ZNF845	zinc finger protein 845	HGNC:25112	details
hsa-miR-3672	RAB27A	RAB27A, member RAS oncogene family	HGNC:9766	details
hsa-miR-3672	DEFB105B	defensin beta 105B	HGNC:29930	details
hsa-miR-3672	DEFB105A	defensin beta 105A	HGNC:18087	details
hsa-miR-3672	SPTLC2	serine palmitoyltransferase long chain base subunit 2	HGNC:11278	details
hsa-miR-3672	CPE	carboxypeptidase E	HGNC:2303	details
hsa-miR-3672	CALCOCO2	calcium binding and coiled-coil domain 2	HGNC:29912	details
hsa-miR-3672	RAD51	RAD51 recombinase	HGNC:9817	details
hsa-miR-3672	MAP2K2	mitogen-activated protein kinase kinase 2	HGNC:6842	details
hsa-miR-3672	FBXL2	F-box and leucine rich repeat protein 2	HGNC:13598	details
hsa-miR-3672	FUT6	fucosyltransferase 6	HGNC:4017	details
hsa-miR-3672	CBS	cystathionine beta-synthase	HGNC:1550	details
hsa-miR-3672	MCCC2	methylcrotonyl-CoA carboxylase subunit 2	HGNC:6937	details
hsa-miR-3672	IMPA2	inositol monophosphatase 2	HGNC:6051	details
hsa-miR-3672	SH2D4A	SH2 domain containing 4A	HGNC:26102	details
hsa-miR-3672	CD82	CD82 molecule	HGNC:6210	details
hsa-miR-3672	TRPM7	transient receptor potential cation channel subfamily M member 7	HGNC:17994	details
hsa-miR-3672	PCYOX1	prenylcysteine oxidase 1	HGNC:20588	details
hsa-miR-3672	PAN2	poly(A) specific ribonuclease subunit PAN2	HGNC:20074	details
hsa-miR-3672	KIN	Kin17 DNA and RNA binding protein	HGNC:6327	details
hsa-miR-3672	MTO1	mitochondrial tRNA translation optimization 1	HGNC:19261	details
hsa-miR-3672	BIVM	basic, immunoglobulin-like variable motif containing	HGNC:16034	details
hsa-miR-3672	POFUT2	protein O-fucosyltransferase 2	HGNC:14683	details
hsa-miR-3672	NKAPL	NFKB activating protein like	HGNC:21584	details
hsa-miR-3672	ZNF486	zinc finger protein 486	HGNC:20807	details
hsa-miR-3672	ZNF285	zinc finger protein 285	HGNC:13079	details
hsa-miR-3672	DDX53	DEAD-box helicase 53	HGNC:20083	details
hsa-miR-3672	NT5DC3	5'-nucleotidase domain containing 3	HGNC:30826	details
hsa-miR-3672	MAPK14	mitogen-activated protein kinase 14	HGNC:6876	details
hsa-miR-3672	KNSTRN	kinetochore localized astrin (SPAG5) binding protein	HGNC:30767	details
hsa-miR-3672	GDE1	glycerophosphodiester phosphodiesterase 1	HGNC:29644	details
hsa-miR-3672	ISCA2	iron-sulfur cluster assembly 2	HGNC:19857	details
hsa-miR-3672	CCDC142	coiled-coil domain containing 142	HGNC:25889	details
hsa-miR-3672	CD226	CD226 molecule	HGNC:16961	details
hsa-miR-3672	ACTR1A	actin related protein 1A	HGNC:167	details
hsa-miR-3672	PXMP4	peroxisomal membrane protein 4	HGNC:15920	details
hsa-miR-3672	SLC10A6	solute carrier family 10 member 6	HGNC:30603	details
hsa-miR-3672	RTTN	rotatin	HGNC:18654	details
hsa-miR-3672	PGPEP1	pyroglutamyl-peptidase I	HGNC:13568	details
hsa-miR-3672	ICOSLG	inducible T cell costimulator ligand	HGNC:17087	details
hsa-miR-3672	KBTBD6	kelch repeat and BTB domain containing 6	HGNC:25340	details
hsa-miR-3672	AGO3	argonaute RISC catalytic component 3	HGNC:18421	details
hsa-miR-3672	AK1	adenylate kinase 1	HGNC:361	details
hsa-miR-3672	UBE2G2	ubiquitin conjugating enzyme E2 G2	HGNC:12483	details
hsa-miR-3672				details
hsa-miR-3672				details
hsa-miR-3672	EMCN	endomucin	HGNC:16041	details
hsa-miR-3672	KLF2	Kruppel like factor 2	HGNC:6347	details
hsa-miR-3672	PLEKHM3	pleckstrin homology domain containing M3	HGNC:34006	details
hsa-miR-3672	RBBP4	RB binding protein 4, chromatin remodeling factor	HGNC:9887	details
hsa-miR-3672	SLC16A1	solute carrier family 16 member 1	HGNC:10922	details
hsa-miR-3672	STRN3	striatin 3	HGNC:15720	details
hsa-miR-3672	YARS2	tyrosyl-tRNA synthetase 2	HGNC:24249	details
hsa-miR-3672	LPP	LIM domain containing preferred translocation partner in lipoma	HGNC:6679	details
hsa-miR-3672	LEAP2	liver enriched antimicrobial peptide 2	HGNC:29571	details
hsa-miR-3672	PIWIL1	piwi like RNA-mediated gene silencing 1	HGNC:9007	details
hsa-miR-3672	YIPF4	Yip1 domain family member 4	HGNC:28145	details
hsa-miR-3672	SNAP29	synaptosome associated protein 29	HGNC:11133	details
hsa-miR-3672	SLC35E1	solute carrier family 35 member E1	HGNC:20803	details
hsa-miR-3672				details
hsa-miR-3672	MBD1	methyl-CpG binding domain protein 1	HGNC:6916	details
hsa-miR-3672	MTMR10	myotubularin related protein 10	HGNC:25999	details
hsa-miR-3672	ZNF419	zinc finger protein 419	HGNC:20648	details
hsa-miR-3672	GMCL1	germ cell-less 1, spermatogenesis associated	HGNC:23843	details
hsa-miR-3672				details
hsa-miR-3672	OGFRL1	opioid growth factor receptor like 1	HGNC:21378	details
hsa-miR-3672	CA6	carbonic anhydrase 6	HGNC:1380	details
hsa-miR-3672	TUFT1	tuftelin 1	HGNC:12422	details
hsa-miR-3672	P4HB	prolyl 4-hydroxylase subunit beta	HGNC:8548	details
hsa-miR-3672	MOB1B	MOB kinase activator 1B	HGNC:29801	details
hsa-miR-3672	ATXN3	ataxin 3	HGNC:7106	details
hsa-miR-3672	ARSB	arylsulfatase B	HGNC:714	details
hsa-miR-3672	ORC6	origin recognition complex subunit 6	HGNC:17151	details
hsa-miR-3672	TRAPPC2	trafficking protein particle complex subunit 2	HGNC:23068	details
hsa-miR-3672				details
hsa-miR-3672	PLA2G2C	phospholipase A2 group IIC	HGNC:9032	details
hsa-miR-3672	ALDH1B1	aldehyde dehydrogenase 1 family member B1	HGNC:407	details
hsa-miR-3672	MXRA7	matrix remodeling associated 7	HGNC:7541	details
hsa-miR-3672	ZNF443	zinc finger protein 443	HGNC:20878	details
hsa-miR-3672	NUP205	nucleoporin 205	HGNC:18658	details
hsa-miR-3672	ZNF264	zinc finger protein 264	HGNC:13057	details
hsa-miR-3672	AGXT2	alanine--glyoxylate aminotransferase 2	HGNC:14412	details
hsa-miR-3672	APOC3	apolipoprotein C3	HGNC:610	details
hsa-miR-3672	QPCTL	glutaminyl-peptide cyclotransferase like	HGNC:25952	details
hsa-miR-3672	ZNF652	zinc finger protein 652	HGNC:29147	details
hsa-miR-3672	UBE2D3	ubiquitin conjugating enzyme E2 D3	HGNC:12476	details
hsa-miR-3672	UBE2B	ubiquitin conjugating enzyme E2 B	HGNC:12473	details
hsa-miR-3672	TRIM45	tripartite motif containing 45	HGNC:19018	details
hsa-miR-3672	RNF115	ring finger protein 115	HGNC:18154	details
hsa-miR-3672	PHTF2	putative homeodomain transcription factor 2	HGNC:13411	details
hsa-miR-3672	PDXK	pyridoxal kinase	HGNC:8819	details
hsa-miR-3672	PAPOLG	poly(A) polymerase gamma	HGNC:14982	details
hsa-miR-3672	OTUD3	OTU deubiquitinase 3	HGNC:29038	details
hsa-miR-3672	MYLK3	myosin light chain kinase 3	HGNC:29826	details
hsa-miR-3672	MRO	maestro	HGNC:24121	details
hsa-miR-3672	PCDHB11	protocadherin beta 11	HGNC:8682	details
hsa-miR-3672	HERPUD2	HERPUD family member 2	HGNC:21915	details
hsa-miR-3672	FBXL3	F-box and leucine rich repeat protein 3	HGNC:13599	details
hsa-miR-3672	DDX19B	DEAD-box helicase 19B	HGNC:2742	details
hsa-miR-3672	DCUN1D5	defective in cullin neddylation 1 domain containing 5	HGNC:28409	details
hsa-miR-3672	CTSS	cathepsin S	HGNC:2545	details
hsa-miR-3672	CRNKL1	crooked neck pre-mRNA splicing factor 1	HGNC:15762	details
hsa-miR-3672	CLCC1	chloride channel CLIC like 1	HGNC:29675	details
hsa-miR-3672	CDC73	cell division cycle 73	HGNC:16783	details
hsa-miR-3672	CAMK2N1	calcium/calmodulin dependent protein kinase II inhibitor 1	HGNC:24190	details
hsa-miR-3672	AEN	apoptosis enhancing nuclease	HGNC:25722	details
hsa-miR-3672	MED29	mediator complex subunit 29	HGNC:23074	details
hsa-miR-3672	OLR1	oxidized low density lipoprotein receptor 1	HGNC:8133	details
hsa-miR-3672	PHF7	PHD finger protein 7	HGNC:18458	details
hsa-miR-3672	ZNF850	zinc finger protein 850	HGNC:27994	details
hsa-miR-3672	FGG	fibrinogen gamma chain	HGNC:3694	details
hsa-miR-3672	KCNRG	potassium channel regulator	HGNC:18893	details
hsa-miR-3672	SSX2IP	SSX family member 2 interacting protein	HGNC:16509	details
hsa-miR-3672	SLFN5	schlafen family member 5	HGNC:28286	details
hsa-miR-3672	TRIM66	tripartite motif containing 66	HGNC:29005	details
hsa-miR-3672	ZNF549	zinc finger protein 549	HGNC:26632	details
hsa-miR-3672	TTC39C	tetratricopeptide repeat domain 39C	HGNC:26595	details
hsa-miR-3672	POLQ	DNA polymerase theta	HGNC:9186	details
hsa-miR-3672	MOB3A	MOB kinase activator 3A	HGNC:29802	details
hsa-miR-3672	SIGLEC8	sialic acid binding Ig like lectin 8	HGNC:10877	details
hsa-miR-3672	PRKX	protein kinase X-linked	HGNC:9441	details
hsa-miR-3672	CD302	CD302 molecule	HGNC:30843	details
hsa-miR-3672	EGR3	early growth response 3	HGNC:3240	details
hsa-miR-3672	LINC01556	long intergenic non-protein coding RNA 1556	HGNC:21195	details
hsa-miR-3672	LY75-CD302	LY75-CD302 readthrough	HGNC:38828	details
hsa-miR-3672	LY75	lymphocyte antigen 75	HGNC:6729	details
hsa-miR-3672	MRPL4	mitochondrial ribosomal protein L4	HGNC:14276	details
hsa-miR-3672	RPL41	ribosomal protein L41	HGNC:10354	details
hsa-miR-3672				details
hsa-miR-3672	CARD8	caspase recruitment domain family member 8	HGNC:17057	details
hsa-miR-3672	CDKN1A	cyclin dependent kinase inhibitor 1A	HGNC:1784	details
hsa-miR-3672	CNBP	CCHC-type zinc finger nucleic acid binding protein	HGNC:13164	details
hsa-miR-3672	COL9A2	collagen type IX alpha 2 chain	HGNC:2218	details
hsa-miR-3672	CSE1L	chromosome segregation 1 like	HGNC:2431	details
hsa-miR-3672	FBXO47	F-box protein 47	HGNC:31969	details
hsa-miR-3672	FOXL2NB	FOXL2 neighbor	HGNC:34428	details
hsa-miR-3672	GNL3L	G protein nucleolar 3 like	HGNC:25553	details
hsa-miR-3672	HTR5A-AS1	HTR5A antisense RNA 1	HGNC:48956	details
hsa-miR-3672	IBA57	iron-sulfur cluster assembly factor IBA57	HGNC:27302	details
hsa-miR-3672	IRAK2	interleukin 1 receptor associated kinase 2	HGNC:6113	details
hsa-miR-3672	KCNN3	potassium calcium-activated channel subfamily N member 3	HGNC:6292	details
hsa-miR-3672	KLF10	Kruppel like factor 10	HGNC:11810	details
hsa-miR-3672	MBD3	methyl-CpG binding domain protein 3	HGNC:6918	details
hsa-miR-3672	METTL7A	methyltransferase like 7A	HGNC:24550	details
hsa-miR-3672	MRPL51	mitochondrial ribosomal protein L51	HGNC:14044	details
hsa-miR-3672	NFIB	nuclear factor I B	HGNC:7785	details
hsa-miR-3672	PDE7A	phosphodiesterase 7A	HGNC:8791	details
hsa-miR-3672	PGAP1	post-GPI attachment to proteins inositol deacylase 1	HGNC:25712	details
hsa-miR-3672	RASSF9	Ras association domain family member 9	HGNC:15739	details
hsa-miR-3672	RPL18A	ribosomal protein L18a	HGNC:10311	details
hsa-miR-3672	RRP15	ribosomal RNA processing 15 homolog	HGNC:24255	details
hsa-miR-3672	SMTNL2	smoothelin like 2	HGNC:24764	details
hsa-miR-3672	SOCS5	suppressor of cytokine signaling 5	HGNC:16852	details
hsa-miR-3672	SPC24	SPC24 component of NDC80 kinetochore complex	HGNC:26913	details
hsa-miR-3672	ST8SIA3	ST8 alpha-N-acetyl-neuraminide alpha-2,8-sialyltransferase 3	HGNC:14269	details
hsa-miR-3672	TMEM154	transmembrane protein 154	HGNC:26489	details
hsa-miR-3672	TSPEAR-AS2	TSPEAR antisense RNA 2	HGNC:16428	details
hsa-miR-3672	USP6NL	USP6 N-terminal like	HGNC:16858	details
hsa-miR-3672	VHL	von Hippel-Lindau tumor suppressor	HGNC:12687	details
hsa-miR-3672	ZDHHC15	zinc finger DHHC-type palmitoyltransferase 15	HGNC:20342	details
hsa-miR-3672	ZMAT2	zinc finger matrin-type 2	HGNC:26433	details
hsa-miR-3672	ZNF157	zinc finger protein 157	HGNC:12942	details
hsa-miR-3672	ZNF487	zinc finger protein 487	HGNC:23488	details
hsa-miR-3672	ZNF490	zinc finger protein 490	HGNC:23705	details
hsa-miR-3672	ZNF716	zinc finger protein 716	HGNC:32458	details
hsa-miR-3672	ABL2	ABL proto-oncogene 2, non-receptor tyrosine kinase	HGNC:77	details
hsa-miR-3672				details
hsa-miR-3672	AP1S1	adaptor related protein complex 1 subunit sigma 1	HGNC:559	details
hsa-miR-3672	APP	amyloid beta precursor protein	HGNC:620	details
hsa-miR-3672	ARHGAP26	Rho GTPase activating protein 26	HGNC:17073	details
hsa-miR-3672	AS3MT	arsenite methyltransferase	HGNC:17452	details
hsa-miR-3672	ASB8	ankyrin repeat and SOCS box containing 8	HGNC:17183	details
hsa-miR-3672	BTBD19	BTB domain containing 19	HGNC:27145	details
hsa-miR-3672	C2orf15	chromosome 2 open reading frame 15	HGNC:28436	details
hsa-miR-3672	C5orf24	chromosome 5 open reading frame 24	HGNC:26746	details
hsa-miR-3672	C6orf132	chromosome 6 open reading frame 132	HGNC:21288	details
hsa-miR-3672	CCP110	centriolar coiled-coil protein 110	HGNC:24342	details
hsa-miR-3672	CCR4	C-C motif chemokine receptor 4	HGNC:1605	details
hsa-miR-3672	CNTLN	centlein	HGNC:23432	details
hsa-miR-3672	COA7	cytochrome c oxidase assembly factor 7	HGNC:25716	details
hsa-miR-3672	CTSB	cathepsin B	HGNC:2527	details
hsa-miR-3672	DENND4C	DENN domain containing 4C	HGNC:26079	details
hsa-miR-3672	EHD3	EH domain containing 3	HGNC:3244	details
hsa-miR-3672	EXOC3-AS1	EXOC3 antisense RNA 1	HGNC:25175	details
hsa-miR-3672	FADS1	fatty acid desaturase 1	HGNC:3574	details
hsa-miR-3672	FAM83D	family with sequence similarity 83 member D	HGNC:16122	details
hsa-miR-3672	FAXC	failed axon connections homolog, metaxin like GST domain containing	HGNC:20742	details
hsa-miR-3672	FRMD4B	FERM domain containing 4B	HGNC:24886	details
hsa-miR-3672				details
hsa-miR-3672	KCNK6	potassium two pore domain channel subfamily K member 6	HGNC:6281	details
hsa-miR-3672	KDSR	3-ketodihydrosphingosine reductase	HGNC:4021	details
hsa-miR-3672	LAX1	lymphocyte transmembrane adaptor 1	HGNC:26005	details
hsa-miR-3672	LETMD1	LETM1 domain containing 1	HGNC:24241	details
hsa-miR-3672	LINC01551	long intergenic non-protein coding RNA 1551	HGNC:19828	details
hsa-miR-3672	LONP2	lon peptidase 2, peroxisomal	HGNC:20598	details
hsa-miR-3672	LSM10	LSM10, U7 small nuclear RNA associated	HGNC:17562	details
hsa-miR-3672	LYRM4	LYR motif containing 4	HGNC:21365	details
hsa-miR-3672	MCM4	minichromosome maintenance complex component 4	HGNC:6947	details
hsa-miR-3672	MOG	myelin oligodendrocyte glycoprotein	HGNC:7197	details
hsa-miR-3672	MRPS23	mitochondrial ribosomal protein S23	HGNC:14509	details
hsa-miR-3672	NUP62	nucleoporin 62	HGNC:8066	details
hsa-miR-3672	OR7D2	olfactory receptor family 7 subfamily D member 2	HGNC:8378	details
hsa-miR-3672	OS9	OS9 endoplasmic reticulum lectin	HGNC:16994	details
hsa-miR-3672	OSTM1	osteoclastogenesis associated transmembrane protein 1	HGNC:21652	details
hsa-miR-3672	PIGX	phosphatidylinositol glycan anchor biosynthesis class X	HGNC:26046	details
hsa-miR-3672	POLR2D	RNA polymerase II subunit D	HGNC:9191	details
hsa-miR-3672	POTED	POTE ankyrin domain family member D	HGNC:23822	details
hsa-miR-3672	PRRT3	proline rich transmembrane protein 3	HGNC:26591	details
hsa-miR-3672	PTPN14	protein tyrosine phosphatase non-receptor type 14	HGNC:9647	details
hsa-miR-3672	PTPN2	protein tyrosine phosphatase non-receptor type 2	HGNC:9650	details
hsa-miR-3672	SCIN	scinderin	HGNC:21695	details
hsa-miR-3672	SEMA3E	semaphorin 3E	HGNC:10727	details
hsa-miR-3672	SF3A1	splicing factor 3a subunit 1	HGNC:10765	details
hsa-miR-3672	SLC4A1	solute carrier family 4 member 1 (Diego blood group)	HGNC:11027	details
hsa-miR-3672	SMAGP	small cell adhesion glycoprotein	HGNC:26918	details
hsa-miR-3672	SMIM7	small integral membrane protein 7	HGNC:28419	details
hsa-miR-3672	SNAP47	synaptosome associated protein 47	HGNC:30669	details
hsa-miR-3672	SRCAP	Snf2 related CREBBP activator protein	HGNC:16974	details
hsa-miR-3672	SYAP1	synapse associated protein 1	HGNC:16273	details
hsa-miR-3672	TAOK1	TAO kinase 1	HGNC:29259	details
hsa-miR-3672	TIMM50	translocase of inner mitochondrial membrane 50	HGNC:23656	details
hsa-miR-3672	TKFC	triokinase and FMN cyclase	HGNC:24552	details
hsa-miR-3672	TRIM38	tripartite motif containing 38	HGNC:10059	details
hsa-miR-3672	TRMT2B	tRNA methyltransferase 2 homolog B	HGNC:25748	details
hsa-miR-3672	TTLL12	tubulin tyrosine ligase like 12	HGNC:28974	details
hsa-miR-3672	TTL	tubulin tyrosine ligase	HGNC:21586	details
hsa-miR-3672	VSNL1	visinin like 1	HGNC:12722	details
hsa-miR-3672	VSTM4	V-set and transmembrane domain containing 4	HGNC:26470	details
hsa-miR-3672	WDR82	WD repeat domain 82	HGNC:28826	details
hsa-miR-3672	ZNF417	zinc finger protein 417	HGNC:20646	details
hsa-miR-3672	ZNF554	zinc finger protein 554	HGNC:26629	details
hsa-miR-3672	UQCRFS1	ubiquinol-cytochrome c reductase, Rieske iron-sulfur polypeptide 1	HGNC:12587	details

miRNA Card

Confidence 3 (3 of 3 tools predicted)

Confidence 2 (2 of 3 tools predicted)

Confidence 1 (1 of 3 tools predicted)